CN104498455A - Moderate neutral beta-glucosidase HiBgl3B for efficiently degrading soybean isoflavone as well as gene and application of moderate neutral beta-glucosidase HiBgl3B - Google Patents
Moderate neutral beta-glucosidase HiBgl3B for efficiently degrading soybean isoflavone as well as gene and application of moderate neutral beta-glucosidase HiBgl3B Download PDFInfo
- Publication number
- CN104498455A CN104498455A CN201410717927.7A CN201410717927A CN104498455A CN 104498455 A CN104498455 A CN 104498455A CN 201410717927 A CN201410717927 A CN 201410717927A CN 104498455 A CN104498455 A CN 104498455A
- Authority
- CN
- China
- Prior art keywords
- glucosidase
- hibgl3b
- beta
- gene
- neutral beta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the field of genetic engineering, and in particular relates to moderate neutral beta-glucosidase HiBgl3B for efficiently degrading soybean isoflavone as well as a gene and application of the moderate neutral beta-glucosidase HiBgl3B. The invention provides new moderate neutral beta-glucosidase HiBgl3B which has an amino acid sequence shown in SEQ ID NO.1 or 2, and the invention also provides a gene which is used for encoding the moderate neutral beta-glucosidase HiBgl3B and has a nucleotide sequence shown in SEQ ID NO.4 or 5, a recombinant vector and a recombinant strain containing the gene and an application of the moderate neutral beta-glucosidase HiBgl3B. The moderate neutral beta-glucosidase provided by the invention has the most important characteristic of unique substrate specificity, has recognition capability and hydrolytic activity to pNPG, genistin and daidzin, does not have activity to natural substrates of gentiobiose, cellobiose and amygdalin, and has very good research and application values.
Description
Technical field
The present invention relates to genetically engineered field, particularly, the present invention relates to a kind of neutral beta-glucosidase HiBgl3B of middle temperature of efficient degradation soybean isoflavones and gene thereof and application.
Background technology
Beta-glucosidase (beta-glucosidase, EC 3.2.1.21) be an important component part of cellulase system, specifically from single glucosyl residue the hydrolysis of oligosaccharide chain reducing end, it is the key enzyme that Mierocrystalline cellulose is thoroughly degraded to glucose.Meanwhile, because it can hydrolysis fiber disaccharides effectively, eliminate product accumulation to the restraining effect of dextranase, the hydrolytic action of beta-glucosidase is also the rate-limiting step of cellulose degradation process.
Beta-glucosidase all has a wide range of applications in a lot of field.Industrially, along with the substitute energy of bio-ethanol as safety environment protective receives increasing attention, the degraded of lignocellulose also receives much concern, and substantially increases the demand to beta-glucosidase in energy industry.In food service industry, glucoside bond containing alkyl and aromatic base and oligosaccharide etc. can be hydrolyzed, as by the glucosides class Substance P hydrolysis containing aromatic nucleus in food, discharge the aromatics with strong fragrance, thus improve flavour of food products.In feed and Medicines and Health Product industry, beta-glucosidase can the natural glucosides such as effectively hydrolyzing soybean isoflavones, realizes the glucosides of inactive and has bio-transformation between bioactive aglycon, playing various biological function.
Beta-glucosidase wide material sources, are all found in plant, animal, microorganism.Beta-glucosidase microbe-derived now mainly concentrates on filamentous fungus, particularly Aspergillus and Trichoderma, becomes the main source of industrial beta-glucosidase.Beta-glucosidase HiBgl3B of the present invention derives from thermophilic fungus Humicola insolens, there is good zymologic property, its maximum feature is the substrate specificity of its uniqueness, it has recognition capability and hydrolytic activity for pNPG and Genistoside, daidzin, but to natural substrate gentiobiose, cellobiose and amygdalin non-activity, there is good investigation and application and be worth.
Summary of the invention
The object of this invention is to provide a kind of neutral beta-glucosidase of middle temperature of efficient degradation soybean isoflavones.
Another object of the present invention is to provide the gene of above-mentioned beta-glucosidase of encoding.
Another object of the present invention is to provide the recombinant vectors comprising said gene.
Another object of the present invention is to provide the recombinant bacterial strain comprising said gene.
Another object of the present invention is to provide a kind of gene engineering method preparing above-mentioned beta-glucosidase.
Another object of the present invention provides the application of above-mentioned beta-glucosidase.
The present invention is separated and obtains a kind of neutral beta-glucosidase HiBgl3B of the middle temperature with unique substrate specificity newly from humicola lanuginosa (Humicola insolens), and construct can the restructuring yeast strains of this beta-glucosidase of high expression.
The invention provides warm neutral beta-glucosidase HiBgl3B in one, its amino bases sequence is as shown in SEQ ID NO.1.
