CN104480057A - Construction method and application of L-isoleucine producing genetically engineered bacteria - Google Patents

Abstract

The invention discloses L-isoleucine producing genetically engineered bacteria and a construction method and application thereof, belonging to the technical field of genetic engineering and microbial fermentation. According to the method, a knockout vector of the gene alr is constructed and electroporated into the host bacteria to obtain a deficient strain IWJ001 delta alr of the alr. The gene segments are connected to an overexpression vector by use of the PCR amplification genes fusA, frr, ilvBN, ilvA and ippnk and then electroporated into corynebacterium glutamicum IWJ001 delta alr, and the target genetically engineered bacteria, namely L-isoleucine producing genetically engineered bacteria IWJ001 delta alr/pJYW-4-fusA-frr-ilvBN-ilvA-ppnk, are obtained through antibiotic resistance screening. The L-isoleucine producing genetically engineered bacteria constructed by the method disclosed by the invention can be used for increasing the yield of L-isoleucine through fermentation in a shake flask or fermentation tank, and the method is conductive to reducing the difficulty in separation and purification and increasing the yield so as to remarkably reduce the production cost of L-isoleucine.

Description

Construction process and the application of ILE genetic engineering bacterium are produced in one strain

Technical field

The present invention relates to a strain and produce ILE genetic engineering bacterium and construction process thereof, and improve the application of amino acid production, belong to genetically engineered and technical field of microbial fermentation.

Background technology

ILE, also known as L-L-iLeu, chemistry L-α-amino-γ-methylthio-n-butyric acid by name, belongs to that aspartic acid race is nonpolar, the amino acid whose one of water transport property.Owing to there are two chiral carbon atoms in α position and β position, so there are 4 kinds of stereoisomerses, be respectively that D, L, D are other, the other type of L, be present in nature and the Isoleucine with physiological function only has L-type.ILE is extensively present in multiple plant animal protein, it is the one of common 18 seed amino acids, also be one of human body eight seed amino acid, all contain a methyl chains in the molecular structure in addition due to it and L-Leu, Valine and be called as branched-chain amino acid.

ILE is as one of 8 seed amino acids of needed by human, it is the raw material of synthesized human hormone, enzyme, there is the effect promoting protein synthesis and suppress to decompose, but cannot self synthesize in body, grownup needs the ILE absorbing 20 mg/kg (body weight) from the external world every day.Therefore, ILE has a wide range of applications and commercial value in food, medicine, feed and sports health field.

In food service industry, ILE can strengthen the nutrition of some food, and ILE as contained in wheat-flour, glutenin, peanut powder, potato etc. is limiting amino acid, to be fortified.ILE is combined with other amino acid, can improve the form of the food such as bread, biscuit, soft sweets, washmarking, proterties, color and luster, taste, nutrition.ILE and other amino acid ligands make amino acid energy beverage and sports drink, have formation muscle, alleviate muscle fatigue, improve athletic patience, promote the synthesis rate of protein level of skeletal muscle and reduce the degradation rate of albumen, being beneficial to muscle recovery.In addition, ILE also can be made into high fat diet treatment epileptics.

In pharmaceutical industries, be mainly used in preparing Hausmam Amin 20, comprise standard amino acid solution transfusion, the transfusion of therapeutic type high branched-chain amino acid and various oral liquid formulations, for liver cirrhosis patient provides albumen and energy, promote the turnover of hat artery patient myocardium protein, improve appetite and the nutrition of uremic patient, avoid malnutrition, for acute nonsuppurative hepatitis provides albumen and the energy.

In feedstuff industry, ILE has special effect as Animal nutrition, is therefore subject to the extensive concern of investigator.At present, ILE makes fodder additives, saves protein feed, forage component is utilized, and improves efficiency of feed utilization, thus reduces costs.In bean pulp type basal diet, add ILE, the muscle growth of ox can be improved.In pig feed, add ILE can improve the utilization of big porker to methionine(Met).When ILE and other amino acid and albumen together feeding cow, the protein content in milk can be improved.In the feed of lactation type sow, add ILE, food consumption and the lactation metabolism of sow can be improved.The ovulation rate that ILE can improve ewe is added in the ewe feed in rutting sedson.

In health-care industry, ILE can improve the immunizing power of human body, promotes the consumption of body energy, reduces fat quantity, can be used for the preparation of diet pill.Control blood sugar by glucocorticosteroid, reduce central fatigue.In addition, ILE has certain effect to treatment sports type obstacle and wound, can reduce the symptom of tardive dyskinesia, and treatment wound, improves the injured cognitive disorder caused.

Because the available area of ILE is extensive, and new purposes is constantly found, considerably increases market demand.At present, domestic existing producer carries out batch production ILE, but the bacterial strain acid producing ability that these enterprises produce is low, and production technique and production unit lag behind the states such as Japan, and output can not be met the need of market.Therefore, improve bacterial strain throughput, optimization technological process, outfit sophisticated equipment become China assistant officer problem to be solved.

