CN104450899A - Preparation method of RBM5 FISH probe for lung cancer detection - Google Patents
Preparation method of RBM5 FISH probe for lung cancer detection Download PDFInfo
- Publication number
- CN104450899A CN104450899A CN201410704376.0A CN201410704376A CN104450899A CN 104450899 A CN104450899 A CN 104450899A CN 201410704376 A CN201410704376 A CN 201410704376A CN 104450899 A CN104450899 A CN 104450899A
- Authority
- CN
- China
- Prior art keywords
- rbm5
- probe
- lung cancer
- preparation
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
Abstract
The invention provides a preparation method of an RBM5 FISH probe for lung cancer detection. The RBM5 FISH probe can be applied to early diagnosis of lung cancer, can significantly improve the diagnosis accuracy when combined with an existing molecular probe, is applicable to multiple types of detection samples, such as paraffin sections, cell drops, cell smears and sputum cells, and can be applied to detection of various clinical samples. A kit can be prepared from the RBM5 FISH probe, the RBM5 FISH probe can be applied to fields of tumor biology, cytogenetics and the like, and comprehensive assessment on relations between various molecular markers and development of the lung cancer is facilitated.
Description
Technical field
The present invention relates to biological technical field, specifically a kind of preparation method of the RBM5FISH probe for lung cancer detection.
Background technology
Lung cancer is current one of the most common, human malignancies that lethality rate is the highest in the world, and sickness rate is worldwide in rising trend.One of reason of patients with lung cancer high mortality is caused to be the shortage of early diagnosis technology.Scientific research shows, and be in middle and advanced stage when a lot of patients with lung cancer occurs that clinical symptom is gone to a doctor, its 5 years survival rates are less than 15%; And early stage particularly the making a definite diagnosis of I phase of lung cancer will significantly improve patient's 5 years survival rates to 80%.
The sudden change that generation development and the series of genes of lung cancer comprise EGFR, KRAS, ALK etc. is relevant, and discovered in recent years RBM5 (RNA-binding motif protein 5) has important effect in lung cancer develops.RBM5 was cloned out in 1996, once LUCA-15, RBM5, H37 etc. were named as, be RNA binding motif protein family member, be positioned at No. 3 the short arm of a chromosome 2 districts 1 and be with 3 subzones (3p21.3), in the tumor suppressor gene region of the Human Lung Cancer of supposition.Research finds, the loss of heterozygosity of 3p21.3 regional gene is the modal chromosomal change of lung precancerous lesion, there is deficient phenomena in RBM5 in people's cancerous lung tissue, and the RBM5 expression level of the From Lung Squamous Carcinoma Patients of 65% and the patients with lung adenocarcinoma of 85% is starkly lower than nonneoplastic tissue.In vitro cell experiment and experimentation on animals show, RBM5 has the function suppressing lung cancer cell growth and transfer.
Genovariation is tumorigenic earliest events, and in developing cancer, the monitoring of specific gene is the effective means of examination early-stage cancer.Fluorescence in situ hybridization (Fluorescence in situhybridization, FISH) becomes the important technology detecting transgenation at present clinically with its highly sensitive and specificity.At present, ALK gene is reset and is detected in the clinical diagnosis of lung cancer, and Abbott Laboratories Vysis ALK Break Apart FISH probe test kit is that lung cancer FISH detects the most frequently used test kit.Due to lung cancer develop in there is many polygenic effects, the accuracy rate that polygene detects is significantly higher than single-gene and detects, and the exploitation of the new probe such as RBM5 will the approach of developing lung cancer detection, and multiprobe coupling can significantly improve the accuracy of diagnosis.The disappearance of RBM5 detects to let others have a look in advance in comparatively early stage suffers from the risk of lung cancer.
Summary of the invention
The invention provides a kind of preparation method of the RBM5FISH probe for lung cancer detection, whether suffer from lung cancer by the disappearance diagnosis patient of the probe in detecting RBM5 of preparation, have the advantages that detection sensitivity is high, specificity is good, the accuracy rate of pulmonary cancer diagnosis can be improved.
