CN104480109B - The molecular labeling related to fat thickness at back of pig character - Google Patents
The molecular labeling related to fat thickness at back of pig character Download PDFInfo
- Publication number
- CN104480109B CN104480109B CN201410852692.2A CN201410852692A CN104480109B CN 104480109 B CN104480109 B CN 104480109B CN 201410852692 A CN201410852692 A CN 201410852692A CN 104480109 B CN104480109 B CN 104480109B
- Authority
- CN
- China
- Prior art keywords
- pig
- molecular labeling
- fat thickness
- base
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of livestock molecular marker preparation, and in particular to the preparation and application with fat thickness at back of pig character related SNP molecular labeling.Described molecular labeling is obtained by HADH gene clonings, its nucleotide sequence such as sequence table SEQ ID NO：Shown in 1 and shown in accompanying drawing 4.In SEQ ID NO：1 and accompanying drawing 4 shown in the 282nd of the sequence base for having a C or T replace；287th base for having a G or A is replaced；296th base for having a C or A is replaced；324th base for having a G or C is replaced；370th base for having a C or T is replaced.The present invention provides new molecular labeling resource for the marker assisted selection of pig.
Description
Technical field
The invention belongs to technical field of livestock molecular marker preparation, and in particular to the molecule mark related to fat thickness at back of pig character
Note and application.
Background technology
China is pig-breeding big country, is also pork consumption big country.With the development of aquaculture, the lean meat species of high-quality are cultivated
Pig, becomes the focus of research.Due to lean meat percentage and thickness of backfat height correlation, and lean meat percentage determines complex, so passing through
The thickness of backfat and indirect selections lean meat percentage are selected, is the Main Means of breeding research.
Traditional thickness of backfat character determination mainly when pig reaches 100kg, is fallen by B ultrasound analyzer sweep measuring
Then the relatively thin individual of back fat is given over to kind of a use by left side away from the thickness of backfat at dorsal line 5cm between several 3-4 ribs.This detection
Method slow down breeding process, and easily be influenceed by feeding environment, cause degree of accuracy decline of reserving seed for planting.With the hair of molecular biology
Exhibition, molecular marker assisted selection (marker-assisted selection, MAS) plays more and more important in pig breeding
Effect, greatly accelerates breeding process.(Shandong continues hero etc., the external livestock technologies of reviews and prospects [J] of Perspective of Animal Breeding Methods,
2000,27(1):During 24-28.) SNP (single nucleotide polymorphism, SNP) is breeding
With more molecule labelling method, main thought is to determine research gene by candidate gene approach, it is determined that the SNP positions of gene
SNP partings (Beuzen N D etc., Molecular markers and their are carried out by methods such as sequencing or digestions after point
use in animal breeding[J].The Veterinary Journal,2000,160(1):42-52.), obtain different
The individual difference in DNA level, then by association analysis, so as to obtain with the genotype individuals for instructing breeding practice.
β-hydroxyl acyl CoA dehydrogenase genes (Hydroxyacyl-CoA Dehydrogenase abbreviation HADH genes) is encoded
β-hydroxyl acyl CoA dehydrogenases, β-hydroxyl acyl CoA can be catalyzed and slough two hydrogen atoms generation β-hydroxyl acyl CoA, be aliphatic acid
During being utilized in vivo, the important rate-limiting enzyme of aliphatic acid beta oxidation.HADH genes during fatty acid metabolism extremely
Close important, but whether influence fat deposition, report is had no at present.So present invention selection HADH is candidate gene, by right
The amplification of population sample, DNA fragmentation is sequenced using sequenator, and SNP is directly read from sequencing peak figure
The genotype of SNP site, so as to filter out the molecular labeling related to back fat thickness.
In the present invention, the subregion that includes of HADH genes is expanded, five new SNP sites are found, it is further complete
It has been apt to the SNP information banks of pig, and it is significant to the raising of fat thickness at back of pig character.
The content of the invention
It is an object of the invention to provide the SNP related to fat thickness at back of pig character (SNP) molecular labeling.
Another object of the present invention is the application for providing the SNP molecular labeling related to fat thickness at back of pig character.