SEQ ID NO.1：
MGHHTATVCLWLALGSLTPVSFARVVEPRDPVPQGYHAASYYPAPHGGWVSSWREAYEKAYALVSQMTLAEKVNITSGVGIYMGPCVGNTGSVDRLGFPQLCLQDSALGVASADNVTAFPAGITTGATWDKQLMYARGVAIGKEFRGKGANIHLGPSVGPLGRKPLGGRNWEGFGSDPVLQGKAAALHIRGVQEQGIIATIKHLVGNEQEMYRMYHIFQEGYSANIDDRTLHELYLWPFAEAVRAGVGAAMTAYNAVNGSACSQNSYLINGILKDELGFQGLVMSDWLSHISGVGSALAGLDLNMPGDTNIPLFGNSLWQYELTRAVLNGSVPVDRLNDMATRVVATWYKFGQDKNHPRPNFSSNTRSRDGPLYPGALFSPSGQVNWFVNVQEDHYLVARQVAQDAITLLKNNDSLLPLDAGDLTGGKLSVFGTDAQVNPDGPNSCLARACNKGTLGMGWGSGIADYPYMDDPIGAIRKRVPDVKFYNTDSFPWFFGTPENDEVAMVFISSDSGENTLTVEGNHGDRDSAKLRAWHDGDKLVQKVAEKFKNVIVVVHTVGPLDLEPWIELPSVKAVLFAHLPGQEAGESLTNVLFGDVSPSGHLPYSITRKASDLPDSIANLKGFTWGQVQDTYSEGLYIDYRYLQKHSIQPRFAFGHGLSYTNFSFTNATIRAITTPLSVTPPAPPATRPASVVAKYSTDIPPASEAYEPAGFSRIWRYLYPWLSKSDADAAHAIGTSKSKTYPYPPGYSTVQRASFPPAGGGEGGNPALWDVAYEVTVRVTNTGKRPGKASAQLYLQFPEGIEYDTPVLQLRDFEKTKELQPGESQELKLTLTRKDVSVWDVRRQNWVVPTAIDDKKGFTAWVGEASDKLKVACYTGEGRCVEGAKQPV
Wherein, this enzyme comprises 891 amino acid, and N holds 23 amino acid to be signal peptide sequence " MGHHTATVCLWLALGSLTPVSFA " (SEQ ID NO.3).
Therefore, the theoretical molecular of ripe beta-glucosidase HiBgl3B is 94.58kDa, and its aminoacid sequence is as shown in SEQ ID NO.2:
RVVEPRDPVPQGYHAASYYPAPHGGWVSSWREAYEKAYALVSQMTLAEKVNITSGVGIYMGPCVGNTGSVDRLGFPQLCLQDSALGVASADNVTAFPAGITTGATWDKQLMYARGVAIGKEFRGKGANIHLGPSVGPLGRKPLGGRNWEGFGSDPVLQGKAAALHIRGVQEQGIIATIKHLVGNEQEMYRMYHIFQEGYSANIDDRTLHELYLWPFAEAVRAGVGAAMTAYNAVNGSACSQNSYLINGILKDELGFQGLVMSDWLSHISGVGSALAGLDLNMPGDTNIPLFGNSLWQYELTRAVLNGSVPVDRLNDMATRVVATWYKFGQDKNHPRPNFSSNTRSRDGPLYPGALFSPSGQVNWFVNVQEDHYLVARQVAQDAITLLKNNDSLLPLDAGDLTGGKLSVFGTDAQVNPDGPNSCLARACNKGTLGMGWGSGIADYPYMDDPIGAIRKRVPDVKFYNTDSFPWFFGTPENDEVAMVFISSDSGENTLTVEGNHGDRDSAKLRAWHDGDKLVQKVAEKFKNVIVVVHTVGPLDLEPWIELPSVKAVLFAHLPGQEAGESLTNVLFGDVSPSGHLPYSITRKASDLPDSIANLKGFTWGQVQDTYSEGLYIDYRYLQKHSIQPRFAFGHGLSYTNFSFTNATIRAITTPLSVTPPAPPATRPASVVAKYSTDIPPASEAYEPAGFSRIWRYLYPWLSKSDADAAHAIGTSKSKTYPYPPGYSTVQRASFPPAGGGEGGNPALWDVAYEVTVRVTNTGKRPGKASAQLYLQFPEGIEYDTPVLQLRDFEKTKELQPGESQELKLTLTRKDVSVWDVRRQNWVVPTAIDDKKGFTAWVGEASDKLKVACYTGEGRCVEGAKQPV
The invention provides the above-mentioned beta-glucosidase gene Hibgl3B of coding.Particularly, the cDNA sequence of this gene is as shown in SEQ ID NO.4:
atgggtcatcacactgccaccgtatgcctctggctcgccctgggctccttgacgcccgtctcctttgcccgcgttgtcgagccccgcgatcctgttcctcaagggtatcatgctgcttcctactaccccgcgccccatggcggttgggtcagctcgtggcgcgaggcctacgaaaaagcctatgcactggtgtcgcagatgacgctggctgagaaggtgaacatcacatcgggcgttggcatttatatgggaccctgtgtaggaaataccgggagtgtggatcgtctcggcttcccccagctctgcctccaagacagcgctctcggcgtcgcctccgccgacaatgtcacggcttttcccgctggcattaccaccggtgccacctgggacaagcagttgatgtatgcccgaggcgtcgcgatcggcaaggagttccgcggcaagggcgccaatattcacttgggtccttcggttgggcccctcggccgcaagcccttgggcggccggaactgggagggctttggctccgacccggtgctccagggcaaggccgctgctctgcacatccgcggcgttcaggagcagggcattattgccaccattaagcaccttgtcggcaatgagcaggagatgtaccgcatgtaccacatttttcaggagggttacagcgccaacattgacgaccgtactctgcatgagctctacctctggcccttcgcggaggcagttcgtgctggagtgggagccgccatgacggcctacaatgccgtcaatggctccgcttgttcccagaacagttatctcatcaatggcattctcaaagacgaactcggcttccagggattggtcatgtcggactggctcagtcacatctcaggcgtgggctcggctctggccggtcttgacctcaacatgccgggcgatacaaacattcccttgtttggtaacagtctgtggcagtacgagctgactcgtgccgtcctgaacggctccgtgcctgtagacagactgaacgacatggccacgcgcgttgtggccacctggtacaagtttgggcaggataagaaccacccacggcccaacttctcatccaacactcgcagccgtgacgggcccctgtaccccggcgcccttttttctcccagcggtcaggtgaattggttcgtcaacgtccaggaggatcactatcttgtcgcccgccaggtggctcaagatgccatcacgctgctcaagaataacgacagcctcttgcctctggacgctggggatcttactggcggcaagctcagcgtcttcggcactgacgctcaagtcaaccccgatgggcccaactcctgcctagcacgggcttgtaacaaaggcactcttggcatgggttggggctcgggtatcgcggactatccgtacatggacgatcccatcggagccatccgcaagcgcgtccccgacgtcaagttctacaacacggacagctttccgtggttctttggcacgccggagaatgacgaggttgctatggtgttcatcagctccgactcgggagagaatacgctgacagtcgagggcaaccatggcgaccgcgactcggccaagctgagggcatggcacgacggtgacaagctcgtgcagaaggtggctgagaaattcaagaacgtaatcgtcgtcgtgcatacggttggtcccctggaccttgagccatggattgaacttccctcggtcaaagccgtcctctttgcccaccttcccggccaagaagccggcgagtctctgaccaacgtcctcttcggcgacgtctcgccgagtggccacctcccctactccatcactcgcaaggcctccgatctgcccgacagcatcgccaacctgaagggtttcacctggggccaagtccaagacacctactccgaagggctctacatcgactaccgctacctgcaaaagcactcgatccagccccgcttcgccttcggccacggcttgagctacaccaacttctccttcaccaatgccaccatccgcgccatcactacccccctatccgtcaccccgccagccccgccagccaccaggcccgcctcagtcgtcgctaaatactccaccgacatcccgcccgccagcgaagcctacgagcctgcaggcttctccaggatctggcgctacctctacccctggctgtccaaatccgacgccgacgccgcccacgctatcggcacgagcaagtccaaaacctacccctaccctcccggctattccaccgtgcagcgcgcgtctttccctcccgctggcggcggcgagggcggcaaccccgcgctctgggacgtggcatacgaggtgacggtgcgcgtcaccaacacgggcaagaggcccgggaaagcctcggcgcagctgtatctgcagttcccggaggggatcgagtacgatacccccgtactgcagctccgggatttcgagaagaccaaggagctccagccgggcgagagccaggagctgaagctgacattgacgaggaaggatgtcagcgtgtgggacgtgaggaggcagaactgggttgttccgacggcgattgacgacaagaaggggttcacggcgtgggtgggcgaggcgagcgataagttgaaggtggcgtgctacacgggtgaggggaggtgtgtggagggggcgaagcagccggtttga
The present invention is based on the method separating clone of PCR beta-glucosidase gene Hibgl3B, DNA complete sequence analysis result to show, remove the beta-glucosidase gene Hibgl3B cDNA total length 2676bp after intron.Wherein, the base sequence of signal peptide is:
atgggtcatcacactgccaccgtatgcctctggctcgccctgggctccttgacgcccgtctcctttgcc(SEQ IDNO.6)。
The gene order of ripe beta-glucosidase gene HiBgl3B is as shown in SEQ ID NO.5.