For realizing above object, the present invention by the following technical solutions:
For a preparation method for the RBM5FISH probe of lung cancer detection, comprise the steps:
The screening of step one, clone: by all clones containing RBM5 gene of NCBI Mapview database retrieval, and these clones are screened, select optimum clone; Clone Life Technology RPCI11.C is bought according to the optimum clone numbering filtered out;
The cultivation of step 2, clone:
With toothpick picked clones RPCI11.C, ruling containing on the LB solid medium of 25 μ g/ml paraxin, the 37 DEG C of static gas wave refrigerator 16-24h of the LB solid medium after line are being obtained the mono-bacterium colony of RPCI11.C; The mono-bacterium colony of picking RPCI11.C proceeds to 5ml containing in the LB liquid nutrient medium of 25 μ g/ml paraxin, and 37 DEG C of 220rpm/min cultivate 8-12h; Get the above-mentioned nutrient solution of 0.5-1ml and proceed to 100ml containing in the LB liquid nutrient medium of 25 μ g/ml paraxin, 37 DEG C of 220rpm/min cultivate 16-24h and obtain cloning nutrient solution;
The extraction of step 3, RBM5 gene:
Collect clone's nutrient solution that above-mentioned steps two obtains, the centrifugal 10min of 3000rpm/min; Get precipitation, application extraction of plasmid DNA test kit extracts RBM5 gene; 0.8% agarose gel electrophoresis is used to detect concentration and the purity of the RBM5 gene extracted;
The qualification of step 4, RBM5 gene:
Use upstream primer and downstream primer to carry out pcr amplification for RBM5 gene, and by 1% sugared gel electrophoresis, amplified production fragment is analyzed, to complete the qualification of RBM5 gene;
The preparation of step 5, RBM5 probe:
Application nick-translation carries out fluorescent mark to RBM5 gene, carries out alcohol settling obtain RBM5 probe, lucifuge ,-20 DEG C of storages to marker;
The checking of step 6, RBM5 probe
End user's cancerous lung tissue detects sample and carries out probe checking.
As above for the preparation method of the RBM5FISH probe of lung cancer detection, the optimum containing RBM5 gene described in step one is cloned, and is numbered RP11-493K19.
As above for the preparation method of the RBM5FISH probe of lung cancer detection, in step 4, the upstream primer of RBM5PCR amplification is: AATCCCAGCCTCAGTAGTATCCA, downstream primer is: GCACCCTACACTTTATCACAGCA.
As above for the preparation method of the RBM5FISH probe of lung cancer detection, the checking of step 6 RBM5 probe specifically comprises the steps:
(1) tissue to be detected is fixed on slide, pre-treatment is carried out to the tissue to be measured on slide; (2) sex change tissue to be measured on RBM5 probe and slide being carried out nucleotide sequence is hybridized; (3), after hybridization, slide is washed; (4) use and redye liquid the hybridising region on slide is redyed; (5) hybridising region of fluorescence microscope slide is used.
As above for the preparation method of the RBM5FISH probe of lung cancer detection, the pre-treatment of the described tissue to be detected of step (1) is:
The molten wax 30min of (a) paraffin section 80 DEG C,
B () Histo-Clear II dewaxes 15 minutes,
(c) soaked in absolute ethyl alcohol 10 minutes,
(d) running water 10 minutes,
E () Proteinase K 8ug/ml digests 1h 40min,
(f) running water 30 minutes.
As above for the preparation method of the RBM5FISH probe of lung cancer detection, the nucleotide sequence sex change of described RBM5 probe and tissue to be measured is hybridized and is by step (2):
A () will soak 45 minutes through the 98 DEG C of water-baths of the pretreated paraffin section of step (1),
(b) distilled water immersion 5 minutes,
C () blots the moisture on paraffin section with thieving paper,
D (), with 7 μ l lysis hybridization buffer CEP-3 probe and RBM5 probes, is mended and is added water to 10 μ l,
E the 10 μ l CEP-3 probes dissolved and RBM5 probe mixed solution are added in the sample areas in section by (),
F () uses mounting rubber seal sheet,
Static 7 minutes of section after (g) mounting 75 DEG C,
H () hybridization proceeded to containing 37 DEG C of hot water is wet 37 DEG C of hybridization 16-24h in box.