In the present invention, we produce based on bacterium IWJ001 by ILE, construct alrgenetic flaw Host Strains, and gene cluster is have expressed on expression vector pJYW-4 fusA- frr- ilvBN-ilva- ppnk, due on this expression vector with alrgene, compensate for Host Strains alrwithout the need to adding microbiotic, disappearance, therefore can ensure that expression vector is expressed at endobacillary stable existence and composition.The engineering bacteria that the present invention builds improves ILE output.

Summary of the invention

The object of this invention is to provide a strain and produce ILE genetic engineering bacterium and construction process thereof and application, the engineering bacteria that the present invention builds improves ILE output.

Technical scheme of the present invention: ILE genetic engineering bacterium is produced in a strain, its Classification And Nomenclature be Corynebacterium glutamicum ( corynebacterium glutamicum) IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnk,be preserved in China typical culture collection center, deposit number: CCTCC NO:M2014529.

Genome is covered by plasmid alrgenetic flaw, thus make expression vector stable existence in the antibiotic-free interpolation situation exercise expressive function in thalline, described bacterial strain comprises alrgene defection type expressive host.

Described expressive host is the gene being knocked encoding alanine racemase alrcorynebacterium glutamicum ( corynebacterium glutamicum).

Described expressive host be by alrknockout carrier is transformed into Corynebacterium glutamicum, is obtained by homologous recombination alrdefective type expressive host, described in alrthe nucleotide sequence of knockout carrier is as shown in SEQ ID NO.1.

First technical problem solved by the invention is, alrdefective type expressive host, its construction process, key step is:

(1) with c. glutamicumiWJ0001 genome is template, respectively with alr-S-(+)/(-) and alr-X-(+)/(-) is for each 1000bp's of primer amplification alrgene upstream and downstream fragment alr-U, alr-D; With pDTW-202(Jinyu Hu, Yanzhen Tan, Yanyan Li, Xiaoqing Hu, Daqing Xu, Xiaoyuan Wang, 2013. Construction and application of an efficient multiple-gene-deletion system in corynebacterium glutamicum.) be template, kan-lox-F/R is primer amplification kanresistance gene fragment. alr-U with xhoi, bamHi enzyme is cut, alr-D with xbai and psti enzyme is cut, kanfragment with bamHi, xbai enzyme is cut, three fragments be connected into together with xhoi and pstpBluescript II SK (+) that I enzyme is cut, the plasmid built namely alrknockout carrier, called after pJXW-1.

(2) will alrknockout carrier transforms Host Strains, is obtained by homologous recombination alrgene defection type expressive host bacterium.

Second technical problem that the present invention will solve is at carrier pJYW-4 expressing gene fusA, frr, ilvBN, ilvA, ppnk, key step is:

(1) increase fusA-frrgene fragment: fusA-frrtwo ends are introduced respectively noti and nhei restriction enzyme site; By PCR primer fusA-frrfragment is connected into the expression vector pJYW-4 cut with same restriction enzyme after cutting with corresponding restriction enzyme, obtain recombinant expression plasmid pJYW-4- fusA- frr;

(2) increase ilvBN-ilvA- ppnkgene fragment, ilvBN-ilvA- ppnktwo ends are introduced respectively sfii and aSci restriction enzyme site; By PCR primer ilvBN-ilvA- ppnkfragment is connected into the expression vector pJYW-4-cut with same restriction enzyme after cutting with corresponding restriction enzyme fusA- frr, obtain recombinant expression plasmid pJYW-4- fusA- frr- ilvBN-ilvA- ppnk;

(3) by recombinant expression plasmid pJYW-4- fusA- frr- ilvBN-ilvA- ppnkproceed to and pass through alrknockout carrier knocks out alrthe corynebacterium glutamicum of gene, obtains genetic engineering bacterium IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnk.

Expressing gene fusA- frr- ilvBN-ilvA-ppnk, its nucleotide sequence is respectively: fusAfor SEQ ID NO.2, frrfor SEQ ID NO.3, ilvAfor SEQ ID NO.4, ilvBNfor SEQ ID NO.5, ppnkfor SEQ ID NO.6.

The application of described product ILE genetic engineering bacterium, ILE is produced in fermentation.

Beneficial effect of the present invention: this bacterial strain do not rely on antibiotics resistance can maintain expression vector stable be present in C. glutamicum cells, be beneficial to suitability for industrialized production.And ILE output can be improved by a relatively large margin.

Biological material specimens preservation: Corynebacterium glutamicum ( corynebacterium glutamicum) IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnk,be preserved in China typical culture collection center, address Wuhan, China Wuhan University, preservation date on October 29th, 2014, deposit number: CCTCC NO:M2014529.

Accompanying drawing explanation

Fig. 1 alrthe structure of gene knockout carrier pJXW-1.

Fig. 2 expression vector pJYW-4- fusA- frr- ilvBN-ilva- ppnkstructure.