SEQ ID NO.5
cgcgttgtcgagccccgcgatcctgttcctcaagggtatcatgctgcttcctactaccccgcgccccatggcggttgggtcagctcgtggcgcgaggcctacgaaaaagcctatgcactggtgtcgcagatgacgctggctgagaaggtgaacatcacatcgggcgttggcatttatatgggaccctgtgtaggaaataccgggagtgtggatcgtctcggcttcccccagctctgcctccaagacagcgctctcggcgtcgcctccgccgacaatgtcacggcttttcccgctggcattaccaccggtgccacctgggacaagcagttgatgtatgcccgaggcgtcgcgatcggcaaggagttccgcggcaagggcgccaatattcacttgggtccttcggttgggcccctcggccgcaagcccttgggcggccggaactgggagggctttggctccgacccggtgctccagggcaaggccgctgctctgcacatccgcggcgttcaggagcagggcattattgccaccattaagcaccttgtcggcaatgagcaggagatgtaccgcatgtaccacatttttcaggagggttacagcgccaacattgacgaccgtactctgcatgagctctacctctggcccttcgcggaggcagttcgtgctggagtgggagccgccatgacggcctacaatgccgtcaatggctccgcttgttcccagaacagttatctcatcaatggcattctcaaagacgaactcggcttccagggattggtcatgtcggactggctcagtcacatctcaggcgtgggctcggctctggccggtcttgacctcaacatgccgggcgatacaaacattcccttgtttggtaacagtctgtggcagtacgagctgactcgtgccgtcctgaacggctccgtgcctgtagacagactgaacgacatggccacgcgcgttgtggccacctggtacaagtttgggcaggataagaaccacccacggcccaacttctcatccaacactcgcagccgtgacgggcccctgtaccccggcgcccttttttctcccagcggtcaggtgaattggttcgtcaacgtccaggaggatcactatcttgtcgcccgccaggtggctcaagatgccatcacgctgctcaagaataacgacagcctcttgcctctggacgctggggatcttactggcggcaagctcagcgtcttcggcactgacgctcaagtcaaccccgatgggcccaactcctgcctagcacgggcttgtaacaaaggcactcttggcatgggttggggctcgggtatcgcggactatccgtacatggacgatcccatcggagccatccgcaagcgcgtccccgacgtcaagttctacaacacggacagctttccgtggttctttggcacgccggagaatgacgaggttgctatggtgttcatcagctccgactcgggagagaatacgctgacagtcgagggcaaccatggcgaccgcgactcggccaagctgagggcatggcacgacggtgacaagctcgtgcagaaggtggctgagaaattcaagaacgtaatcgtcgtcgtgcatacggttggtcccctggaccttgagccatggattgaacttccctcggtcaaagccgtcctctttgcccaccttcccggccaagaagccggcgagtctctgaccaacgtcctcttcggcgacgtctcgccgagtggccacctcccctactccatcactcgcaaggcctccgatctgcccgacagcatcgccaacctgaagggtttcacctggggccaagtccaagacacctactccgaagggctctacatcgactaccgctacctgcaaaagcactcgatccagccccgcttcgccttcggccacggcttgagctacaccaacttctccttcaccaatgccaccatccgcgccatcactacccccctatccgtcaccccgccagccccgccagccaccaggcccgcctcagtcgtcgctaaatactccaccgacatcccgcccgccagcgaagcctacgagcctgcaggcttctccaggatctggcgctacctctacccctggctgtccaaatccgacgccgacgccgcccacgctatcggcacgagcaagtccaaaacctacccctaccctcccggctattccaccgtgcagcgcgcgtctttccctcccgctggcggcggcgagggcggcaaccccgcgctctgggacgtggcatacgaggtgacggtgcgcgtcaccaacacgggcaagaggcccgggaaagcctcggcgcagctgtatctgcagttcccggaggggatcgagtacgatacccccgtactgcagctccgggatttcgagaagaccaaggagctccagccgggcgagagccaggagctgaagctgacattgacgaggaaggatgtcagcgtgtgggacgtgaggaggcagaactgggttgttccgacggcgattgacgacaagaaggggttcacggcgtgggtgggcgaggcgagcgataagttgaaggtggcgtgctacacgggtgaggggaggtgtgtggagggggcgaagcagccggtttga
Maturation protein theoretical molecular is 94.58kDa, ripe for beta-glucosidase gene Hibgl3B encoding sequence and the aminoacid sequence derived is carried out BLAST comparison, determines that HiBgl3B is a kind of new beta-glucosidase.
The invention provides the recombinant vectors comprising above-mentioned beta-glucosidase gene Hibgl3B, elect pPIC-Hibgl3B as.Beta-glucosidase gene of the present invention is inserted between the suitable restriction enzyme site of expression vector, makes that its nucleotide sequence is exercisable to be connected with expression regulation sequence.As the most preferred embodiment of the present invention, be preferably and beta-glucosidase gene of the present invention be inserted between EcoR I on plasmid pPIC9 and Not I restriction enzyme site, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulate and control by it, obtain expression of recombinant yeast plasmid pPIC9-Hibgl3B.