As above for the preparation method of the RBM5FISH probe of lung cancer detection, the described slide washing of step (3) is:
Open wet box after (a) hybridization, tear mounting glue off with tweezers,
B slide proceeds in 2 × SSC/0.1%NP-40 washing lotion of 25 DEG C by (), soaking at room temperature 5 minutes, removes cover glass,
C () proceeds in 2 × SSC/0.3%NP-40 washing lotion of 72 DEG C by removing the slide after cover glass, wash 5 minutes,
D slide after washing proceeds to rapidly in 70% ethanol by (), soaking at room temperature 5 minutes.
As above for the preparation method of the RBM5FISH probe of lung cancer detection, described in step (4), the method for redying is:
A () takes out the slide in 70% ethanol with tweezers, dark place seasoning,
B () adds 10ul DAPI, covered,
C () wraps up with tinfoil, directly observe or put into-20 DEG C of Refrigerator stores.
As above for the preparation method of the RBM5FISH probe of lung cancer detection, step (5) described observational technique is:
A (), with fluorescence microscope, observes monochromatic result with red, green, blue excitation light spectral filter successively,
B () observes three look results in threeway position,
C () adopts figure with FISH2.0 software,
D () result judges: add up the number of red fluorescent and green florescent signal signaling point in cell and compare, in people's cancerous lung tissue cell, CEP-3 probe takes on a red color signal, RBM5 probe is green, occur in cell that green florescent signal illustrates that RBM5 probe preparation is good and probe and cell DNA are hybridized successfully, the appearance of two kinds of fluorescent signals illustrates that probe in detecting system is excellent, being applicable to the detection of same sample different probe, illustrating that cell exists the disappearance of RBM5 gene when there is two red fluorescent and a green florescent signal in cell.
The present invention compared with prior art, has following advantages:
(1) the invention provides a kind of preparation method of new molecular probe of lung cancer early diagnosis, this molecular probe and existing molecular probe coupling can significantly improve the accuracy rate of diagnosis;
(2) the present invention is applicable to polytype detection sample, as paraffin section, cell drip sheet, cell smear, phlegm cell, is applicable to the detection of various clinical sample;
(3) the sample washing after detection method provided by the invention does not use carboxamide agents to hybridize, security is good;
(4) technical system provided by the invention is reproducible, and the technician in the fields such as molecular diagnosis and molecular medicine inspection can independent operation;
(5) the present invention can be prepared into test kit, realizes the application in the field such as oncobiology, cytogenetics, and what contribute to that each molecular marker of comprehensive evaluation and lung cancer occurs to develop contacts.
Accompanying drawing explanation
Figure 1 shows that the electroresis appraisal result of RBM5 gene of the present invention, wherein 1 road is DNAMarker, and 2 roads are blanks, and 3 roads are RBM5PCR amplified production, and the molecular weight of pcr amplification product is 363bp;
Figure 2 shows that the electroresis appraisal result of RBM5 probe of the present invention, wherein 1 road is DNAMarker, and 2 roads are RBM5 gene, and 3 roads are RBM5 probe, and probe length is 300-600bp, highlights with red boxes;
Figure 3 shows that the detected result of the present inventor's cancerous lung tissue paraffin section RBM5 probe and CEP-3 probe, wherein, CEP-3 probe takes on a red color signal, RBM5 probe is green), in the cell of the arrow instruction on the right of picture, there are two red fluorescent points and two green florescent signal points simultaneously, there is not the disappearance of RBM5 gene in it, having two red fluorescent points and a green florescent signal point in the cell of the arrow instruction on the picture left side, there is the disappearance of RBM5 gene in this cell.
Embodiment
Below in conjunction with the accompanying drawing in the present invention, the technical scheme in the present invention is clearly and completely described.
The invention provides a kind of preparation method of the RBM5FISH probe for lung cancer detection, comprise the steps:
The screening of step one, clone:
By all clones containing RBM5 gene of NCBI Mapview database retrieval, and these clones are screened, select optimum clone; The described optimum containing RBM5 gene is cloned, and is numbered RP11-493K19.
