CN104498499A - Corn tissue specificity promoter and applications thereof - Google Patents

Abstract

The invention discloses a corn tissue specificity promoter and applications thereof, and belongs to the field of separation and applications of plant tissue specificity promoters. The invention firstly discloses the tissue specificity promoter as shown by nucleotide sequence SEQ ID NO.1 separated from corn, and the tissue specificity promoter sequence is further truncated to obtain a truncated promoter segment as shown by SEQ ID NO.2 or SEQ ID NO.3 still with the promoter function. The invention further discloses the applications of the tissue specificity promoter or the truncated promoter segment in aspects of enhancing crop seed quality, improving crop characters and cultivating new varieties of transgenic plants and the like.

Description

Corn tissue's specificity promoter and application thereof

Technical field

The present invention relates to a kind of promotor be separated from plant, particularly relate to the tissue-specific promoter be separated from corn (Zea mays), the invention further relates to the recombinant plant expression vector containing this tissue-specific promoter and recombinant host cell, the invention further relates to them improving the application in crop seed quality, Crop Improvement proterties, the new variety that cultivate plants etc., belonging to separation and the Application Areas thereof of plant tissue specificity promoter.

Background technology

Promotor is the DNA sequence dna of RNA polymerase specific recognition and combination, is important cis-acting elements, is generally positioned at structure gene 5 ' and holds upstream.Higher plant gene regulation and control are mainly carried out at transcriptional level, promotor controls initial time and the expression degree of genetic expression, also decisive role is played to used RNA polymerase type simultaneously, so promotor understands the key of gene expression pattern and transcription regulation mechanism, it is the center of plant gene transcription regulation and control.

According to transcriptional profile and the function of promotor, can be divided three classes: constitutive promoter, tissue-specific promoter and inducible promoter.At present, the great majority used in plant genetic engineering are constitutive promoter, make external source goal gene at each tissue site high level expression of plant, but constitutive promoter also has shortcomings, such as, the expression of goal gene effectively can not be regulated and controled from Time and place, consume intracellular matter and energy (Gittins JR excessively, Pellny TK, HilesER, Rosa C, Biricolti S, et al. (2000) Transgene expression driven byheterologous ribulose-1, 5-bisphosphate carboxylase/oxygenase small-subunitgene promoters in the vegetative tissues of apple (Malus pumila mill.) .Planta210:232-240.), a large amount of heterologous protein or meta-bolites are at plant interior accumulation, break the metabolic balance of plant, be unfavorable for plant-growth (Robinson DJ (1996) Environmental riskassessment of releases of transgenic plants containing virus-derived inserts.Transgenic research 5:359-362.), easily cause gene silencing or co-suppression phenomenon (Kumpatla SP, Chandrasekharan MB, Iyer LM, Guofu L, Hall TC (1998) Genome intruder scanning and modulation systems and transgene silencing.Trends in Plant Science 3:97-104, Mette MF, Aufsatz W, van der Winden J, Matzke MA, Matzke AJ (2000) Transcriptional silencing and promotermethylation triggered by double-stranded RNA.EMBO J 19:5194-5201.).Therefore, scientists constantly finds more efficiently tissue-specific promoter to replace constitutive promoter, to regulating and controlling the expression of foreign gene more accurately.

Gene transcription process under tissue-specific promoter's regulation and control generally only occurs in some specific tissue or organ.Tissue specificity expression promoter effectively can regulate and control the expression of foreign gene more economically, play a role at the position of specific needs specifically, so not only can improve the gene expression abundance of foreign gene, and biological energy consumption is dropped to minimum, thus not affect the normal growth of plant.

Corn (Zea mays) is the food crop of Largest In China, is also important genetically modified crops.Corn tissue's specificity promoter can be divided into the tissue-specific promoters such as root, stem, leaf, flower, embryo, endosperm, fruit, xylem, chlorenchyma, and the tissue-specific promoter of each type all has some special functional element.Be separated from corn and obtain tissue-specific promoter, can utilize specificity promoter that goal gene is carried out specific high expression in plant, this carries out molecular improvement or production to corn has the aspects such as the new corn variety of special purpose and has important meaning.

Summary of the invention

One of the object of the invention is to provide the tissue-specific promoter be separated from corn (Zea mays) or the promoter fragment still with promoter function will obtained after its brachymemma.

Two of the object of the invention is to provide the recombinant expression vector containing above-mentioned tissue-specific promoter or promoter fragment.

Three of the object of the invention described tissue-specific promoter or promoter fragment and the recombinant expression vector containing this tissue-specific promoter or promoter fragment is applied to build transgenic plant, improvement crop seeds proterties or cultivation and have the aspects such as the new variety of plant of good character.

For achieving the above object, the present invention provide firstly a kind of tissue-specific promoter of separation from corn (Zea mays), and its polynucleotide sequence is (a), (b), shown in (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.1; Or

(b), the polynucleotide of hybridizing can be carried out at stringent hybridisation conditions with the complementary sequence of SEQ ID NO.1, these polynucleotide still have function or the activity of tissue-specific promoter; Or

(c), to have the polynucleotide sequence of 60% or more homology at least with the polynucleotide sequence of SEQ ID NO.1, and these polynucleotide have function or the activity of tissue-specific promoter; Preferably, have the polynucleotide sequence of 80% or more homology at least with the polynucleotide sequence of SEQ ID NO.1, and these polynucleotide have function or the activity of tissue-specific promoter; Preferred, have the polynucleotide sequence of 90% or more homology at least with the polynucleotide sequence of SEQ IDNO.1, and these polynucleotide have function or the activity of tissue-specific promoter; Particularly preferred, have the polynucleotide sequence of 95% or more homology at least with the polynucleotide sequence of SEQ ID NO.1, and these polynucleotide have function or the activity of tissue-specific promoter; Or

D (), the disappearance that the basis of SEQ ID NO.1 is carried out one or more base, replacement or insertion also comprise the polynucleotide variant of SEQ ID NO.2 sequence, and this polynucleotide variant still has function or the activity of tissue-specific promoter.