Fig. 3 bacterial strain shake flask fermentation and amino acid production change signal.

The thalli growth amount variation diagram of Fig. 4 bacterial strain tank top fermentation.

Embodiment

Embodiment 1 alrthe structure of knockout carrier pJXW-1

With c. glutamicumiWJ001 genome is template, respectively with alr-S-(+)/(-) and alr-X-(+)/(-) is for each 1000bp's of primer amplification alrgene upstream and downstream fragment alr-U, alr-D; With pDTW-202(Jinyu Hu, Yanzhen Tan, Yanyan Li, Xiaoqing Hu, Daqing Xu, Xiaoyuan Wang, 2013. Construction and application of an efficient multiple-gene-deletion system in corynebacterium glutamicum.) be template, kan-lox-F/R is primer amplification kanresistance gene fragment. alr-U with xhoi, bamHi enzyme is cut, alr-D with xbai and psti enzyme is cut, kanfragment with bamHi, xbai enzyme is cut, three fragments be connected into together with xhoi and pstpBluescript II SK (+) that I enzyme is cut, the plasmid built namely alrknockout carrier, called after pJXW-1(Fig. 2).

The structure of embodiment 2 expression vector

First, with plasmid pDXW-8- fusA- frrfor template, fusA-F, frr-R is primer, amplification fusA- frrgene fragment, fusA- frrtwo ends are introduced respectively noti and nhei restriction enzyme site; By PCR primer fusA- frrfragment is connected into the pJYW-4 cut with same restriction enzyme after cutting with corresponding restriction enzyme, completes expression plasmid and builds pJYW-4- fusA- frr.

With plasmid pDXW-8- ilvBN-ilva- ppnk(Yin L, Zhao J, Chen C, Hu X, Wang X (2014) Enhancing the carbon flux and NADPH supply to increase L-isoleucine production in corynebacterium glutamicum.) be template, ilvBN-F, ppnk-R is primer, amplification ilvBN-ilvA-ppnkgene fragment, ilvBN-ilva- ppnktwo ends are introduced respectively sfii and asci restriction enzyme site; By PCR primer ilvBN-ilva- ppnkfragment is connected into the pJYW-4-cut with same restriction enzyme after cutting with corresponding restriction enzyme fusA- frr, complete expression plasmid and build pJYW-4- fusA- frr- ilvBN-ilvA-ppnk.

Then, by pJYW-4- fusA-frr-ilvBN-ilvA-ppnkproceed to IWJ001 Δ alr, build engineering strain IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnk.

Embodiment 3 shake flask fermentation

From preservation strain IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnkglycerine pipe in draw and get a ring bacterium liquid and rule on solid-state activation medium, cultivate 36 h for 30 DEG C.Utilizing transfering loop to be transferred to from scraping one ring lawn the flat board activated is equipped with in 250 mL triangular flasks of 25mL seed culture medium, and 30 DEG C, 200 r/min cultivate 18 h.From cultured seed liquor, draw 2.4 mL bacterium liquid be forwarded to and be equipped with in the 250mL triangular flask of 23mL fermention medium, cultivate 6 h for 30 DEG C, adding final concentration is that 1 mM isopropylthiogalactoside (IPTG) inducible protein is expressed until fermentation ends (t=72h).

Fermentation ends fermented liquid adopts HPLC to measure aminoacids content, utilizes HPLC OPA (o-phthalaldehyde(OPA)) pre-column derivatization method.Centrifugal 30 min of fermented liquid 12000 r/min, supernatant liquor is transferred in a clean EP pipe, dilute 20 times (shaking flasks) or 40 times (fermentor tank) with 5% trichoroacetic acid(TCA), room temperature places 4h, centrifugal 30 min of 12000 r/min, 0.22 μm of aqueous phase pin type frit, now sample directly can go up machine testing.Chromatographic column: Agilent Hypersil ODS 4.0*250mm (5 μm), column temperature: 40 DEG C.Moving phase: aqueous phase A: anhydrous sodium acetate 3.01 g, first water-soluble, then add triethylamine 200 μ L, tetrahydrofuran (THF) 5 mL, ddH ₂o constant volume 1 L, 5% acetic acid is adjusted to pH 7.2; Organic phase B: anhydrous sodium acetate 3.01g, ddH ₂o constant volume is 200 mL, and 5% acetic acid is adjusted to pH 7.2, and then adds 400 mL methyl alcohol (chromatographically pure) and 400 mL acetonitriles (chromatographically pure), and flow velocity is 1 mL/min.Sample needs to carry out column front derivation before running pillar, and the sample derived enters chromatographic column and carries out gradient elution, and elution program is as follows:

Step	Time	%A	%B
				1	0	92	8
2	27	40	60
				3	31.5	0	100
4	32	0	100
				5	34	0	100
6	35.5	92	8

This experiment used medium:

Activated inclined plane substratum (g/L): Tryptones 10, NaCl 5, yeast extract 5, glucose 5, beef extractive substance 10, deionized water is prepared;

Seed culture medium (g/L): glucose 30, (NH ₄) ₂sO ₄5, KH ₂pO ₄1, MgSO ₄0.5, corn steep liquor 30, utilizes 5 M NaOH solution to regulate pH 7.0;

Fermention medium (g/L): glucose 100, (NH ₄) ₂sO ₄35, KH ₂pO ₄1, MgSO ₄0.5, corn steep liquor 15, deionized water is prepared; 5 M NaOH solution are utilized to regulate pH 7.0; Shake flask fermentation cultivates interpolation 20 g/L CaCO ₃for regulating pH.