Clone Life Technology RPCI11.C is bought according to the optimum clone numbering filtered out;
The cultivation of step 2, clone:
With toothpick picked clones RPCI11.C, ruling containing on the LB solid medium of 25 μ g/ml paraxin, the 37 DEG C of static gas wave refrigerator 16-24h of the LB solid medium after line are being obtained the mono-bacterium colony of RPCI11.C;
The mono-bacterium colony of picking RPCI11.C proceeds to 5ml containing in the LB liquid nutrient medium of 25 μ g/ml paraxin, and 37 DEG C of 220rpm/min cultivate 8-12h;
Get the above-mentioned nutrient solution of 0.5-1ml and proceed to 100ml containing in the LB liquid nutrient medium of 25 μ g/ml paraxin, 37 DEG C of 220rpm/min cultivate 16-24h, obtain cloning nutrient solution.
The extraction of step 3, RBM5 gene:
Collect clone's nutrient solution that above-mentioned steps two obtains, the centrifugal 10min of 3000rpm/min; Get precipitation, application extraction of plasmid DNA test kit extracts RBM5 gene, and DNA extraction kit can use commercially available plasmid extraction kit, the Plasmid MidiKit of preferred Qiagen company;
Use 0.8% agarose gel electrophoresis to detect concentration and the purity of the RBM5 gene extracted, the Concentration Testing of RBM5 gene can use commercially available DNA Marker, preferred LambdaDNA/HindIII.
The qualification of step 4, RBM5 gene:
Use upstream primer and downstream primer to carry out polymerase chain reaction (Polymerase Chain Reaction, PCR) amplification for RBM5 gene, and by 1% sugared gel electrophoresis, amplified production fragment is analyzed, to complete the qualification of RBM5 gene.
Wherein, the upstream primer of RBM5PCR amplification is: AATCCCAGCCTCAGTAGTATCCA, and its DNA sequence dna is as shown in SEQ ID NO:1; Downstream primer is: GCACCCTACACTTTATCACAGCA, and its DNA sequence dna is as shown in SEQ ID NO:2.
The concrete steps of identifying of RBM5 gene are:
(1) reagent ice bath needed for PCR is dissolved.
(2) in PCR pipe, following material is added:
(3), after brief centrifugation, PCR instrument is put into.
(4) PCR program is set, is specially
(5), after PCR terminates, use 1% agarose gel electrophoresis to detect pcr amplification result, if there is RBM5 gene, the DNA fragmentation (as shown in Figure 1) of 363bp can be amplified.
The preparation of step 5, RBM5 probe:
Application nick-translation carries out fluorescent mark (preferred Abbott Nicktranslation kit) to RBM5 gene, carries out alcohol settling obtain RBM5 probe, lucifuge ,-20 DEG C of storages to marker.Concrete steps are as follows:
Preparation 0.2mM Green dUTP, 0.1mM dNTP, 0.1mM d TTP solution;
Following material is added in without enzyme PCR pipe:
Joined rear concussion mixing, centrifugal in short-term, 15 DEG C of mark 12h, use length and the purity (as shown in Figure 2) of 2% agarose gel electrophoresis detection probes;
Alcohol settling is carried out to marker and obtains RBM5 probe, lucifuge ,-20 DEG C of storages.
Gene probe also can use 1 ~ 2 μ l HumanCot-1DNA (1 μ g/ μ l) dissolution precipitation, avoid occurring non-specific hybridization in follow-up hybrid experiment after using alcohol settling concentrated.
The checking of step 6, RBM5 probe
End user's cancerous lung tissue paraffin section carries out probe checking.Specifically comprise the steps: that tissue to be detected is fixed on slide by (1), pre-treatment is carried out to the tissue to be measured on slide; (2) sex change tissue to be measured on the RBM5 probe of above-mentioned preparation and slide being carried out nucleotide sequence is hybridized; (3), after hybridization, slide is washed; (4) use and redye liquid the hybridising region on slide is redyed; (5) hybridising region of fluorescence microscope slide is used.
In such scheme, the described source detecting tissue of step (1) is that get the fresh cancerous lung tissue that hospital of attached Tongji University of the Central China University of Science and Technology is postoperative, neutral formalin is fixed, specimens paraffin embedding slices.
In such scheme, the pre-treatment of the described tissue to be detected of step (1) is:
The molten wax 30min of (a) paraffin section 80 DEG C.