Polynucleotide sequence shown in SEQ ID NO.1 holds deletion sequence gradually to obtain the sequence of multiple brachymemma from 5 ' by the present invention further, each sequence after brachymemma is connected respectively on the expression vector with reporter gene and verifies whether the sequence after brachymemma has the function of tissue specific promoter; The present invention is determined by functional verification experiment, reporter gene can be driven in corn seed embryo to carry out high expression the sequence of the 411bp shown in the SEQID NO.3 after 5 ' the terminal nucleotide sequence brachymemma of SEQ ID NO.1, illustrate that the promoter sequence after brachymemma shown in SEQ ID NO.3 still has the function of tissue-specific promoter.

The present invention is also further by the sequence of the 276bp shown in the SEQ IDNO.2 after the nucleotide sequence brachymemma of SEQ ID NO.1, this sequence still has the function starting reporter gene expression in embryo tissue, but its activity comparatively the activity of total length promotor (SEQ ID NO.1) obviously decline and almost lose.

Therefore, the invention provides a kind of by the promoter fragment after the tissue specific promoter brachymemma shown in SEQ ID NO.1, its polynucleotide sequence be (a), (b), shown in (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.2; Or

(b), the polynucleotide of hybridizing can be carried out at stringent hybridisation conditions with the complementary sequence of SEQ ID NO.2, these polynucleotide still have function or the activity of tissue-specific promoter; Or

(c), to have the polynucleotide sequence of 60% or more homology at least with the polynucleotide sequence of SEQ ID NO.2, and these polynucleotide have function or the activity of tissue-specific promoter; Preferably, have the polynucleotide sequence of 80% or more homology at least with the polynucleotide sequence of SEQ ID NO.2, and these polynucleotide have function or the activity of tissue-specific promoter; Preferred, have the polynucleotide sequence of 90% or more homology at least with the polynucleotide sequence of SEQ IDNO.2, and these polynucleotide have function or the activity of tissue-specific promoter; Particularly preferred, have the polynucleotide sequence of 95% or more homology at least with the polynucleotide sequence of SEQ ID NO.2, and these polynucleotide have tissue-specific promoter function or active or

D polynucleotide variant that (), the disappearance that the basis of SEQ ID NO.2 is carried out one or more base, replacement or insertion obtain, and this polynucleotide variant still has function or the activity of promotor.

Invention further provides a kind of promoter fragment will obtained after tissue specific promoter brachymemma shown in SEQ ID NO.1, its polynucleotide sequence be (a), (b), shown in (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.3; Or

(b), the polynucleotide of hybridizing can be carried out at stringent hybridisation conditions with the complementary sequence of SEQ ID NO.3, these polynucleotide still have function or the activity of tissue-specific promoter; Or

(c), to have the polynucleotide sequence of 60% or more homology at least with the polynucleotide sequence of SEQ ID NO.3, and these polynucleotide have function or the activity of tissue-specific promoter; Preferably, have the polynucleotide sequence of 80% or more homology at least with the polynucleotide sequence of SEQ ID NO.3, and these polynucleotide have function or the activity of tissue-specific promoter; Preferred, have the polynucleotide sequence of 90% or more homology at least with the polynucleotide sequence of SEQ IDNO.3, and these polynucleotide have function or the activity of tissue-specific promoter; Particularly preferred, have the polynucleotide sequence of 95% or more homology at least with the polynucleotide sequence of SEQ ID NO.3, and these polynucleotide have tissue-specific promoter function or active or

D polynucleotide variant that (), the disappearance that the basis of SEQ ID NO.3 is carried out one or more base, replacement or insertion obtain, and this polynucleotide variant still has function or the activity of tissue-specific promoter.

" replacement " described in the present invention refers to and replaces other base by different bases respectively; Described " disappearance " is the one or more base of hypodactylia; Described " insertion " refers to the change of Nucleotide, relative natural molecule, and described change is because adding caused by one or more base.

For the function of the tissue specific promoter that research the present invention is separated from corn, promotor shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 or the promoter sequence after brachymemma are connected with gus reporter gene is exercisable by the present invention, build and obtain recombinant plant expression vector; Take corn as acceptor material, adopt the Transient Expression System of via Particle Bombardment Transformation, recombinant plant expression vector is transformed in corn functional verification is carried out to promotor; Functional verification test-results shows, the gus gene of SEQ IDNO.1, SEQ ID NO.2 or the promoters driven shown in SEQ ID NO.3 only carries out specific expressed in the embryo of corn seed, in other tissue sites such as corn seed endosperm, root, stem, leaf, do not have GUS expression activity; Test-results confirms, the SEQID NO.1 that the present invention is separated from corn, SEQ ID NO.2 or the nucleotides sequence shown in SEQ ID NO.3 are classified as tissue-specific promoter or have the promoter sequence of promoter activity.

Invention further provides the recombinant plant expression vector containing described tissue-specific promoter and the host cell containing this recombinant plant expression vector.