Fig. 3 is shown in amino acid production change: cultivate through 72h, IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnkisoleucine content be 12.4g/L; Under same culture conditions, IWJ001 Δ alriLE output 7.4 g/L of/pJYW-4, both compare IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnkcomparatively IWJ001 Δ alrits output of/pJYW-4 promotes 67%.

The top fermentation of embodiment 4 tank

From the glycerine pipe of preservation strain, get a ring bacterium liquid rule at solid-state activation medium, cultivate 36 h for 30 DEG C.From the flat board activated, the access of scraping one transfering loop lawn is equipped with in 500 mL triangular flasks of 50mL seed culture medium, and 30 DEG C of 200 r/min cultivates 18 h.Be equipped with being forwarded in 150 mL seed liquor in 3 L automatic fermenters of 1.2 L fermention mediums.Utilize the ammoniacal liquor auto-control pH=7.0 of 50%, utilize cooling circulating water and base hot-plate A.T.C to be 30 DEG C, utilize mixing speed and dissolved oxygen coupling, maintain dissolved oxygen 30%, Ventilation Rate (1.5 vvm).As cultivation 6 h, adding final concentration is that 1 mM IPTG inducible protein is expressed.When the glucose concn in substratum is lower than 20 g/L, utilize peristaltic pump to add the glucose of certain volume, maintain glucose concn near 20 g/L.Fermentation culture 72 h.

IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnkisoleucine content be 28.6g/L; Under same culture conditions, IWJ001 Δ alrisoleucine output 20.3 g/L of/pJYW-4.Both compare IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN- ilva- ppnkcomparatively IWJ001 Δ alrits output of/pJYW-4 promotes 40.9%.

table 1the present invention relates to primer

Primer	Sequence (5'-3')	Restriction enzyme site
			alr-S-(+)	ATACTCGAGGTAGCAGACATCGCCGGCCCAG	XhoI
alr-S-(-)	ATATCTAGACATGCGCGGGAGAAATAACAGC	XbaI
			alr-X-(+)	ACAGGATCCTGGACAAGGCACTTCCTATGG	BamHI
alr-X-(-)	GGTCTCGAGCAAGATCCAACAAAAGGTTCACT	PstI
			kan-lox-F	ATGGATCCAATACGACTCACTATAGGGCG	BamHI
kan-lox-R	ACCTCTAGAGCGCAATTAACCCTCACTAAAG	XbaI
			alr-P-(+)	ACGAGATCTCCTTTGTGGTCTGGCATGAAG	BglII
alr-P-(-)	CACCTGCAGAGACGTCCAAAATCACCACATCGCCAGCTTC	AatII
			ilvBN-F	TTGGCGCGCCTGCTTCTGGCGTCAGGC	AscI
ppnk-R	TATGGCCGGCGGGGCCTTTTACCCCGCTGACCTGGGAT	SfiI
			fusA-F	TAGCTAGCAGAAGGAGTAAATCGGTGGCTCAAGAAGTGCTTAAG	NheI
frr-R	ATAAGAATGCGGCCGCTATGGCCGGCGGGGCCTTGGCGCGCCCTAGACCTCCATC	NotI

Although the present invention with preferred embodiment openly as above; but it is also not used to limit the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can do various changes and modification, what therefore protection scope of the present invention should define with claims is as the criterion.

<160> 6

 

<210> SEQ ID NO: 1

<211> 1086

<212> DNA

<213> alr

 