The present invention is achieved through the following technical solutions：
Applicant clones from the pig HADH genes of report and obtains the SNP marker related to fat thickness at back of pig character, should
The nucleotide sequence of molecular labeling is as follows：
CCACAACAATGCCATATCCGAGCTGTGTCTGCGATCTACACCACAGCTCACGGCCATGCCAGATCCTTA
ACCCACTGAGCTAGGCCAGGGATTGAACCTGTGTCTTCATGGATGCTAGGCAGATTCACTTCCCCTGAGCCACAACG
GGAACTCCAGACTTAACTGTTTTAAGAACAAGCCAGCTGGTGGCGGTTGAAAGTCTCGGCAGAATGCCTTTTTCTGA
CAGTTGAAGTTAGTGTTGACAACTCGTGTTGATGGCGGAGTTTAAGGCATTGCACAACRAGAGRTAATGATARACTC
ATACTTGGCAGCTCTGCGAGATGRAACTGATTTATGACTTTTTTCCTCTCTGGATCAAATCATGAGAACRCAAGGGC
AGGCCTTGATGCAAAGGCACAGTAGCCTCTGGGGCCCAGCAGCCTCATGGGGAGCACTGACTCTTTTGTATTTGTTC
TTAGGGGATTAAGAAGTTAGAATTTGGGTGTGGCAGAGGGGACAGGTAACTGTGATTTTTCAAAGAGAGTGTAATGT
TGCCGAAATGAAACCCTCCTGTAGTGTATGGGCCCAAGGAGCACCTCACTGGACCAGTTGATGTAGTTTTCACAAAT
TCACCACTCAAGTTATACTTCAGAGGAGCTGCTTCAAATCTTGTGATATGTTTGCAAAAATTGAGAAATCTAGCAAG
ACTCTGCTTGGCGTGTTTCCTTGGCCCTATGGCTGGAGTACTCAGGGGCTTTGATAAGTATGCTATTCACTTGGTCT
ATTTTTACAGCTCTGAAGCACCCTTGTCTAAAAATATTTCTCTGGCTAAGCTTGCCTTTCCATCTTCCAGGCTGGAA
AAGTCATGGAGCTGAGGACATAGCCTGCAAATAAATTTTTTTTTTCCATCGTAGACTGCTTGTCCTCAAGGCCTTAT
AGTGTGTAGGTCACTGTCATTTAAAATAAGAGTTCTCAGTGGGTTGATTCAGATTATTGGCATTC
The above-mentioned common 981bp of sequence, the R in the 282nd is C or T；R in 287th is G or A；R in 296th is C
Or A；R in 324th is G or C；R in 370th is C or T.
Applicant devise expand above-mentioned HADH genetic fragments primer pair (primer pair be also amplification the present invention molecule
The primer pair of mark), its DNA sequence dna is as follows：
Forward primer：5'-CCACAACAATGCCATATCCGAG-3',
Reverse primer：5'-GAATGCCAATAATCTGAATCAACCC-3'.
Specific method is：Extract pig genomic DNA, pig HADH gene sequence information (its nucleotides announced according to NCBI
Sequence table such as SEQ ID NO：1) primer is designed.Enter performing PCR with these primer pairs to expand, obtain 981bp fragment, its electrophoretogram
As shown in Figure 3.PCR primer is delivered into the sequencing of Wuhan Qing Ke biotech firms, analysis obtains SNP, and carries out genotype and pig back fat
The application of association analysis between thickness, new molecular labeling is provided for pig marker assisted selection.
More detailed technical scheme referring to《Embodiment》.
Brief description of the drawings
Sequence table SEQ ID NO：1 is the partial nucleotide sequence in the pig HADH gene complete sequences that the present invention is cloned.Sequence
Row length is 981bp, and the sequence is the sequence after allelic mutation, and its SNP site, i.e. mutational site are the of above-mentioned sequence
The base of 282 sports T by C；The base of the 287th sports A by G；The base of the 296th sports A by C；324th
Base C is sported by G；370th bit base sports T by C.
Fig. 1：It is main technical flows schematic diagram of the present invention.
Fig. 2：It is HADH Gene Partial sequence PCR primer electrophoretograms.Description of reference numerals：In figure：M swimming lanes are DNA molecular
Amount mark (DL2000)；Product is 981bp.