Tissue-specific promoter of the present invention is carried out exercisable connection with heterologous gene to be transcribed, obtains the recombinant plant expression vector of specific expressed heterologous gene in crop seeds embryo.

Also selectable marker gene can be contained in described recombinant plant expression vector.

In addition, tissue-specific promoter of the present invention can be connected with flag sequence is exercisable the activity determining flag sequence, described flag sequence generally includes the gene providing antibiotics resistance or Herbicid resistant, such as: tetracycline resistance gene, hygromycin gene, careless glycosides phosphine or careless fourth phosphine resistant gene etc.

Can adopt the methods for plant transformation of any one the recombinant plant expression vector constructed by the present invention is transformed into recipient plant cell, tissue in, obtain transformant; To be regenerated by method for plant tissue culture by transformant again and obtain complete plant and clone thereof or its offspring; Described method for transformation comprises: Agrobacterium-medialed transformation, protoplast transformation, Ti-plasmids, Ri plasmid, plant viral vector, microinjection, electroporation, microparticle bombardment etc.; Described recipient plant comprises monocotyledons, dicotyledons; Preferably, described recipient plant is grass, the farm crop such as such as corn, paddy rice, barley, wheat or Chinese sorghum.

The tissue-specific promoter that the present invention is separated improving the quality of crop seed, improve plant trait, be widely used in the new variety that cultivate plants etc.

Heterologous gene exercisable and to be transcribed for tissue-specific promoter of the present invention is connected, instruct or regulate and control heterologous gene the to be transcribed embryo in plant seed and carry out specific expression, obtain transgenic plant or the new variety of plant with expection proterties; Such as, heterologous gene exercisable and to be transcribed for tissue-specific promoter of the present invention is connected (wherein, this heterologous gene to be transcribed also is connected with 3 ' non-coding region is exercisable, and 3 ' described non-coding region can comprise terminator sequence, mRNA cuts sequence etc.) obtain the recombinant plant expression vector can expressing this heterologous gene to be transcribed in embryo of plant seed.Heterologous gene to be transcribed is unrestricted, can be regulatory gene, the inverted defined gene of regulatory gene or the tiny RNA etc. that native gene can be disturbed to express; Described heterologous gene to be transcribed can be nucleic acid molecule from non-target gene species or gene, or originates from or be present in identical species through nucleic acid molecule that is artificial reconstructed or that modify or gene.

As a rule, heterologous gene to be transcribed mostly is Crop Improvement seed quality, improve Plant stress resistance, improve the genes involved of crop character or metabolism, such as, can be: improve plant physiology, the genes involved of g and D, improve the genes involved of output, nutrient-reinforced, improve stress resistance (such as, disease and insect resistance, drought-resistant, Salt And Alkali Tolerance, low temperature resistant) etc. genes involved, these genes or provide useful proterties for plant materials, or improve or improve crop seed quality, or promote seed embryo to grow or improve crop seed to environment stress resistance etc.Such as, can by iron in promotion crop seed, zinc, build after the exercisable and of the present invention tissue-specific promoter of related gene of accumulation of the trace element such as potassium is connected and obtain recombinant plant expression vector, this recombinant plant expression vector is transformed into after in recipient plant tissue or cell, tissue-specific promoter of the present invention can drive and promote iron in crop seed, zinc, the related gene of the accumulation of the trace element such as potassium carries out special high expression in crop seed embryo, iron in effective raising crop seed, zinc, the accumulation of the trace element such as potassium, reach the object improving crop seed quality.

the term definition arrived involved in the present invention

Unless otherwise defined, otherwise all technology used herein and scientific terminology all have with those skilled in the art usually understand identical implication.Although any method, device and the material similar or equivalent with person described herein can be used in practice of the present invention or test, preferred method, device and material are described now.

Term " homology " refers to the measurement being used as similarity between sequence at this; Sequence homology between two sequences is larger, then degree of hybridization is higher.Those skilled in the art adopt known method can measure crossbred and are formed.

Term " complementation " refers to the ability of perfect match between two Nucleotide.

Term " stringent hybridisation conditions " means low ionic strength known in the art and the condition of high temperature.Usually, under high stringency conditions, probe and its target sequence hybridize can detection level than with other sequence hybridization can detection level be higher (such as exceedes background at least 2 times.Stringent hybridisation conditions is sequence dependent, will be different under different envrionment conditionss, longer sequence specific hybrid at relatively high temperatures.The target sequence with probe 100% complementation can be identified by the preciseness or wash conditions that control hybridization.Detailed guidance for nucleic acid hybridization can with reference to related documents (Tijssen, Techniques inBiochemistry and Molecular Biology-Hybridization with Nucleic Probes, " Overview of principles of hybridization and the strategy of nucleic acidassays.1993).More specifically, described high stringency conditions is selected as usually lower than the heat fusion joint (T of distinguished sequence under regulation ionic strength pH _m) about 5-10 DEG C.T _mfor in the state of the equilibrium 50% with the probe hybridization of target complementation to temperature (specifying under ionic strength, pH and nucleic acid concentration) residing during target sequence (because of the excessive existence of target sequence, so at T _munder in the state of the equilibrium 50% probe be occupied).High stringency conditions can be following condition: wherein in pH 7.0 to 8.3 times salt concn lower than about 1.0M Na ion concentration, be generally about 0.01 to 1.0M Na ion concentration (or other salt), and temperature is at least about 30 DEG C for short probe (including, but is not limited to 10 to 50 Nucleotide), and is at least about 60 DEG C for long probe (including, but is not limited to be greater than 50 Nucleotide).The destabilizing agent of high stringency conditions also by adding such as methane amide realizes.For selectivity or specific hybrid, positive signal can be the background hybridization of at least twice, is optionally 10 times of background hybridizations.Exemplary stringent hybridisation conditions can be as follows: 50% methane amide, 5 × SSC and 1%SDS, cultivates at 42 DEG C; Or 5 × SSC, 1%SDS, cultivate at 65 DEG C, wash in 0.2 × SSC and wash in 0.1%SDS at 65 DEG C.Described washing can be carried out 5,15,30,60,120 minutes or the longer time.