<400> 1

atgaacttgc tgaccaccaa aattgacctg gatgccatcg cccataacac gagggtgctt 60

aaacaaatgg cgggtccggc gaagctgatg gcggtggtga aggcgaatgc atataaccat 120

ggcgtagaga aggtcgctcc ggttattgct gctcatggtg cggatgcgtt tggtgtggca 180

actcttgcgg aggctatgca gttgcgtgat atcggcatca gccaagaggt tttgtgttgg 240

atttggacac cggagcagga tttccgcgcc gccattgatc gcaatattga tttggctgtt 300

atttctcccg cgcatgccaa agccttgatc gaaactgatg cggagcatat tcgggtgtcc 360

atcaagattg attctgggtt gcatcgttcg ggtgtggatg agcaggagtg ggagggcgtg 420

ttcagcgcgt tggctgctgc cccgcacatt gaggtcacgg gcatgttcac gcacttggcg 480

tgcgcggatg agccagagaa tccggaaact gatcgccaaa ttattgcttt tcgacgcgcc 540

cttgcgctcg cccgcaagca cgggcttgag tgcccggtca accacgtatg caactcacct 600

gcattcttga ctcgatctga tttacacatg gagatggtcc gaccgggttt ggccttttat 660

gggttggaac ccgtggcggg actggagcat ggtttgaagc cggcgatgac gtgggaggcg 720

aaggtgagcg tcgtaaagca aattgaagct ggacaaggca cttcctatgg cctgacctgg 780

cgcgctgagg atcgcggctt tgtggctgtg gtgcctgcgg gctatgccga tggcatgccg 840

cggcatgccc aggggaaatt ctccgtcacg attgatggcc tggactatcc gcaggttggg 900

cgcgtatgca tggatcagtt cgttatttct ttgggcgaca atccacacgg cgtggaagct 960

ggggcgaagg ccgtgatatt cggtgagaat gggcatgacg caactgattt tgcggagcgt 1020

ttagacacca ttaactatga ggtagtgtgc cgaccaaccg gccgaactgt ccgcgcatat 1080

gtttaa 1086

 

<210> SEQ ID NO: 2

<211> 2130

<212> DNA

<213> fusA

 

<400> 2

gtggcacaag aagtgcttaa gatctaaaca aaggtccgca acatcggcat catggcgcac 60

atcgatgctg gtaagaccac gaccaccgaa cgcatcctct tctacaccgg catcaaccgt 120

aaggtcggtg agacccacga cggtggcgca accaccgact ggatggagca ggagaaggaa 180

cgcggcatca ccattacctc cgccgcggtt acctgtttct gggataacaa ccaggtcaac 240

atcattgaca cccctggcca cgttgacttc accgttgagg ttgagcgttc cctccgcgtg 300

cttgacggcg cagttgctgt gttcgacggc aaggaaggcg ttgagccaca gtctgagcag 360

gtttggcgtc aggctaccaa gtacgacgtt ccacgtatct gcttcgtgaa caagatggac 420

aagctcggtg ctgacttcta cttcaccgtt ggcaccatcg aggaccgcct gggtgcaaag 480

ccattggtta tgcagctccc aatcggtgct gaggacaact tcgacggcgt catcgacctt 540

cttgaaatga aggcactgac ctggcgtgga gttaccccaa ttggtaccga agctaccgtt 600

gaggagatcc cagcagagct cgcagaccgc gcagctgagt accgtgagaa gcttctcgag 660

accgttgcag agtccgacga agagctcatg gagaagtact tcggtggcga agagctcagc 720

atcgctgaga tcaaggcagc tatccgtaag atggttgtta actctgagat ctaccctgtt 780

tactgtggca ccgcctacaa gaacaagggc atccagccac tgctcgacgc agtcgttgac 840

ttcctgcctt ccccactgga tctcggcgag accaagggca ctgacgttaa ggatcctgag 900

aaggttctga cccgtaagcc ttccgacgaa gagccactgt ctgcacttgc attcaagatt 960

gcagctcacc cattcttcgg taagctgacc ttcgttcgtc tgtactccgg caaggttgag 1020

ccaggcgagc aggttcttaa ctccaccaag aacaagaagg aacgcattgg taagctgttc 1080

cagatgcacg ccaacaagga aaaccctgtt gaggttgcac acgctggtaa catctacgcg 1140

ttcatcggcc tgaaggacac caccaccggt gacaccctct gtgacgcaaa cgctccaatc 1200

attcttgagt ccatggactt cccggatcca gttatccagg ttgctattga gcctaagacc 1260

aagtctgacc aggagaagct cggcgtagct atccagaagc ttgctgaaga agacccaacc 1320

ttcaccgttc acttggacga tgagtccggc cagaccgtca ttggcggcat gggcgagctg 1380

cacctcgatg ttcttgttga ccgcatgaag cgcgagttca aggttgaggc aaacatcggt 1440

gacccacagg ttgcttaccg tgagaccatc cgtaagcctg ttgagtccct cagctacacc 1500

cacaagaagc agactggtgg ttccggtcag ttcgctaagg tcatcatcac cattgagcct 1560

tacgcacctg aggcagacga gcttgaagag ggcgagtccg caatctacaa gttcgagaac 1620

gctgtcaccg gtggtcgtgt tccacgtgaa tacatcccat ccgttgacgc tggtatccag 1680

gacgcaatgc agtacggctt cctggctggc tacccactgg ttaacgtcaa ggcaaccctt 1740

gaagatggcg cttaccacga cgttgactcc tctgaaatgg ccttcaagct cgccggttcc 1800

caggcgttca aggaagctgt tgcaaaggca aagccagtcc tcctcgagcc aatcatgtcc 1860

gttgaaatca ccactcctga ggagtacatg ggtgaagtca tcggtgacgt gaactcccgc 1920

cgtggccaga tcgcttccat ggatgaccgt gcaggcgcca agctggttaa ggctaaggtt 1980

ccactgtctc agatgttcgg ttacgtcggt gaccttcgct ctaagaccca gggtcgtgca 2040

aactactcca tggtcttcga ttcctacgct gaggtcccag ccaacgttgc cgcagatgtt 2100

attgctgagc gcaacggcac cgcttcctaa 2130

                                                       