B () Histo-Clear II dewaxes 15 minutes, Histo-Clear II can adopt commercially available product, the Histo-Clear II of preferred National Diagnostics company.
(c) soaked in absolute ethyl alcohol 10 minutes.
(d) running water 10 minutes.
E () Proteinase K 8ug/ml digests 1h 40min.
(f) running water 30 minutes.
In such scheme, the nucleotide sequence sex change of described RBM5 probe and tissue to be measured is hybridized and is by step (2):
A paraffin section 98 DEG C of water-baths after washing in step (1) are soaked 45 minutes by ().
(b) distilled water immersion 5 minutes.
C () blots the moisture on paraffin section with thieving paper.
D () adds water to 10 μ l by 7 μ l lysis hybridization buffer CEP-3 probe and RBM5 probes, benefit, CEP-3 probe can adopt commercially available probe, the orange fluorescein CEP-3 probe of Abbott of the preferred U.S..
E the 10 μ l CEP-3 probes dissolved and RBM5 probe mixed solution are added in the sample areas in section by ().
F () uses mounting rubber seal sheet, mounting glue can adopt commercially available prod or nail varnish, preferred Best-Test Products.
Static 7 minutes of section after (g) mounting 75 DEG C.
H () hybridization proceeded to containing 37 DEG C of hot water is wet in box, 37 DEG C of hybridization 16-24h.
In such scheme, the described slide washing of step (3) is:
Open wet box after (a) hybridization, tear mounting glue off with tweezers.
B slide proceeds in 2 × SSC/0.1%NP-40 washing lotion of 25 DEG C by (), soaking at room temperature 5 minutes, removes cover glass.
C () proceeds in 2 × SSC/0.3%NP-40 washing lotion of 72 DEG C by removing the slide after cover glass, wash 5 minutes.
D slide after washing proceeds to rapidly in 70% ethanol by (), soaking at room temperature 5 minutes.
In such scheme, described in step (4), the method for redying is:
A () takes out the slide in 70% ethanol with tweezers, dark place seasoning.
B () adds 10ul DAPI, covered, and DAPI can adopt commercially available reagent, preferred vector Products.
C () wraps up with tinfoil, directly observe or put into-20 DEG C of Refrigerator stores.
In such scheme, step (5) described observational technique is:
A () observes with fluorescent microscope (fluorescent microscope can adopt commercially available triple channel fluorescent microscope, preferred Olympus BX51), observe monochromatic result successively with red, green, blue excitation light spectral filter.Observation requirement is: find under 40 × object lens, at 100 × thing Microscopic observation; Adjust focal length, to see that signal is for standard clearly; Distinguish signal and background, when extracellular exists fluorescent signal point, note, with the differentiation of Intracellular signals point, not using the obvious area count of extracellular signal to take pictures.
B () observes three look results in threeway position.
C () adopts figure with FISH2.0 software.
D () result judges.
Add up the number of red fluorescent and green florescent signal signaling point in cell and compare.In people's cancerous lung tissue cell, CEP-3 probe takes on a red color signal, and RBM5 probe is green.Occur in cell that green florescent signal illustrates that RBM5 probe preparation is good and probe and cell DNA are hybridized successfully, the appearance of two kinds of fluorescent signals illustrates that probe in detecting system is excellent, being applicable to the detection of same sample different probe, illustrating that cell exists the disappearance (as shown in Figure 3) of RBM5 gene when there is two red fluorescent and a green florescent signal in cell.
The present invention can separately for the diagnosis of lung cancer, also can with additive methods such as ALK fusion gene detections jointly for the diagnosis of people's lung cancer.
The above; be only the specific embodiment of the present invention, but protection scope of the present invention is not limited thereto, anyly belongs to those skilled in the art in the technical scope that the present invention discloses; the change that can expect easily or replacement, all should be encompassed within protection scope of the present invention.Therefore, protection scope of the present invention should be as the criterion with the protection domain of claim.