Term " host cell " or " recombinant host cell " mean the cell comprising polynucleotide of the present invention, and no matter use which kind of method to carry out inserting to produce recombinant host cell, such as directly absorb, transduce, known other method in f pairing or affiliated field.Exogenous polynucleotide can remain the non-integrated vector of such as plasmid or can be integrated in host genome.

Term " polynucleotide " or " Nucleotide " mean the deoxyribonucleotide of sub-thread or bifilar form, dezyribonucleoside, ribonucleoside or ribonucleotide and polymkeric substance thereof.Except nonspecific restriction, otherwise the nucleic acid of the known analogue containing natural nucleotide contained in described term, and described analogue has the binding characteristic that is similar to reference nucleic acid and carries out metabolism in the mode of the Nucleotide being similar to natural generation.Unless other specific restriction, otherwise described term also means oligonucleotide analogs, and it comprises PNA (peptide nucleic acid(PNA)), DNA analogue used in antisense technology (thiophosphatephosphorothioate, phosphamide acid esters etc.).Unless otherwise, otherwise the specific nucleic acid sequence sequence that also impliedly contains its conservative varient (including, but is not limited to degenerate codon replace) of modifying and complementary sequence and clearly specify.Particularly, the 3rd sequence replaced through mixing base and/or deoxyinosine residue by producing one of them or more than one selected (or all) codon replaces to realize degenerate codon (people such as Batzer, Nucleic Acid Res.19:5081 (1991); The people such as Ohtsuka, J.Biol.Chem.260:2605-2608 (1985); With people such as Cassol, (1992); The people such as Rossolini, MolCell.Probes 8:91-98 (1994)).

Term " promotor " refers to the upstream being present in goal gene encoding sequence, provides the recognition site of RNA polymerase and the necessary other factors of correct transcription initiation, starts or instructs goal gene to be transcribed into mRNA.

Term " tissue-specific promoter ": regulation and control or the promotor driving goal gene specific expressed in the tissue.

Term " heterologous gene " refers to that this gene order belongs to external source to this specific host cell, if or carried out modifying or transformation to this original series from identical primary source.

Term " native gene ", from the gene of host itself, comprises DNA or RNA sequence.

Term " selectable marker gene ": the expression of this gene in vegetable cell gives this cell selective advantage can be because they and the growth phase ratio of non-transformed cell have the ability grown under the existence of negative selection agent (as: antibiotic or weedicide) by the selective advantage that these cells that these selected markers transform have.Selectable marker gene also refers to the combination of several genes, and their expression in vegetable cell give this cell negative and positive selective advantage.

Term " exercisable connection " refers to functional connection between two or more elements, and the element of exercisable connection can be adjacent or non-adjacent.

Term " conversion ": heterology DNA sequence dna is incorporated into host cell or organic method.

Term " expression ": endogenous gene or transgenosis transcribing and/or translating in vegetable cell.

Term " encoding sequence ": the nucleotide sequence being transcribed into RNA.

Term " plant expression vector ": one or more are for realizing the DNA vector of Plant Transformation; In this area, these carriers are often called as binary vector.Binary vector is mostly be usually used in agrobacterium-mediated conversion together with the carrier with helper plasmid.Binary vector generally includes: T-DNA transfer required for cis acting sequence, through through engineering approaches process selectable marker or heterologous gene etc. to be transcribed can be expressed in vegetable cell.

Accompanying drawing explanation

Fig. 1 RNA quality examination electrophorogram; R: root; S1, S2, S3: 4th, 3,2 sections stems; L1, L2, L3: 2nd, 4,6 leaves; SH1, SH2, SH3: 2nd, the leaf sheath of 4,6 leaves; SA: stem apex; T: male flower; EN: endosperm; E: embryo; K: seed.

The schematic diagram of Fig. 2 origin authentication carrier pCAMBIA3301.

The schematic diagram of Fig. 3 pEU66589-EZ.

The schematic diagram of Fig. 4 pUM3G intermediate carrier.

The schematic diagram of Fig. 5 expression vector pEU66589G3.

The transient expression result of Fig. 6 embryo-specific promoter; The development time of embryo is 20 days.

Fig. 7 tissue-specific promoter SEQ ID NO.1 (P _eU66589) start the stably express of gus gene in transgenic corn plant; (a)-(c): after being followed successively by pollination, the T1 of 15,20 days sprouts the rip cutting figure of three days for transgenic corns seed and mature seed; (d)-(f): the T1 in be followed successively by three leaves wholeheartedly period is for the root of transgenic corns, stem and blade; Wherein scheme (f) right half part for contrast; (g)-(i): be followed successively by the root of T1 for transgenic corns in typhon mouth period, stem and blade.

The transient expression result of Fig. 8 different lengths promoters driven reporter gene expression.

Fig. 9 p EU66589-1G3 stable expressed vector schematic diagram.