<210> SEQ ID NO: 3

<211> 558

<212> DNA

<213> frr

 

<400> 3

atgattgatg aaattctgtt cgaagcggaa gagcgcatga ccgcaacggt cgagcacacc 60

cgcgaagact tgaccaccat tcgtaccggt cgcgcaaacc cggctatgtt caacggtgtc 120

atggctgaat actacggcgt gcctactcct attactcaga tgtcaggcat cactgttcca 180

gagcctcgca tgctgctgat caagccttat gagatgtctt ccatgcaggt cattgagaat 240

gctatccgta actctgacct tggtgttaac cccaccaacg atggccaggt gctgcgtgtg 300

accatcccac agcttactga agagcgtcgt aaggacatgg tcaagcttgc taagggtaag 360

ggcgaagacg gcaagattgc cattcgtaac atccgccgca agggcatgga ccagctaaag 420

aagctgcaaa aagatggcga cgctggcgaa gatgaagtac aggcagcaga aaaagaacta 480

gataaagtca ccgctggttt tgttgcgcag gtcgatgaag tcgttgctcg caaggaaaag 540

gaactgatgg aggtctag 558

 

<210> SEQ ID NO: 4

<211> 1311

<212> DNA

<213> ilvA

 

<400> 1

atgagtgaaa catacgtgtc tgagaaaagt ccaggagtga tggctagcgg agcggagctg 60

attcgtgccg ccgacattca aacggcgcag gcacgaattt cctccgtcat tgcaccaact 120

ccattgcagt attgccctcg tctttctgag gaaaccggag cggaaatcta ccttaagcgt 180

gaggatctgc aggatgttcg ttcctacaag atccgcggtg cgctgaactc tggagcgcag 240

ctcacccaag agcagcgcga tgcaggtatc gttgccgcat ctgcaggtaa ccatgcccag 300

ggcgtggcct atgtgtgcaa gtccttgggc gttcagggac gcatctatgt tcctgtgcag 360

actccaaagc aaaagcgtga ccgcatcatg gttcacggcg gagagtttgt ctccttggtg 420

gtcactggca ataacttcga cgaagcatcg gctgcagcgc atgaagatgc agagcgcacc 480

ggcgcaacgc tgatcgagcc tttcgatgct cgcaacaccg tcatcggtca gggcaccgtg 540

gctgctgaga tcttgtcgca gctgacttcc atgggcaaga gtgcagatca cgtgatggtt 600

ccagtcggcg gtggcggact tcttgcaggt gtggtcagct acatggctga tatggcacct 660

cgcactgcga tcgttggtat cgaaccagcg ggagcagcat ccatgcaggc tgcattgcac 720

aatggtggac caatcacttt ggagactgtt gatccctttg tggacggcgc agcagtcaaa 780

cgtgtcggag atctcaacta caccatcgtg gagaagaacc agggtcgcgt gcacatgatg 840

agcgcgaccg agggcgctgt gtgtactgag atgctcgatc tttaccaaaa cgaaggcatc 900

atcgcggagc ctgctggcgc gctgtctatc gctgggttga aggaaatgtc ctttgcacct 960

ggttctgtcg tggtgtgcat catctctggt ggcaacaacg atgtgctgcg ttatgcggaa 1020

atcgctgagc gctccttggt gcaccgcggt ttgaagcact acttcttggt gaacttcccg 1080

caaaagcctg gtcagttgcg tcacttcctg gaagatatcc tgggaccgga tgatgacatc 1140

acgctgtttg agtacctcaa gcgcaacaac cgtgagaccg gtactgcgtt ggtgggtatt 1200

cacttgagtg aagcatcagg attggattct ttgctggaac gtatggagga atcggcaatt 1260

gattcccgtc gcctcgagcc gggcacccct gagtacgaat acttgaccta a 1311

 