Present invention also offers the recombinant bacterial strain comprising above-mentioned beta-glucosidase gene Hibgl3B, preferred described bacterial strain is intestinal bacteria, yeast, is preferably recombinant bacterial strain Hibgl3B.
Present invention also offers a kind of method preparing beta-glucosidase gene HiBgl3B, comprise the following steps:
1) with above-mentioned recombinant vectors transformed host cell, recombinant bacterial strain is obtained;
2) cultivate recombinant bacterial strain, induction restructuring beta-glucosidase gene HiBgl3B expresses;
3) the beta-glucosidase gene HiBgl3B also expressed by purifying is reclaimed.
Wherein, preferred described host cell is Pichia pastoris, cerevisiae or many types of inferior yeast cell, preferably by expression of recombinant yeast Plastid transformation Pichia pastoris (Pichia pastoris) GS115, obtain recombinant bacterial strain GS115/Hibgl3B.
Present invention also offers the application of above-mentioned beta-glucosidase HiBgl3B.To the degradation experiment of soybean isoflavones, show that beta-glucosidase HiBgl3B can efficient degradation soybean isoflavones, be translated into three kinds of active aglycones, degradation rate reaches more than 90%.When adding the beta-glucosidase of equal unit of enzyme, HiBgl3B successful is much better than the beta-glucosidase of other originated from fungus, and its special substrate selective makes it be more suitable for soybean isoflavones of degrading.
Accompanying drawing explanation
The optimal pH of Fig. 1 beta-glucosidase.
Fig. 2 recombinates the pH stability of beta-glucosidase.
Fig. 3 recombinates the optimum temperuture of beta-glucosidase.
Fig. 4 recombinates the thermostability of beta-glucosidase.
Embodiment
Test materials and reagent
1, bacterial strain and carrier: the present invention is separated and obtains a kind of new beta-glucosidase HiBgl3B from humicola lanuginosa (Humicola insolens Y1CGMCC 4573).Yeast expression vector pPIC9 and bacterial strain GS115 is purchased from Invitrogen company.
2, enzyme and other biochemical reagents: restriction endonuclease is purchased from TaKaRa company, and ligase enzyme is purchased from Invitrogen company.Birch xylan available from Sigma, other is all domestic reagent (all can buy from common biochemical Reagent Company and obtain).
3, substratum:
(1) humicola lanuginosa (Humicola insolens Y1CGMCC 4573) substratum is potato juice substratum: 1000mL potato juice, 10g glucose, 25g agar, pH nature.
(2) Escherichia coli culture medium LB (1% peptone, 0.5% yeast extract, 1%NaCl, pH nature).
(3) BMGY substratum: 1% yeast extract, 2% peptone, 1.34%YNB, 0.00004%Biotin, 1% glycerine (V/V).
(4) BMMY substratum: replace glycerine divided by 0.5% methyl alcohol, all the other compositions are all identical with BMGY, pH nature.
Illustrate: in following examples, do not make the experimental methods of molecular biology illustrated, concrete grammar listed in equal reference " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book carries out, or carries out according to test kit and product description.
The clone of embodiment 1 humicola lanuginosa (Humicola insolens) beta-glucoside enzyme coding gene bgl3B
Design gene-specific primer:
PF:GGG
GAATTCCGCGTTGTCGAGCCCCGCGATC
PR:GGG
GCGGCCGCTCAAACCGGCTGCTTCGCCCCCTC
Extract humicola lanuginosa Humicola insolens Y1CGMCC 4573RNA, reverse transcription obtains cDNA.With Humicola insolens Y1CGMCC 4573cDNA for template carries out pcr amplification.PCR reaction parameter is: 94 DEG C of sex change 5min; Then 94 DEG C of sex change 30sec, 60 DEG C of annealing 30sec, 72 DEG C extend 2min30s, 35 rear 72 DEG C of insulation 10min of circulation.Obtain an about 2600bp fragment, the Bioisystech Co., Ltd of Song Rui Boxing section that is connected with pEASY-T3 carrier after this fragment being reclaimed checks order.
Sequencing result is beta-glucosidase gene Hibgl3B gene 2607bp (removal signal peptide), encode 868 amino acid and a terminator codon.Predict that the theoretical molecular of the maturation protein of this coded by said gene is 94.58kDa.
The preparation of embodiment 2 recombined xylanase
Expression vector pPIC9 is carried out double digestion (EcoR I+Not I), simultaneously by the gene bgl3B double digestion (EcoR I+Not I) of encoding beta-glucosidase Bgl3B, the gene fragment (not comprising signal peptide sequence) cutting out encoding mature beta-glucosidase is connected with expression vector pPIC9, obtain the recombinant plasmid pPIC-Hibgl3B containing humicola lanuginosa (Humicola insolens Y1CGMCC 4573) beta-glucosidase gene Hibgl3B and transform Pichia pastoris GS115, obtaining recombinant pichia yeast strain GS115/Hibgl3B.