Figure 10 p EU66589-7G3 stable expressed vector schematic diagram.

The GUS colored graph that each deletion fragment of Figure 11 promotor is respectively organized for transgenic corns at T1; A GUS colored graph that the T1 of ()-(e): pEU66589-1G3 stable conversion respectively organizes for transgenic corns; F GUS colored graph that the T1 of ()-(k): pEU66589-7G3 stable conversion respectively organizes for transgenic corns; A ()/(b)/(f)/(g): the seed rip cutting of pollinating latter 30 days, (b)/(g) are negative contrast; (c)/(i): leaf sheath; (d)/(j): leaf; (e)/(k): root; (h): the square section being figure (i) coloured part of amplification 25 times.

Embodiment

Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiments are only exemplary, do not form any restriction to scope of the present invention.It will be understood by those skilled in the art that and can modify to the details of technical solution of the present invention and form or replace down without departing from the spirit and scope of the present invention, but these amendments and replacement all fall within the scope of protection of the present invention.

The Cloning and sequence analysis of embodiment 1 corn tissue specific promoter

1, microarray data is utilized to screen the promotor driving corn seed specific expression gene

The preparation of gene chip material: get the root of corn B73 typhon mouth phase, leaf, between stem and stem, ripening stage but the young fringe of not pollinating and filigree, totally 14 samples such as the Fetal liver cells of pollinating latter 10 days, 15 days, 20 days, 25 days, each sample type establishes 3 repetitions, utilizes gene chip (the Maize GenomeArray of Affymetrix company) to analyze the gene expression profile of 42 samples.

Bioinformatic analysis: adopt the method for information biology to carry out data analysis to 42 samples, find that a gene Zm66589 (promoter sequence of this gene is shown in SEQ ID NO.1) is in the middle and later periods of embryonic development respectively, specific great expression.

Table 1 utilizes gene microarray analysis gene (its promoter sequence the is SEQ ID NO.1) expression amount in different tissues

2, quantitative RT-PCR screening drives the promotor of embryo specific expression gene

Self-mating system B73 draws materials: the Fetal liver cells got the root of typhon mouth phase, stem, leaf, leaf sheath, stem apex and pollinate latter 10 days, 15 days, 20 days, 25 days.Wherein stem takes three sections of morphology upper end, and leaf and corresponding leaf sheath get the 2nd, 4,6 leaves from terminal number under morphology and leaf sheath respectively, and 3 repetitions established by each sample.

The extraction of RNA and cDNA obtain: by tissue sample after claying into power with the mortar of Liquid nitrogen precooler, take general TRIzol reagent extracting method to extract RNA.The quality of the RNA agarose gel electrophoresis of 1.5% detects, and electrophorogram is shown in Fig. 1.First remove DNA by the RNA consumption of the requirement of Reverse Transcription box (Promega company), then reverse transcription becomes cDNA.Reverse transcription 42 DEG C of incubations in PCR instrument, after 1 hour, add termination reaction in 25mM EDTA to each reaction system.Use after the cDNA sample mother liquor of each tissue all dilutes 25 times, the cDNA after the dilution of each reaction use 5 microlitre.Reference gene uses actin, and three parallel points are all done in target gene and each reaction of reference gene.Checking primer is in table 2.

Primer verified by table 2

Adopt real-time quantitative RT-PCR to verify the result of gene microarray analysis further, and verify the expression specificity of gene Zm66589 (promoter sequence of this gene is SEQ ID NO.1) in embryo and expression intensity.Find that the experimental result of the result of quantitative RT-PCR and gene microarray analysis is basically identical, this gene is mainly expressed in embryo.

Table 3 utilizes RT-PCR analyzing gene (its promotor SEQ ID NO.1) expression amount in different tissues

3, the clone of promotor

Using the 2.0kb sequence shown in SEQ ID NO.1 as the sequences Design cloning primer comprising " tissue specificity high expression level " promotor total length, designed cloning primer is as follows:

66589 f4 5-gaattcACATCCATCTGATCAACAATATTAGC-3；

66589 r4 5-ctgcagTCTTCGTCGCACGAGCTCAGCTAGCT-3；

With self-mating system B73 genomic dna for template, increased by high-fidelity DNA polymerase KOD and obtain object promotor clone, pcr amplification condition is as follows: 1,94 DEG C of 4min, 2,98 DEG C of 10sec, 3,61 DEG C of 30sec, 4,68 DEG C of 2min, 2-4 component loops 30 times, then 68 DEG C of 10mi.PCR cloned sequence is loaded on cloning vector pEASY-Blunt (purchased from Beijing Quanshijin Biotechnology Co., Ltd), errorless through sequence verification sequence, by novel vector called after pEU66589-EZ.