Fig. 3：HADH Gene Partial sequence result figures.
Fig. 4：It is the nucleotide sequence of molecular labeling prepared by the present invention." R " wherein in sequence table is prominent for allele
Become, i.e. SNP site：282nd R=C or T；287th R=G or A；296th R=C or A；324th R=G or C；The
370 R=C or T.
Embodiment
Embodiment 1
(1) pig extracting genome DNA
It is Large White (Hubei gold woods original seed herding Co., Ltd) that the pig variety of pig genomic DNA is extracted in the present invention.Pig
The DNA sample of colony is all using the genomic DNA kit (TIANamp of biochemical (Beijing) Technology Co., Ltd. production of Tiangeng
Genomic DNA Kit) (by kit specification operation) is extracted, comprise the following steps that：
1st, Large White ear sample is put into 2mL EP pipes, be cut into the ophthalmologic operation of alcohol swab wiped clean after pasty state
Add 200 μ L buffer solutions GA.
2nd, 20 μ L Proteinase K Solutions (kit is carried) are added, is placed in digest in 56 DEG C of water-baths after mixing and stays overnight.
3rd, 200 μ L buffer solutions GB (kit is carried) are added, fully reverse to mix, 70 DEG C of placement 10min, solution strain
Limpid, of short duration centrifugation removes the globule of inside pipe wall.
4th, 200 μ L absolute ethyl alcohols are added, fully vibration mixes 15s, now it is possible that flocculent deposit, of short duration centrifugation
Afterwards, the globule of inside pipe wall is removed.
The 5th, previous step resulting solution and flocculent deposit are all added in an adsorption column CB3 to (adsorption column is put into collecting pipe
In), 12,000rpm centrifugation 30s outwell waste liquid, adsorption column CB3 are put back in collecting pipe.
6th, 500 μ L buffer solutions GD (kit is carried), 12,000rpm centrifugation 30s are added into adsorption column CB3, are outwelled
Waste liquid, adsorption column CB3 is put into collecting pipe.
7th, 600 μ L rinsing liquids PW (kit is carried), 12,000rpm centrifugation 30s are added into adsorption column CB3, are outwelled
Waste liquid, adsorption column CB3 is put into collecting pipe.
8th, step 7 is repeated.
9th, adsorption column CB3 is transferred in a clean centrifuge tube, 50-200 μ is vacantly added dropwise to the middle part of adsorption column
L elution buffers TE (kit is carried), room temperature places 2-5min, 12,000rpm centrifugation 2min, and solution is collected into centrifugation
Guan Zhong.
10th, the DNA extracted is carried out after integrality identification and Concentration Testing, is placed in -80 DEG C and saves backup.
(2) PCR amplifications and sequencing
HADH gene (GenBank indexed numbers are downloaded from NCBI：NC_010450.3 sequence), design primer amplification,
The DNA sequence dna of primer is as follows：
Forward primer：5'-CCACAACAATGCCATATCCGAG-3',
Reverse primer：5'-GAATGCCAATAATCTGAATCAACCC-3'.
PCR reaction systems：Reaction total system is 10 μ L, including μ L of DNA profiling 40ng, 2 × PCR Mix 5, forward primer
3pmoL, reverse primer 3pmoL, ddH2O 3.4μL。
PCR response procedures：95 DEG C of pre-degenerations 5min, 94 DEG C of 30s, 59.9 DEG C of 30s, 72 DEG C of 50s, are circulated 35 times, 72 DEG C are prolonged
5min is stretched, 15 DEG C stop reaction.
PCR primer detects that product is 981bp through 2.0% agarose gel electrophoresis.
PCR primer by identification delivers to the sequencing of Wuhan Qing Ke biotech firms, and sequencing analysis figure is as shown in Figure 4.