Build the expression vector containing signal peptide sequence in the same way, and transform pichia spp.
Get the GS115 bacterial strain containing recombinant plasmid, be inoculated in 400mL BMGY nutrient solution, after 30 DEG C of 250rpm shaking culture 48h, collected by centrifugation thalline.Then resuspended in 200mL BMMY substratum, 30 DEG C of 250rpm shaking culture.After induction 48h, collected by centrifugation supernatant.Measure the vigor of beta-glucosidase.SDS-PAGE result shows, restructuring beta-glucosidase obtains expression in pichia spp.
Embodiment 3 is recombinated the activation analysis of beta-glucosidase
The mensuration of activity of beta-glucosidase: the amount measuring the product p-NP (pNP) that enzymic hydrolysis substrate pNPG generates under 405nm.
Reactions steps: 125 μ l 2mM pNPG substrates and 125 μ l damping fluids mix, and add the enzyme liquid that 250 μ l suitably dilute, in 60 DEG C of reaction 10min, adds the Na of 1.5mL 1M
2cO
3termination reaction, uses spectrophotometric determination OD
405value.
The definition of Mei Huo unit: 1 activity of beta-glucosidase unit (U) is defined as under the given reaction conditions, per minute decomposition substrate pNPG generates the enzyme amount needed for 1 μm of ol p-NP (pNP).
Embodiment 4 is recombinated the property testing of beta-glucosidase
Measure the character that embodiment 2 obtains restructuring beta-glucosidase HiBgl3B
The measuring method of the optimal pH of beta-glucosidase HiBgl3B and the pH stability of 1, recombinating is as follows:
The restructuring beta-glucosidase HiBgl3B of embodiment 2 purifying is carried out enzymatic reaction to measure its optimal pH under different pH.Substrate pNPG carries out beta-glucoside enzyme activity determination with in the 0.1mol/L citrate-phosphate disodium hydrogen damping fluid of different pH 50 DEG C.Result (Fig. 1) shows, the optimal pH of beta-glucosidase HiBgl3B is 6.0.Beta-glucosidase is 37 DEG C of process 60min in the damping fluid of above-mentioned various different pH, then in pH6.0 buffer solution system, measure enzymic activity at 50 DEG C, with the pH stability of studying enzyme.Result (Fig. 2) shows the pH tolerance of beta-glucosidase HiBgl3B.
2, the optimum temperuture of beta-glucosidase HiBgl3B and thermal stability determination method as follows:
Being determined as of optimum temperuture of beta-glucosidase carries out enzymatic reaction under citrate-phosphate disodium hydrogen damping fluid (pH6.0) buffer solution system and differing temps.Temperature tolerance is determined as beta-glucosidase and processes different time at different temperatures, then carries out enzyme assay under optimum temperuture.Enzyme reaction optimum temperuture measurement result (Fig. 3) shows that its optimum temperuture is 50 DEG C.The thermostability test of enzyme shows (Fig. 4), and beta-glucosidase HiBgl3B has good thermostability, incubation 1h at 50 DEG C, enzyme can be kept to live and do not reduce.
3, the enzyme kinetics measuring method of beta-glucosidase HiBgl3B is as follows:
Be substrate with the pNPG of different concns, in citrate-phosphate disodium hydrogen damping fluid (pH4.5) buffer solution system, at 50 DEG C, measure enzymic activity, calculate its K at 50 DEG C
mvalue.After measured, K when taking pNPG as substrate
mvalue is 1.51mM, maximum reaction velocity V
maxbe 25.53 μm of ol/minmg.
4, different metal ion chemistry reagent is determined as follows the impact that beta-glucosidase HiBgl3B enzyme is lived:
In enzymatic reaction system, add different metal ions and the chemical reagent of different concns, study its impact on enzymic activity, various material final concentration is 5mmol/L.50 DEG C, measure enzymic activity under pH6.0 condition.Result shows, most of ion and the chemical reagent vigor on restructuring beta-glucosidase does not affect, but SDS and Ag+ seriously suppresses its enzyme activity, shows the enzyme activity of under optimum condition 5% and 24% respectively.
5, the substrate specificity of restructuring beta-glucosidase HiBgl3B
To substrates such as multiple polysaccharide, natural glucosides and synthetics pNPG, under optimum condition, measure enzyme activity, the substrate specificity of research beta-glucosidase HiBgl3B.Result is as shown in table 2.Compare most of beta-glucosidase, the HiBgl3B that humicola lanuginosa (Humicola insolens) is originated has very unique substrate specificity, and it can not be hydrolyzed natural substrate cellobiose, the gentiobiose and amygdalin etc. of such lytic enzyme.Find through amino acid sequence analysis, HiBgl3B there occurs sudden change, so guess that the change of its substrate specificity is because substrate can not correct combination in multiple crucial aromatic amino acid residue site that there is molecular interaction with substrate+1 glucose molecule.