Test example 1 alternate promoters drives reporter gene specifically expressing test in maize

Plant expression vector construction: in order to verify whether the fragment of about the 2.0kb shown in SEQ ID NO.1 has tissue-specific promoter's function, fragment shown in SEQ ID NO.1 is cloned into the function that plant expression vector pCAMBIA3301 (purchased from Cambia company, http://www.cambia.org) (Fig. 2) verifies promotor.For the ease of clone, the multiple clone site of pCAMBIA3301 carrier is transformed by this test, with EcoR I and Pst I, double digestion is carried out to it, and this insert a synthesis containing multiple restriction enzyme site small segment (SEQ ID NO.3) (sequence is as follows), carry out alternative original multiple clone site and form intermediate carrier pUM3G:

5- GAATTC GGTACCCGGG(EcoR Ⅰ/Hind III/Kpn Ⅰ/Sma Ⅰ)

ctattgcggtgcaggctgccagagcggcggctgtgacgctgtctttgccggcgccatcaccgccaactccactcttctcgcagaatgatgatagatccaccatggttaacctagacttgtccatcttctggattggccaacttaattaatgtatgaaataaaaggatgcacacatagtgacatgctaatcactataatgtgggcatcaaagttgtgtgttatgtgtaattactagttatctgaataaaagagaaagagatcatccatatttcttatcctaaatgaatgtcacgtgtctttataattctttgatgaaccagatgcatttcattaaccaaatccatatacatataaatattaatcatatataattaatatcaattgggttagcaaaacaaatctag TCTAGACTGCAG CCATGGTAGATCT(Xba Ⅰ/Pst Ⅰ/Nco Ⅰ/BglⅡ)-3

Utilize EcoR I and Pst I to carry out enzyme to pEU66589-EZ (Fig. 3) and cut process, promoter fragment is connected into and cuts with EcoR I enzyme the pUM3G intermediate carrier (Fig. 4) cutting process with Pst I enzyme, obtain expression vector pEU66589G3 (Fig. 5), reporter gene is GUS.

The acquisition of converting material: consider that the transcript of most candidate gene is all reach maximum in about 20 days after corn pollination, therefore the young fringe of after corn pollination 20 days is got, remove bract and filigree, the clorox soaking disinfection sterilizing with 5% 30 minutes, then uses sterile water wash three times.In Bechtop, under aseptic condition, strip rataria with scalper, and rataria is concentrated be immersed in liquid MS medium to remove starch on embryo surface and to keep the vigor of embryo.To take after enough embryos again with liquid MS medium cleaning once, then transfer to that solid is high oozes that to cultivate upper high osmotic treatment 4 hours for subsequent use.9-12 rataria placed by every ware, and three embryo a line placement 3-4 are capable.

Transform: the making of micro-bullet and biolistic bombardment method reference (Rumei Chen et.al., 2008, Transgenic Res.17 (4): 633-43), just can split the specification that film changes 1100psi into.Once, each structure 2-3 parallel, and plasmid consumption is 1 microgram/rifle in every ware bombardment.Bombard latter one hour, then rataria to be transferred on recovery media 28 DEG C of light culture 24 hours.

GUS histochemical stain: by the corn transformation material transfer of light culture to aseptic 2 milliliters of centrifuge tubes (1 rifle/pipe) in Bechtop, often pipe adds 400 microlitre GUS dye liquors, button upper tube cap, lies in a horizontal plane in centrifuge tube in 37 DEG C of thermostat containers and is incubated at least 8 hours.The presence or absence of the painted spot of observation analysis rataria and the depth verify the function of the alternate promoters shown in SEQ ID NO.1.From test-results visible (Fig. 6), shown in SEQ ID NO.1, promoters driven gus reporter gene has the expression of high strength in maize.

The function of embryo-specific promoter identified further by stable conversion corn: stable conversion carrier pEU66589G3 (Fig. 5) has been transformed corn material Hi II with agriculture bacillus mediated method, obtain the plant of stable conversion, maize stable conversion process is as follows:

(1), get the pollination young fringe of Hi II of latter 10 days, first with the chlorine bleach liquor of sterilized water preparation 5%, immersion sterilizing 15min is carried out to young fringe, then use sterilized water soaking and washing three times.

(2), aseptically, strip length to be placed at the rataria of about 1.5mm-2.0mm the liquid being added with Syringylethanone and to infect substratum (culture medium prescription refers to paper MolecularBreeding, calendar year 2001, the 8th volume, the page number: 323 – 333) in.

(3), by prior on the YEB solid medium with corresponding resistant, cultivate 4 days be resuspended in containing the recombinant clone thalline scraping of object expression vector the liquid being added with Syringylethanone in right amount and infect in substratum at 28 DEG C, 28 DEG C of constant-temperature table low speed renewal cultivations are to OD ₂₆₀to 0.4-0.6.

(4), with liquid infect substratum and clean the rataria twice stripped, inhale and abandon scavenging solution, add OD ₂₆₀the thalline of=0.4-0.6 puts upside down mixing 20 times, leaves standstill 5min under being placed in dark condition.

(5), bacterium liquid is abandoned in suction, and infect with liquid the rataria twice that substratum cleaning contaminates, related second time scavenging solution is poured over the solidified co-cultivation medium of pressing without screening together with rataria, and (culture medium prescription refers to paper Molecular Breeding, calendar year 2001,8th volume, the page number: 323 – 333) on, rataria is evenly distributed on substratum, and the even surface of rataria is close to cultivation, arc is upward.

(6), inhale and abandon scavenging solution, cultivate 3 days under culture being placed in 25 DEG C of thermostat container dark conditions.The rataria of Dual culture after 3 days is aseptically transferred on the solid recovery media without screening pressure, under 28 DEG C of dark conditions, cultivate 7-10 days.

(7), by renewal cultivation grow fine and aseptic rataria derivative transfer to there is basta screening pressure screening culture medium on cultivate 1-2 month under screening 28 DEG C of dark conditions, every 2 weeks subcultures are once.

(8), after the kanamycin-resistant callus tissue having the speed of growth to be significantly higher than general callus occurs, bred necessarily, (culture medium prescription refers to paper Molecular Breeding a certain amount of kanamycin-resistant callus tissue to be transferred to the division culture medium with multiple hormone, calendar year 2001,8th volume, the page number: 323 – 333) cultivate about 2 weeks under upper 28 DEG C of dark conditions, induced synthesis embryoid.