Claims (9)
1., for a preparation method for the RBM5 FISH probe of lung cancer detection, it is characterized in that comprising the steps:
The screening of step one, clone:
By all clones containing RBM5 gene of NCBI Mapview database retrieval, and these clones are screened, select optimum clone; Clone Life Technology RPCI11.C is bought according to the optimum clone numbering filtered out;
The cultivation of step 2, clone:
With toothpick picked clones RPCI11.C, ruling containing on the LB solid medium of 25 μ g/ml paraxin, the 37 DEG C of static gas wave refrigerator 16-24h of the LB solid medium after line are being obtained the mono-bacterium colony of RPCI11.C; The mono-bacterium colony of picking RPCI11.C proceeds to 5ml containing in the LB liquid nutrient medium of 25 μ g/ml paraxin, and 37 DEG C of 220rpm/min cultivate 8-12h; Get the above-mentioned nutrient solution of 0.5-1ml and proceed to 100ml containing in the LB liquid nutrient medium of 25 μ g/ml paraxin, 37 DEG C of 220rpm/min cultivate 16-24h and obtain cloning nutrient solution;
The extraction of step 3, RBM5 gene:
Collect clone's nutrient solution that step 2 obtains, the centrifugal 10min of 3000rpm/min; Get precipitation, application extraction of plasmid DNA test kit extracts RBM5 gene; 0.8% agarose gel electrophoresis is used to detect concentration and the purity of the RBM5 gene extracted;
The qualification of step 4, RBM5 gene:
Use upstream primer and downstream primer to carry out pcr amplification for RBM5 gene, and by 1% sugared gel electrophoresis, amplified production fragment is analyzed, to complete the qualification of RBM5 gene;
The preparation of step 5, RBM5 probe:
Application nick-translation carries out fluorescent mark to RBM5 gene, carries out alcohol settling obtain RBM5 probe, lucifuge ,-20 DEG C of storages to marker;
The checking of step 6, RBM5 probe:
End user's cancerous lung tissue detects sample and carries out probe checking.
2., as claimed in claim 1 for the preparation method of the RBM5FISH probe of lung cancer detection, it is characterized in that: the optimum containing RBM5 gene described in step one is cloned, and is numbered RP11-493K19.
3. as claimed in claim 1 for the preparation method of the RBM5 FISH probe of lung cancer detection, it is characterized in that: in step 4, the upstream primer of RBM5 pcr amplification is: AATCCCAGCCTCAGTAGTATCCA, and downstream primer is: GCACCCTACACTTTATCACAGCA.
4., as claimed in claim 1 for the preparation method of the RBM5 FISH probe of lung cancer detection, it is characterized in that: the checking of step 6 RBM5 probe specifically comprises the steps:
(1) tissue to be detected is fixed on slide, pre-treatment is carried out to the tissue to be measured on slide; (2) sex change tissue to be measured on RBM5 probe and slide being carried out nucleotide sequence is hybridized; (3), after hybridization, slide is washed; (4) use and redye liquid the hybridising region on slide is redyed; (5) hybridising region of fluorescence microscope slide is used.
5., as claimed in claim 4 for the preparation method of the RBM5 FISH probe of lung cancer detection, it is characterized in that: the pre-treatment of the described tissue to be detected of step (1) is:
The molten wax 30min of (a) paraffin section 80 DEG C,
B () Histo-Clear II dewaxes 15 minutes,
(c) soaked in absolute ethyl alcohol 10 minutes,
(d) running water 10 minutes,
E () Proteinase K 8ug/ml digests 1h 40min,
(f) running water 30 minutes.
6. the preparation method of the RBM5 FISH probe for lung cancer detection as described in claim 4 or 5, is characterized in that: the nucleotide sequence sex change of described RBM5 probe and tissue to be measured is hybridized and is by step (2):
A () will soak 45 minutes through the 98 DEG C of water-baths of the pretreated paraffin section of step (1),
(b) distilled water immersion 5 minutes,
C () blots the moisture on paraffin section with thieving paper,
D (), with 7 μ l lysis hybridization buffer CEP-3 probe and RBM5 probes, is mended and is added water to 10 μ l,
E the 10 μ l CEP-3 probes dissolved and RBM5 probe mixed solution are added in the sample areas in section by (),
F () uses mounting rubber seal sheet,
Static 7 minutes of section after (g) mounting 75 DEG C,
H () hybridization proceeded to containing 37 DEG C of hot water is wet in box, 37 DEG C of hybridization 16-24h.