(3) data relation analysis
The present invention determines 100kg body weight ages in days, the back of the body of the Large White (sample is 235 Large Whites) of 100kg body weight live bodies
Fat thickness, and according to the group structure of Ministry of Agriculture boar measure center Large White group, using general linear model (GLM) to single
SNP site and swinery sports school just after each trait data be associated analysis, illustrating influences the genotype of these characters, statistics mould
Type is as follows：
Yij=μ+genotypei+εij
Wherein YijFor phenotypic number；μ is colony's average；genotypeiFor genotype effects；εijFor random error；Mutually solely
Stand and submit to N (0, σ2)。
The 287th genotype of 1 HADH gene SNP sites of table and the association analysis of back fat thickness
Statistics finds five SNP site complete linkages, so the data of the 287th listed can represent five SNP sites
Information.282nd R=C or T；287th R=G or A；296th R=C or A；324th R=G or C；370th R=
The average that the waist of C or T GG genotype individuals recommends the vertebra junction thickness of backfat is substantially less than other genotype individuals (P ＜ 0.05).
Claims (4)
1. a kind of SNP marker related to Large White back fat thickness, it is characterised in that：The nucleosides of described molecular labeling
Acid sequence is as follows：
CCACAACAATGCCATATCCGAGCTGTGTCTGCGATCTACACCACAGCTCACGGCCATGCCAGATCCTTAACCC
ACTGAGCTAGGCCAGGGATTGAACCTGTGTCTTCATGGATGCTAGGCAGATTCACTTCCCCTGAGCCACAACGGGAA
CTCCAGACTTAACTGTTTTAAGAACAAGCCAGCTGGTGGCGGTTGAAAGTCTCGGCAGAATGCCTTTTTCTGACAGT
TGAAGTTAGTGTTGACAACTCGTGTTGATGGCGGAGTTTAAGGCATTGCACAACRAGAGRTAATGATARACTCATAC
TTGGCAGCTCTGCGAGATGRAACTGATTTATGACTTTTTTCCTCTCTGGATCAAATCATGAGAACRCAAGGGCAGGC
CTTGATGCAAAGGCACAGTAGCCTCTGGGGCCCAGCAGCCTCATGGGGAGCACTGACTCTTTTGTATTTGTTCTTAG
GGGATTAAGAAGTTAGAATTTGGGTGTGGCAGAGGGGACAGGTAACTGTGATTTTTCAAAGAGAGTGTAATGTTGCC
GAAATGAAACCCTCCTGTAGTGTATGGGCCCAAGGAGCACCTCACTGGACCAGTTGATGTAGTTTTCACAAATTCAC
CACTCAAGTTATACTTCAGAGGAGCTGCTTCAAATCTTGTGATATGTTTGCAAAAATTGAGAAATCTAGCAAGACTC
TGCTTGGCGTGTTTCCTTGGCCCTATGGCTGGAGTACTCAGGGGCTTTGATAAGTATGCTATTCACTTGGTCTATTT
TTACAGCTCTGAAGCACCCTTGTCTAAAAATATTTCTCTGGCTAAGCTTGCCTTTCCATCTTCCAGGCTGGAAAAGT
CATGGAGCTGAGGACATAGCCTGCAAATAAATTTTTTTTTTCCATCGTAGACTGCTTGTCCTCAAGGCCTTATAGTG
TGTAGGTCACTGTCATTTAAAATAAGAGTTCTCAGTGGGTTGATTCAGATTATTGGCATTC
R in the 282nd of above-mentioned sequence is C or T；R in 287th is G or A；R in 296th is C or A；324th
R in position is G or C；R in 370th is C or T.
2. the primer pair of amplification molecular labeling as claimed in claim 1, its DNA sequence dna is as follows：
Forward primer：5'-CCACAACAATGCCATATCCGAG-3',
Reverse primer：5'-GAATGCCAATAATCTGAATCAACCC-3'.
3. application of the molecular labeling in the detection of Large White back fat thickness described in claim 1.