(9), by embryoid transfer in solid root media, cultivate about 1 week under 28 DEG C of illumination conditions.To take root seedling, seedling is transferred to and fills in the cylindric culture tube of solid root media, cultivate about 1 week under 28 DEG C of illumination conditions.

(10), again the test-tube plantlet launching 2-3 sheet spire is transferred to and after illumination box cultivates about 1 week, namely can be transferred to greenhouse in the nutrition pot of nutritious soil and cultivate further and be finally transplanted to large Tanaka.

The situation that Fig. 6 drives gus gene to express for promotor shown in SEQ ID NO.1 at corn seed, can find that from Fig. 6 shown in SEQ ID NO.1, promotor can drive gus gene high expression level in maize, does not substantially have the expression of gus gene in other tissue.

As can be seen from (a)-(c) of Fig. 7, reporter gene is only expressed in the embryo tissue of different development stage, and promotor (P shown in SEQ ID NO.1 is described _eU66589) have embryo express activity.The GUS coloration result of nutritive issue never of the same period can be found out, reporter gene expression is only expressed at the position of the damaged of nutritive issue, this is a kind of characteristic expressed by mechanical induction, and other non-damage location does not then have painted, illustrates that reporter gene is not expressed.Therefore, result can find out (the P of promotor promotor shown in SEQID NO.1 accordingly _eU66589) be strict embryo organizing specific expression promotor under normal physiological conditions, but it has the characteristic at nutritive issue damaged abduction delivering simultaneously.

The separation of the shortest promotor of test example 2 and functional verification test thereof

Promotor shown in SEQ ID NO.1 is deleted the promoter fragment obtaining multiple brachymemma gradually from 5 ' end, and its length is respectively 1.3kb, 0.74kb, 0.41kb, 0.27kb, 0.25kb and 0.20kb; And then respectively the fragment of each brachymemma is connected into instantaneous checking carrier pCAMBIA3301 (purchased from Cambia company, http://www.cambia.org), verify whether the fragment of each brachymemma still has the function of promotor, to determine the shortest promoter sequence with expressive function.

As can be seen from Figure 8, truncated sequence promotor shown in SEQ ID NO.1 being deleted from 5 ' end 1.3kb, 0.74kb, 0.41kb and 0.27kb of obtaining gradually all can drive gus gene to express in corn seed embryo, and wherein 0.276kb (the shortest promoter fragment) is the fragment (SEQ ID NO.2) between-276-+1:

-276-+1 for having the minimal segment of function;

-244-+1 for not having the maximum segment of function; Both difference 32bp, comprise an a DOFCOREZM BOX and CAAT BOX in this 32bp.

Test-results confirms, the promoter fragment of the brachymemma shown in SEQ ID NO.2 can drive gus gene to carry out specific high expression in maize, proves that the fragment of the brachymemma shown in SEQ ID NO.2 still has promoter function.

The separation of test example 3 brachymemma promotor and functional verification test thereof

Promotor shown in SEQ ID NO.1 is deleted the promoter fragment obtaining brachymemma gradually, its length 411bp (SEQ ID NO.3) from 5 ' end; The 411bp fragment of this brachymemma is connected into stable expressed vector and obtains maize stable expression vector pEU66589-1G3 (Fig. 9); Stable conversion carrier pEU 66589-1G3 is transformed corn material Hi II with agriculture bacillus mediated method, obtains the plant (stable conversion method is with test example 1) of stable conversion.

Promotor brachymemma shown in SEQ ID NO.1 is obtained the promoter fragment after the brachymemma shown in SEQ ID NO.2, its length 276bp; The 276bp fragment of brachymemma is connected into stable expressed vector and obtains maize stable expression vector p EU66589-7G3 (Figure 10); Stable conversion carrier p EU66589-7G3 is transformed corn material Hi II with agriculture bacillus mediated method, obtains the plant (stable conversion method is with test example 1) of stable conversion.

Test-results is shown in Figure 11.Promoter deletion fragment SEQ ID NO.3 (P can be found out from Figure 11 (a) _eU66589-1) still there is the function starting reporter gene expression in embryo tissue, but its activity comparatively total length promotor SEQ ID NO.1 (P _eU66589) obviously decline.And promoter deletion fragment SEQ ID NO.3 (P can be found out from Figure 11 (c)-(e) _eU66589-1) expression of Reporter gene GUS can not be driven in nutritive issue, illustrate that it loses the characteristic of abduction delivering, thus obtain the characteristic of strict embryo specifically expressing.Comprehensive above each result can be found out, promoter deletion fragment SEQ ID NO.3 (P _eU66589-1) be the embryo tissue-specific promoter that a promoter activity reduces.

As can be seen from Figure 11 (f), promoter deletion fragment SEQ ID NO.2 (P _eU66589-7) still there is the function starting reporter gene expression in embryo tissue, but its activity comparatively total length promotor SEQID NO.1 (P _eU66589) obviously decline almost lose.And promoter deletion fragment SEQ ID NO.2 (P can be found out from Figure 11 (h)-(k) _eU66589-7) under normal physiological conditions, in each nutritive issue, all not there is promoter activity, but under physical abuse induction, show the characteristic of abduction delivering in nutritive issue, because colored spots only appears at the cross section of leaf and leaf sheath.Comprehensive above each result can be found out, under normal physiological conditions, and promoter deletion fragment SEQ ID NO.2 (P _eU66589-7) be the embryo tissue-specific promoter that a promoter activity obviously reduces, but the characteristic of abduction delivering is shown in nutritive issue under physical abuse induction.