7. as claimed in claim 4 for the preparation method of the RBM5 FISH probe of lung cancer detection, it is characterized in that: the described slide washing of step (3) is:
Open wet box after (a) hybridization, tear mounting glue off with tweezers,
B slide proceeds in 2 × SSC/0.1%NP-40 washing lotion of 25 DEG C by (), soaking at room temperature 5 minutes, removes cover glass,
C the slide removing cover glass proceeds in 2 × SSC/0.3%NP-40 washing lotion of 72 DEG C by (), wash 5 minutes,
D slide after washing proceeds in 70% ethanol by (), soaking at room temperature 5 minutes.
8., as claimed in claim 4 for the preparation method of the RBM5 FISH probe of lung cancer detection, it is characterized in that: described in step (4), the method for redying is:
A () takes out the slide in 70% ethanol with tweezers, dark place seasoning,
B () adds 10ul DAPI, covered,
C () wraps up with tinfoil, directly observe or put into-20 DEG C of Refrigerator stores.
9., as claimed in claim 4 for the preparation method of the RBM5 FISH probe of lung cancer detection, it is characterized in that: step (5) described observational technique is:
A (), with fluorescence microscope, observes monochromatic result with red, green, blue excitation light spectral filter successively,
B () observes three look results in threeway position,
C () adopts figure with FISH2.0 software,
D () result judges: add up the number of red fluorescent and green florescent signal signaling point in cell and compare, in people's cancerous lung tissue cell, CEP-3 probe takes on a red color signal, RBM5 probe is green, occur in cell that green florescent signal illustrates that RBM5 probe preparation is good and probe and cell DNA are hybridized successfully, the appearance of two kinds of fluorescent signals illustrates that probe in detecting system is excellent, being applicable to the detection of same sample different probe, illustrating that cell exists the disappearance of RBM5 gene when there is two red fluorescent and a green florescent signal in cell.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410704376.0A CN104450899A (en) | 2014-11-27 | 2014-11-27 | Preparation method of RBM5 FISH probe for lung cancer detection |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410704376.0A CN104450899A (en) | 2014-11-27 | 2014-11-27 | Preparation method of RBM5 FISH probe for lung cancer detection |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104450899A true CN104450899A (en) | 2015-03-25 |
Family
ID=52897644
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410704376.0A Pending CN104450899A (en) | 2014-11-27 | 2014-11-27 | Preparation method of RBM5 FISH probe for lung cancer detection |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104450899A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106520932A (en) * | 2016-10-18 | 2017-03-22 | 绍兴金箓生物技术有限公司 | Detection method for detecting NK/T cell lymphoma copy number variation |
CN109136370A (en) * | 2018-05-31 | 2019-01-04 | 广州表观生物科技有限公司 | A kind of prognostic markers object of lung cancer and its application |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1125947A1 (en) * | 1998-10-30 | 2001-08-22 | Japan Science and Technology Corporation | HUMAN H37 PROTEINS AND cDNAS ENCODING THE SAME |
WO2003064676A2 (en) * | 2001-09-21 | 2003-08-07 | The Regents Of The University Of California | Diagnostic and therapeutic methods using the h37 tumor suppressor gene |
CN103276060A (en) * | 2013-04-28 | 2013-09-04 | 中国医学科学院血液病医院(血液学研究所) | Gene probe composition and kit for detecting epithelial ovarian cancer |
CN103952485A (en) * | 2014-04-24 | 2014-07-30 | 山西医科大学 | RUNX1 gene splitting and copy number increase detection kit and preparation method thereof |
-
2014
- 2014-11-27 CN CN201410704376.0A patent/CN104450899A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1125947A1 (en) * | 1998-10-30 | 2001-08-22 | Japan Science and Technology Corporation | HUMAN H37 PROTEINS AND cDNAS ENCODING THE SAME |
WO2003064676A2 (en) * | 2001-09-21 | 2003-08-07 | The Regents Of The University Of California | Diagnostic and therapeutic methods using the h37 tumor suppressor gene |