Table 1. beta-glucosidase HiBgl3B substrate specificity is analyzed
The embodiment 5 beta-glucosidase encoding gene Hibgl3B that recombinates degrades soybean isoflavones effect experimental
Soybean isoflavones comprises daidzein, genistein and Daidezin 3 kinds of isoflavones, and the natural glucosides that they and glucose, acetyl glucosamine and malonyl-glucose form with 9 kinds of iso-flavone glucosides that β-glycosidic link is formed.Beta-glucosidase effectively can cut off the β-glycosidic link between isoflavone genin and glucose, thus soybean isoflavone glycoside is converted into there is bioactive active aglycone, there is good using value for isoflavones extract drugs and animal health.
Take the bean cake powder that 10g crosses 40 mesh sieves, add 30ml water and stir, adjust pH to appropriate pH, add 3U beta-glucosidase by every gram of dregs of beans, after 37 DEG C of waters shaking table hydrolysis 1h, add 100ml dehydrated alcohol, 70 DEG C of extraction 2h, obtain soybean isoflavones extracting solution, carry out HPLC quantitative analysis.Beta-glucosidase selects 3 family's beta-glucosidases of HiBgl3B and two other originated from fungus, to compare.
Table 2. beta-glucosidase HiBgl3B hydrolyzed soy bean isoflavone
Visible, HiBgl3B can efficient degradation soybean isoflavones, and be translated into three kinds of active aglycones, degradation rate reaches more than 90%.When adding the beta-glucosidase of equal unit of enzyme, HiBgl3B successful is much better than the beta-glucosidase of other originated from fungus, its possible cause is that HiBgl3B there occurs sudden change to substrate+1 glucose molecule in conjunction with relevant critical amino acid residues site multiple, thus show very unique substrate specificity, without disaccharides substrate active, but right+1 aglucon be the soybean isoflavones substrate enzyme activity of phenyl ring higher than other beta-glucosidases, this special substrate selective make its be more suitable for degrade soybean isoflavones.
Claims (8)
1. the neutral beta-glucosidase HiBgl3B of the middle temperature of efficient degradation soybean isoflavones, is characterized in that, its amino bases sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.
2. the neutral beta-glucosidase gene Hibgl3B of the middle temperature of efficient degradation soybean isoflavones, is characterized in that, encode beta-glucosidase HiBgl3B according to claim 1.
3. beta-glucosidase gene Hibgl3B as claimed in claim 2, it is characterized in that, its base sequence is as shown in SEQ ID NO.4 or SEQ ID NO.5.
4. comprise the recombinant vectors of beta-glucosidase gene Hibgl3B described in claim 2.
5. comprise the recombinant vectors pPIC-Hibgl3B of beta-glucosidase gene Hibgl3B described in claim 2.
6. comprise the recombinant bacterial strain of beta-glucosidase gene Hibgl3B described in claim 2.
7. prepare a method of restructuring beta-glucosidase HiBgl3B, it is characterized in that, comprise the following steps:
1) with the recombinant vectors transformed host cell of claim 4, recombinant bacterial strain is obtained;
2) cultivate recombinant bacterial strain, induction restructuring beta-glucosidase HiBgl3B expresses;
3) the beta-glucosidase HiBgl3B also expressed by purifying is reclaimed.