<210> SEQ ID NO: 5

<211> 2413

<212> DNA

<213> ilvBN

<400> 5

gtgaatgtgg cagcttctca acagcccact cccgccacgg ttgcaagccg tggtcgatcc 60

gccgcccctg agcggatgac aggtgcaaag gcaattgttc gatcgctcga ggagcttaac 120

gccgacatcg tgttcggtat tcctggtggt gcggtgctac cggtgtatga cccgctctat 180

tcctccacaa aggtgcgcca cgtcttggtg cgccacgagc agggcgcagg ccacgcagca 240

accggctacg cgcaggttac tggacgcgtt ggcgtctgca ttgcaacctc tggcccagga 300

gcaaccaact tggttacccc aatcgctgat gcaaacttgg actccgttcc catggttgcc 360

atcaccggcc aggtcggaag tggcctgctg ggtaccgacg ctttccagga agccgatatc 420

cgcggcatca ccatgccagt gaccaagcac aacttcatgg tcaccaaccc taacgacatt 480

ccacaggcat tggctgaggc attccacctc gcgattactg gtcgccctgg ccctgttctg 540

gtggatattc ctaaggatgt ccagaacgct gaattggatt tcgtctggcc accaaagatc 600

gacctgccag gctaccgccc agtttcaaca ccacatgctc gccagatcga gcaggcagtc 660

aagctgatcg gtgaggccaa gaagcccgtc ctttacgttg gtggtggcgt aatcaaggct 720

gacgcacacg aagagcttcg tgcgttcgct gagtacaccg gcatcccagt tgtcaccacc 780

ttgatggctt tgggtacttt cccagagtct cacgagctgc acatgggtat gccaggcatg 840

catggcactg tgtccgctgt tggtgcactg cagcgcagcg acctgctgat tgctatcggc 900

tcccgctttg atgaccgcgt caccggtgac gttgacacct tcgcgcctga cgccaagatc 960

attcacgccg acattgatcc tgccgaaatc ggcaagatca agcaggttga ggttccaatc 1020

gtgggcgatg cccgcgaagt tcttgctcgt ctgctggaaa ccaccaaggc aagcaaggca 1080

gagaccgagg acatctccga gtgggttgac tacctcaagg gcctcaaggc acgtttcccg 1140

cgtggctacg acgagcagcc aggcgatctg ctggcaccac agtttgtcat tgaaaccctg 1200

tccaaggaag ttggccccga cgcaatttac tgcgccggcg ttggccagca ccaaatgtgg 1260

gcagctcagt tcgttgactt tgaaaagcca cgcacctggc tcaactccgg tggactgggc 1320

accatgggct acgcagttcc tgcggccctt ggagcaaagg ctggcgcacc tgacaaggaa 1380

gtctgggcta tcgacggcga cggctgtttc cagatgacca accaggaact caccaccgcc 1440

gcagttgaag gtttccccat taagatcgca ctaatcaaca acggaaacct gggcatggtt 1500

cgccaatggc agaccctatt ctatgaagga cggtactcaa atactaaact tcgtaaccag 1560

ggcgagtaca tgcccgactt tgttaccctt tctgagggac ttggctgtgt tgccatccgc 1620

gtcaccaaag cggaggaagt actgccagcc atccaaaagg ctcgagagat caacgaccgc 1680

ccagtagtca tcgacttcat cgtcggtgaa gacgcacagg tatggccaat ggtgtctgct 1740

ggatcatcca actccgatat ccagtacgca ctcggattgc gcccattctt tgatggtgat 1800

gaatctgcag cagaagatcc tgccgacatt cacgaagccg tcagcgacat tgatgccgcc 1860

gttgaatcga ccgaggcata aggagagacc caagatggct aattctgacg tcacccgcca 1920

catcctgtcc gtactcgttc aggacgtaga cggaatcatt tcccgcgtat caggtatgtt 1980

cacccgacgc gcattcaacc tcgtgtccct cgtgtctgca aagaccgaaa cacacggcat 2040

caaccgcatc acggttgttg tcgacgccga cgagctcaac attgagcaga tcaccaagca 2100

gctcaacaag ctgatccccg tgctcaaagt cgtgcgactt gatgaagaga ccactatcgc 2160

ccgcgcaatc atgctggtta aggtctctgc ggacagcacc aaccgtccgc agatcgtcga 2220

cgccgcgaac atcttccgcg cccgagtcgt cgacgtggct ccagactctg tggttattga 2280

atccacaggc accccaggca agctccgcgc actgcttgac gtgatggaac cattcggaat 2340

ccgcgaactg atccaatccg gacagattgc actcaaccgc ggtccgaaga ccatggctcc 2400

ggccaagatc taa 2413

<210> SEQ ID NO: 6

<211> 963

<212> DNA

<213> ppnk

<400> 6

atgactgcac ccacgaacgc tggggaactc aggcgagttt tgctggttcc acacaccggg 60

cgttcttcca atattgaatc cgccatcttg gcagccaagc tgctcgacga tgctggaatc 120

gatgtgaggg tgctgatcaa tgatgcagat gatccaattg cagagcactc cgttttaggc 180

cgtttcaccc atgtcaggca cgctgcagac gccgctgacg gcgcagaact agttctggtg 240

ctgggtggag atggcacctt cctccgcgca gcagatatgg cccacgctgt tgatttgcct 300

gttctgggca tcaacctagg ccatgtggga ttcttggctg aatgggagtc tgactcactt 360

gaagaggcac tcaaacgtgt gatcgaccgc gattaccgta ttgaagatcg catgacctta 420

actgtcgttg tcctagacgg cggtggagaa gaaatcggcc gaggctgggc tctcaatgag 480

gtcagtattg aaaacttaaa ccgcagggga gtgctcgatg caaccctcga ggtagatgca 540

cgaccagttg cttcctttgg ttgcgatggc gtgctgattt ccaccccaac cggctccacc 600

gcttatgcat tttccgccgg tggtcctgta ctgtggccag aactcgatgc catcttggtg 660

gttcctaata acgcccacgc gctgtttacc aaaccgctgg ttgtgagccc aaaatccacc 720

gtagctgtgg aatccaattc agatacttca gcagcgatgg ccgtcatgga tggtttccgt 780

cccattccta tgcctccagg atcccgtgtt gaggtcacca ggggtgagcg tcccgtgcgt 840