CN103276060A (en) * | 2013-04-28 | 2013-09-04 | 中国医学科学院血液病医院(血液学研究所) | Gene probe composition and kit for detecting epithelial ovarian cancer |
CN103952485A (en) * | 2014-04-24 | 2014-07-30 | 山西医科大学 | RUNX1 gene splitting and copy number increase detection kit and preparation method thereof |
Non-Patent Citations (3)
Title |
---|
JULIANA J. OH,ET AL: "3p21.3 Tumor Suppressor Gene H37/Luca15/RBM5 Inhibits Growth of Human Lung Cancer Cells through Cell Cycle Arrest andAp optosis", 《CANCER RES》, vol. 66, no. 7, 1 April 2006 (2006-04-01), pages 3419 - 3427 * |
代建丽等: "RBM5荧光原位杂交探针的制备及应用", 《生物技术》, vol. 25, no. 2, 30 April 2015 (2015-04-30), pages 173 - 175 * |
孟广平等: "潜在的肺癌肿瘤抑制基因RBM5的研究进展", 《中国免疫学杂志》, vol. 28, 31 December 2012 (2012-12-31), pages 274 - 277 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106520932A (en) * | 2016-10-18 | 2017-03-22 | 绍兴金箓生物技术有限公司 | Detection method for detecting NK/T cell lymphoma copy number variation |
CN109136370A (en) * | 2018-05-31 | 2019-01-04 | 广州表观生物科技有限公司 | A kind of prognostic markers object of lung cancer and its application |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2006047484A2 (en) | Molecular analysis of cellular fluid and liquid cytology specimens for clinical diagnosis, characterization, and integration with microscopic pathology evaluation | |
ES2767853T3 (en) | Detection of immunoglobulin light chain restriction by in situ hybridization of RNA | |
US20200199687A1 (en) | Materials and methods for assessing progression of prostate cancer | |
Chung et al. | Clonal evolution of lung tumors | |
CN114196766B (en) | Molecular marker, primer pair, kit and method for specifically identifying rice ralstonia solanacearum Xoo | |
WO2017114007A1 (en) | Pml gene and rara gene detection probe, preparation method therefor, and test kit | |
CN102409110A (en) | In-situ hybridization detection kit and method thereof for human papilloma virus | |
CN104450899A (en) | Preparation method of RBM5 FISH probe for lung cancer detection | |
CN110564850A (en) | EWSR1-TFEB fusion gene and detection primer and application thereof | |
CN102517382A (en) | Human chromosome P16 gene detection kit and application thereof | |
CN109182519B (en) | It is a kind of for diagnosing the probe combinations and its application of ACTA2-MITF transposition blood vessel week epithelioid cell's tumour | |
CN107058305A (en) | One group of nucleotide sequence and the application in EML4 ALK fusion gene quick detections | |
CN107299134B (en) | It is a kind of for diagnosing the PCR primer combination and its application of PRCC-TFE3 transposition tumour | |
CN104419763B (en) | Physical positioning method for cucumber single-copy gene on chromosome | |
WO2017114006A1 (en) | Aml1 gene and eto gene detection probe, preparation method therefor, and test kit | |
WO1999043196A2 (en) | Method of cancer diagnosis based on the detection of chromosome abnormality | |
Ding et al. | Direct visualization of the novel pathogen, S piroplasma eriocheiris, in the freshwater crayfish P rocambarus clarkii (G irard) using fluorescence in situ hybridization | |
CN108396026A (en) | The exploitation and application of the Chang Miho couchgrass indigo plant kernel Characters of decaploid special chemoattractant molecule label and fluorescence in situ hybridization probe | |
WO2017114005A1 (en) | Terc gene and/or myc gene detection probe, preparation method therefor, and reagent kit | |
CN103993067A (en) | Multiplex PCR detection method for three nematodes of Anisakidae | |
CN109022434B (en) | Probe combination for diagnosing ACTB-TFEB (active transcription factor receptor-responsive element binding) translocation renal cancer and application thereof | |
CN101824487A (en) | Method for detecting virus infection in pathological sample by combining PCR (Polymerase Chain Reaction) with nucleic acid probe dot hybridization technology | |
JP2002272497A (en) | Method for diagnosing cancer and diagnostic vector therefor | |
CN104531878A (en) | LncRNA and AR3 combined detection kit and application of detection kit | |
CN108315487A (en) | A kind of primer sets, kit and its application of detection common eel herpesviral |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150325 |