8. the application of beta-glucosidase HiBgl3B described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410717927.7A CN104498455B (en) | 2014-12-01 | 2014-12-01 | A kind of middle temperature neutral beta glucuroide HiBgl3B of efficient degradation isoflavones and its gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410717927.7A CN104498455B (en) | 2014-12-01 | 2014-12-01 | A kind of middle temperature neutral beta glucuroide HiBgl3B of efficient degradation isoflavones and its gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104498455A true CN104498455A (en) | 2015-04-08 |
| CN104498455B CN104498455B (en) | 2017-08-04 |
Family
ID=52939907
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410717927.7A Active CN104498455B (en) | 2014-12-01 | 2014-12-01 | A kind of middle temperature neutral beta glucuroide HiBgl3B of efficient degradation isoflavones and its gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104498455B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567663A (en) * | 2016-01-28 | 2016-05-11 | 中国农业科学院饲料研究所 | Beta-glucosidase mutant F67Y with improved catalyst efficiency and encoding gene and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789331A (en) * | 2013-04-26 | 2014-05-14 | 中山大学 | Beta-glucosidase gene for efficiently hydrolyzing soybean isoflavone glycoside and application thereof |
-
2014
- 2014-12-01 CN CN201410717927.7A patent/CN104498455B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789331A (en) * | 2013-04-26 | 2014-05-14 | 中山大学 | Beta-glucosidase gene for efficiently hydrolyzing soybean isoflavone glycoside and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| 孙正博等: "大豆异黄酮β-葡萄糖苷酶产生菌的选育及产酶条件研究", 《饲料工业》 * |
| 孙艳梅等: "黑曲霉β-葡萄糖苷酶水解大豆异黄酮糖苷研究", 《东北农业大学学报》 * |
| 许晶等: "里氏木霉β-葡萄糖苷酶水解大豆异黄酮糖苷的工艺研究", 《中国粮油学报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567663A (en) * | 2016-01-28 | 2016-05-11 | 中国农业科学院饲料研究所 | Beta-glucosidase mutant F67Y with improved catalyst efficiency and encoding gene and application thereof |
| CN105567663B (en) * | 2016-01-28 | 2018-09-07 | 中国农业科学院饲料研究所 | The β-glucosidase mutants F67Y and its encoding gene and application that a kind of catalytic efficiency improves |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104498455B (en) | 2017-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Bifunctional family 3 glycoside hydrolases from barley with α-L-arabinofuranosidase and β-D-xylosidase activity: characterization, primary structures, and COOH-terminal processing | |
| Wymelenberg et al. | The Phanerochaete chrysosporium secretome: database predictions and initial mass spectrometry peptide identifications in cellulose-grown medium | |
| CN103275955B (en) | Xylosidase Xyl43B with high xylose tolerance, and gene and application thereof | |
| Zhang et al. | Molecular cloning and heterologous expression of a new xylanase gene from Plectosphaerella cucumerina | |
| Pauchet et al. | Identification and characterization of plant cell wall degrading enzymes from three glycoside hydrolase families in the cerambycid beetle Apriona japonica | |
| Šimčíková et al. | α‐L‐rhamnosyl‐β‐D‐glucosidase (rutinosidase) from Aspergillus niger: characterization and synthetic potential of a novel diglycosidase | |
| Heo et al. | Characterization of an extracellular xylanase in Paenibacillus sp. HY-8 isolated from an herbivorous longicorn beetle | |
| Wu et al. | Molecular cloning and characterization of an endogenous digestive β‐glucosidase from the midgut of the fungus‐growing termite M acrotermes barneyi | |
| CN104357429B (en) | A kind of high temperature neutral beta glucuroide HiBgl3A and its gene and application | |
| CN109929861B (en) | Encoding gene of glucomannanase, enzyme, preparation and application thereof | |
| CN103160483B (en) | Beta-glucosidase, as well as expression gene and application thereof | |
| CN102363774B (en) | Beta-mannaseBA-Man5A with wide pH range, gene thereof and application of gene | |
| CN107002055B (en) | Fungus-derived high-temperature acidic beta-glucosidase, and coding gene and application thereof | |
| CN103343112B (en) | High-temperature alkaline xylanase XYN11A as well as gene and application thereof | |
| CN104498455A (en) | Moderate neutral beta-glucosidase HiBgl3B for efficiently degrading soybean isoflavone as well as gene and application of moderate neutral beta-glucosidase HiBgl3B | |
| CN102181416B (en) | Alkali-resisting beta-mannase Man5A as well as gene and applications thereof | |
| CN104388408A (en) | Acid glucanase GLU16-3 with high specific activity, gene for same and application of acid glucanase GLU16-3 | |
| CN104498456A (en) | Acidic beta-glucosidase Bgl3B and gene and application thereof | |
| Ni et al. | cDNA cloning and heterologous expression of an endo‐β‐1, 4‐glucanase from the fungus‐growing termite Macrotermes barneyi | |
| Ding et al. | Molecular cloning and transcriptional expression analysis of an intracellular β-glucosidase, a family 3 glycosyl hydrolase, from the edible straw mushroom, Volvariella volvacea | |
| Bokma et al. | Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis | |
| CN103789283B (en) | A kind of neutral arabinofuranosidase Abf43 and gene thereof and application | |
| CN105861471B (en) | A kind of neutrality low temperature xylosidase CaXyl43A and its gene and application | |
| CN105018444A (en) | Humicola-sourced high-temperature acid beta-glucosidase HiBgl3C as well as gene and application thereof | |
| CN105420218B (en) | A kind of xyloside of low temperature/arabinofuranosidase glucosides bifunctional enzyme AX543 and its gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200831 Address after: 100193 Beijing Old Summer Palace West Road, Haidian District, No. 2 Patentee after: Beijing Institute of Animal Science and Veterinary Medicine, Chinese Academy of Agricultural Sciences Address before: 100081 Beijing, Zhongguancun, South Street, No. 12, No. Patentee before: FEED Research Institute CHINESE ACADEMY OF AGRICULTURAL SCIENCES |
|
| TR01 | Transfer of patent right |