tgggtgaggc ttgattcttc accgtttacc gaccgacttg tgagcaaatt aaggctcccc 900

gttaccggtt ggcggggtcc gcaaaaacag gcggaaaata aagatcccag gtcagcgggg 960

taa 963

 

Claims (8)

1. ILE genetic engineering bacterium is produced in a strain, its Classification And Nomenclature be Corynebacterium glutamicum ( corynebacterium glutamicum) IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnk,be preserved in China typical culture collection center, deposit number: CCTCC NO:M2014529.

2. produce ILE genetic engineering bacterium according to claim 1, it is characterized in that, cover genome by plasmid alrgenetic flaw, thus make expression vector stable existence in the antibiotic-free interpolation situation exercise expressive function in thalline, described bacterial strain comprises alrgene defection type expressive host.

3. produce ILE genetic engineering bacterium according to claim 2, it is characterized in that, described expressive host is the gene being knocked encoding alanine racemase alrcorynebacterium glutamicum ( corynebacterium glutamicum).

4. according to Claims 2 or 3, produce ILE genetic engineering bacterium, it is characterized in that, described expressive host be by alrknockout carrier is transformed into corynebacterium glutamicum, is obtained by homologous recombination alrdefective type expressive host, described in alrthe nucleotide sequence of knockout carrier is as SEQ ID NO.1.

5. produce ILE genetic engineering bacterium according to claim 4, described in alrdefective type expressive host, its construction process, is characterized in that, key step is:

(1) with c. glutamicumiWJ001 genome is template, respectively with alr-S-(+)/(-) and alr-X-(+)/(-) is for each 1000bp's of primer amplification alrgene upstream and downstream fragment alr-U and alr-D; Take pDTW-202 as template, kan-lox-F/R is primer amplification kanresistance gene fragment; alr-U with xhoi, bamHi enzyme is cut, alr-D with xbai and psti enzyme is cut, kanfragment with bamHi, xbai enzyme is cut, three fragments be connected into together with xhoi and pstpBluescript II SK (+) that I enzyme is cut, the plasmid built namely alrknockout carrier, called after pJXW-1;

(2) will alrknockout carrier transforms Host Strains, is obtained by homologous recombination alrgene defection type expressive host bacterium.

6. according to claim 1 or 5, produce ILE genetic engineering bacterium, it is characterized in that, coexpression gene fusA- frr- ilvBN-ilvA-ppnk, its nucleotide sequence is respectively: fusAfor SEQ ID NO.2, frrfor SEQ ID NO.3, ilvAfor SEQ ID NO.4, ilvBNfor SEQ ID NO.5, ppnkfor SEQ ID NO.6.

7. according to claim 1,5 or 6, produce ILE genetic engineering bacterium, described expression vector pJYW-4- fusA- frr- ilvBN-ilvA- ppnk, its construction process, is characterized in that, key step is:

(1) increase fusA-frrgene fragment: fusA-frrtwo ends are introduced respectively noti and nhei restriction enzyme site; By PCR primer fus-frrfragment is connected into the expression vector pJYW-4 cut with same restriction enzyme after cutting with corresponding restriction enzyme, obtain recombinant expression plasmid pJYW-4- fusA- frr;

(2) increase ilvBN- ilva- ppnkgene fragment: ilvBN- ilva- ppnktwo ends are introduced respectively sfii and asci restriction enzyme site; By PCR primer ilvBN- ilva- ppnkfragment is connected into the expression vector pJYW-4-cut with same restriction enzyme after cutting with corresponding restriction enzyme fusA- frr, obtain recombinant expression plasmid pJYW-4- fusA- frr- ilvBN-ilvA- ppnk;

(3) by recombinant expression plasmid pJYW-4- fusA-frr-ilvBN-ilvA-ppnkproceed to and pass through alrknockout carrier knocks out alrthe corynebacterium glutamicum of gene, obtains genetic engineering bacterium IWJ001 Δ alr/ pJYW-4- fusA- frr- ilvBN-ilva- ppnk.

8. produce the application of ILE genetic engineering bacterium described in claim 1,5 or 6, it is characterized in that for the product ILE that ferments.