Claims (9)

1. the tissue-specific promoter be separated from corn (Zea mays), is characterized in that, its polynucleotide are (a), (b), shown in (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.1; Or

(b), the polynucleotide sequence of hybridizing can be carried out at stringent hybridisation conditions with the complementary sequence of SEQ ID NO.1, these polynucleotide still have function or the activity of tissue-specific promoter; Or

(c), to have the polynucleotide sequence of 60% or more homology at least with the polynucleotide sequence of SEQ ID NO.1, and these polynucleotide have the function of tissue-specific promoter; Preferably, have the polynucleotide sequence of 80% or more homology at least with the polynucleotide sequence of SEQ IDNO.1, and these polynucleotide has the function of tissue-specific promoter; Preferred, have the polynucleotide sequence of 90% or more homology at least with the polynucleotide sequence of SEQ ID NO.1, and these polynucleotide have the function of tissue-specific promoter; Particularly preferred, have the polynucleotide sequence of 95% or more homology at least with the polynucleotide sequence of SEQ ID NO.1, and these polynucleotide have the function of tissue-specific promoter; Or

D (), the disappearance that the basis of SEQ ID NO.1 is carried out one or more base, replacement or insertion also comprise the polynucleotide variant of SEQ ID NO.2 sequence, and this polynucleotide variant still has the function of tissue-specific promoter.

2. the promoter fragment will obtained after the tissue-specific promoter's brachymemma be separated from corn of claim 1, is characterized in that, its polynucleotide sequence is (a), (b), shown in (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.2; Or

(b), the polynucleotide of hybridizing can be carried out at stringent hybridisation conditions with the complementary sequence of SEQ ID NO.2, these polynucleotide still have the function of promotor; Or

(c), to have the polynucleotide sequence of 60% or more homology at least with the polynucleotide sequence of SEQ ID NO.2, and these polynucleotide have the function of promotor; Preferably, have the polynucleotide sequence of 80% or more homology at least with the polynucleotide sequence of SEQ ID NO.2, and these polynucleotide has the function of promotor; Preferred, have the polynucleotide sequence of 90% or more homology at least with the polynucleotide sequence of SEQ ID NO.2, and these polynucleotide have the function of promotor; Particularly preferred, have the polynucleotide sequence of 95% or more homology at least with the polynucleotide sequence of SEQ ID NO.2, and these polynucleotide still have the function of promotor; Or

D polynucleotide variant that (), the disappearance that the basis of SEQ ID NO.2 is carried out one or more base, replacement or insertion obtain, and this polynucleotide variant still has the function of promotor.

3. the promoter fragment will obtained after the tissue-specific promoter's brachymemma be separated from corn of claim 1, is characterized in that, its polynucleotide sequence is (a), (b), shown in (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.3; Or

(b), the polynucleotide of hybridizing can be carried out at stringent hybridisation conditions with the complementary sequence of SEQ ID NO.3, these polynucleotide still have the function of promotor; Or

(c), to have the polynucleotide sequence of 60% or more homology at least with the polynucleotide sequence of SEQ ID NO.3, and these polynucleotide have the function of promotor; Preferably, have the polynucleotide sequence of 80% or more homology at least with the polynucleotide sequence of SEQ ID NO.3, and these polynucleotide has the function of promotor; Preferred, have the polynucleotide sequence of 90% or more homology at least with the polynucleotide sequence of SEQ ID NO.3, and these polynucleotide have the function of promotor; Particularly preferred, have the polynucleotide sequence of 95% or more homology at least with the polynucleotide sequence of SEQ ID NO.3, and these polynucleotide still have the function of promotor; Or

D polynucleotide variant that (), the disappearance that the basis of SEQ ID NO.3 is carried out one or more base, replacement or insertion obtain, and this polynucleotide variant still has the function of promotor.

4. containing the tissue-specific promoter of claim 1-3 described in any one or the recombinant plant expression vector of promoter fragment.

5. according to recombinant plant expression vector according to claim 4, it is characterized in that, comprise: the tissue-specific promoter of claim 1-3 described in any one or promoter fragment and heterologous gene to be transcribed; Wherein, described tissue-specific promoter or promoter fragment are operationally connected with heterologous gene to be transcribed, and heterologous gene to be transcribed is positioned at the downstream of described tissue-specific promoter.

6. according to recombinant plant expression vector according to claim 5, it is characterized in that: described heterologous gene is the gene improving or improve the gene of crop seed quality, the gene of promotion seed embryo growth or improve crop or crop seed stress resistance.

7. claim 1-3 tissue-specific promoter described in any one or promoter fragment in regulation and control, instruct or start heterologous gene and carry out specific expressed purposes in embryo of plant seed.

8. claim 1-3 tissue-specific promoter described in any one or promoter fragment are in the purposes improving crop seed quality, improvement plant trait or cultivate in transgenic plant new variety.

9. according to the purposes described in claim 7 or 8, it is characterized in that, comprising: the structure that the tissue-specific promoter of claim 1-3 described in any one or promoter fragment and heterologous gene to be transcribed is operably connected obtains plant recombination expression vector; By this plant recombination expression vector transformed plant cells, tissue, obtain transformant; Transformant is obtained complete plant or clone by tissue culture regenerates.