4. application of the primer pair in the detection of Large White back fat thickness described in claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410852692.2A CN104480109B (en) | 2014-12-31 | 2014-12-31 | The molecular labeling related to fat thickness at back of pig character |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410852692.2A CN104480109B (en) | 2014-12-31 | 2014-12-31 | The molecular labeling related to fat thickness at back of pig character |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104480109A CN104480109A (en) | 2015-04-01 |
| CN104480109B true CN104480109B (en) | 2017-10-20 |
Family
ID=52754716
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410852692.2A Expired - Fee Related CN104480109B (en) | 2014-12-31 | 2014-12-31 | The molecular labeling related to fat thickness at back of pig character |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104480109B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107022603B (en) * | 2016-07-07 | 2020-08-18 | 华中农业大学 | Molecular marker for pig backfat thickness character and application thereof |
| CN108300789B (en) * | 2017-11-14 | 2020-09-22 | 中国农业大学 | SNP molecular marker related to multiple important economic traits of pig and application thereof |
| CN108330197B (en) * | 2018-03-06 | 2018-12-21 | 华南农业大学 | One kind SNP marker relevant to Duroc kind fat thickness at back of pig and application thereof |
| CN112941199B (en) * | 2019-12-10 | 2022-09-09 | 中国农业科学院农业基因组研究所 | Method for evaluating pig backfat thickness and eye muscle area and application thereof |
| CN117625813B (en) * | 2024-01-23 | 2024-04-16 | 江西农业大学 | Application of SNP molecular marker affecting backfat thickness of long white pig |
-
2014
- 2014-12-31 CN CN201410852692.2A patent/CN104480109B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| CT009506;Henderson et al;《Genbank》;20070507 * |
| NC_010450.3;Groene et al;《Genbank》;20101105 * |
| NM_214331.1;Uenishi et al;《Genbank》;20040520 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104480109A (en) | 2015-04-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104480109B (en) | The molecular labeling related to fat thickness at back of pig character | |
| CN109971865B (en) | SNP marker significantly related to weight traits of litopenaeus vannamei and application | |
| CN107937556B (en) | SNP (Single nucleotide polymorphism) site related to pig feed conversion rate and application thereof | |
| CN103911373B (en) | Affect the main effect SNP marker of pork fat acid constituents and the application in kind of pig flesh characters genetic improvement thereof | |
| CN103451180B (en) | Molecular marker related to sedimentary character of pork fat, and application thereof | |
| CN108315439A (en) | It is a kind of to grow relevant SNP marker and its application with Pelteobagrus vachelli | |
| CN107815498B (en) | SNP molecular marker related to multiple economic traits of pig and application thereof | |
| CN104911273B (en) | A kind of chicken FABP1 gene molecule genetic marker related to the excellent production traits of chicken and its application | |
| CN105200146B (en) | The SNP genetic marker related to label of pig fat deposition description character and application | |
| KR100804310B1 (en) | 4 DNA marker of adipocyte-fatty acid binding protein gene related the intramuscular fat content in beef cattle | |
| CN104593363B (en) | Excellent slaughter trait molecular genetic marker of broiler chicken and application of excellent slaughter trait molecular genetic marker | |
| CN112662789B (en) | SNP (Single nucleotide polymorphism) marker related to birth age of Holstein cows in south China and application thereof | |
| CN107868832B (en) | SNP molecular marker related to multiple economic traits of pig and application thereof | |
| CN104131097B (en) | A kind of method detecting beef cattle UCP3 gene mononucleotide polymorphism and application thereof | |
| CN107130025B (en) | Method and its application that are a kind of while detecting two insertion and deletion sites of ox FoxO1 gene | |
| CN108441566A (en) | A kind of detection method of goat ATBF1 gene insertion/deletions and its application | |
| CN102816759B (en) | The detection method of Beijing duck STMN1 gene mononucleotide polymorphisms and its molecular labeling | |
| CN112575096A (en) | SNP molecular marker related to total papilla number of large white pigs and acquisition method thereof | |
| CN107937557B (en) | SNP (single nucleotide polymorphism) site related to economic traits of pigs and application thereof | |
| CN113817841B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to swine nipple number traits and application thereof | |
| CN112094923B (en) | SINE transposon polymorphic molecular marker associated with pig growth speed as well as detection method and application thereof | |
| CN104131096B (en) | A kind of method detecting beef cattle UCP3 gene mononucleotide polymorphism | |
| CN104480216A (en) | Molecular marker related to pH (Potential of Hydrogen) value character of pig muscle | |
| CN108300789B (en) | SNP molecular marker related to multiple important economic traits of pig and application thereof | |
| CN101875977B (en) | Method for detecting mononucleotide polymorphism of scalper SREBP1c gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171020 Termination date: 20191231 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |