CN103276060A - Gene probe composition and kit for detecting epithelial ovarian cancer - Google Patents
Gene probe composition and kit for detecting epithelial ovarian cancer Download PDFInfo
- Publication number
- CN103276060A CN103276060A CN2013101557573A CN201310155757A CN103276060A CN 103276060 A CN103276060 A CN 103276060A CN 2013101557573 A CN2013101557573 A CN 2013101557573A CN 201310155757 A CN201310155757 A CN 201310155757A CN 103276060 A CN103276060 A CN 103276060A
- Authority
- CN
- China
- Prior art keywords
- gene probe
- gene
- probe
- clone
- chk2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a gene probe composition and a kit for detecting epithelial ovarian cancer. The gene probe composition comprises a c-myc gene probe, an Rb1 gene probe, a Chk2 gene probe, a p53 gene probe and a BRCA1 gene probe. Another objective of the invention is to provide a kit for fluorescence in situ hybridization (FISH) detection of the epithelial ovarian cancer, and the kit comprises the gene probe composition as described above. The kit can detect 5 kinds of genes in a same sample even a single tumor cell of the epithelial ovarian cancer at the same time, and thereby substantially improving detection capability and efficiency. The invention further provides an optimal sample selection strategy and a slide preparation method for an ovarian cancer FISH research.
Description
Technical field
The present invention relates to a kind of gene probe composition and test kit, relate in particular to a kind of gene probe composition and test kit that detects the epithelial ovarian cancer.
Background technology
Ovarian cancer is one of common tumour of female sex organ, and sickness rate is only second to cervical cancer and carcinoma of uterine body and is listed as and occupies the 3rd.But because ovarian cancer causes the dead, but account for the first place of all kinds of gynecological tumors, women's life is caused serious threat.The cause of disease of ovarian cancer it be unclear that, ovarian cancer is because the region of anatomy is hidden, atypical symptoms, about 70% patient has been in progressive stage (III, IV phase) when finding ovarian cancer, in recent years along with tumour subtracts carrying out of the operation combined utilization chemical therapeutic method that goes out, patient's survival rate increases, but general status and pessimistic.There is 80%～85% ovarian cancer patients to recur approximately, and chemotherapeutics such as cis-platinum are produced tolerance, become the bottleneck of further treatment.
The diagnosis of present all types of tumours has the trend that develops to the molecular diagnosis level from the level of cytodiagnosis, only rely on cytodiagnosis can satisfy the needs of clinical position far from, molecular diagnosis particularly gene diagnosis has become the development trend of tumor diagnostics because it has important effect in many-sides such as judging oncobiology behavior, judgement tumor prognosis, guidance treatment and prediction chemosensitivity.But the FISH diagnostic kit that is applied to the ovarian cancer molecular diagnosis at present still is blank on market.
Along with deepening continuously of cytogenetics and tumor aetiology research, the various chromosome instabilities that studies show that are that numerical exception (aneuploid) and structural rearrangement (disappearance, gene amplification and transposition) are closely related with the formation and development of tumour.The unusual correlative study of ovarian cancer gene group that comprises comparative genome hybridization etc. finds to comprise that a series of important gene such as c-myc, Rb1, Chk2, p53 and BRCA1 play an important role in the developing of ovarian cancer.The c-myc gene is one of important member of myc gene family, and the myc assignment of genes gene mapping is in karyomit(e) 8q24, and the myc gene mainly activates by the mode of amplification and chromosome translocation rearrangement, has lapsed to important relationship with generation, development and the differentiation of some tissue tumor.Correlative study is found, the overexpression in the ovarian epithelial cancerous tissue of the mRNA of c-myc and albumen.The frequency of c-myc gene amplification is significantly higher than ovarian epithelial benign tumor tissue and normal ovarian tissue in the ovarian cancer.
(Retinoblastoma1 Rb1) is the cancer suppressor gene of human first separating clone to retinoblastoma gene 1.The Rb1 gene is the negative regulatory factor of cell cycle, regulates cell proliferation and the required expression of gene of differentiation by being combined with transcription factor, thereby keeps the balance that cell grows.The function of this gene is relevant with cell cycle, cell aging, apoptosis, cytodifferentiation and growth-inhibiting etc.The albumen pRb of Rb1 coded by said gene is one and is positioned at nuclear phosphorprotein that relative molecular mass is about 104-110kDa.PRb is the grow crucial regulatory factor in each stage of cell, and an amount of expression of pRb is that the organism normal growth is grown necessary.PRb mainly keeps the balance that biology growing is grown by cell cycle and various tissue, the associated transcription factor of organ and the regulation and control of albumen, in case pRb inactivation or mistake are expressed abnormality proliferation, aging or the apoptosis that will cause cell, normal organ-tissue generation pathologic is changed, cause the generation of various diseases, and finally influence organism growing development.Have and studies confirm that the Rb1 path is found in the ovarian serous papilloma unusually; Make mouse ovarian superficial epithelium p53 and Rb1 gene be total to inactivation and can bring out the cancer generation.
Checkpoint Kinase 2 (Chk2) is a recent newfound cell cycle regulating protein.Dna damage takes place or copies retardance after, cell activates Chk2 by different approaches, and then act on the different target protein in downstream, final activate G1, S and (or) G2/M phase check point mechanism, cell cycle progression is blocked, activate simultaneously and repair transcribing of genes involved, promote cell that damage is repaired.The Chk2 transgenation has certain meaning in tumor invasion, but its incidence is lower.Tumour cell can be strengthened injury repairing by activating Chk2, causes drug-resistant phenotype to produce.
The mutation rate of p53 gene nearly 50% in all human tumors, when undergoing mutation, the p53 gene can cause stable protein can not finish the effect that suppresses cell proliferation, and promotion vicious transformation, tumor invasion power strengthens, make the p53 gene transfer proto-oncogene to by cancer suppressor gene, the p53 of sudden change loses the function that suppresses growth of tumour cell, thereby promotes the generation of malignant tumour.
BRCA1 gene (breast cancer susceptibility gene l) ovarian cancer-breast cancer susceptibility gene is cancer suppressor gene, its cancer suppressor protein of encoding, participate in many important cell activities, as regulation and control, transcription activating and inhibition, Chromatin Remodeling, the centrosome of cell cycle copy, dna damage reparation etc.Normal BRCA1 genes encoding BRCA1 albumen plays restraining effect to growth of tumor, if owing to congenital heredity or the reason producer sudden change day after tomorrow, the gene product effect disappears or reduces, and just may cause the generation of ovarian tumor.The low expression of BRCA1 may be relevant with generation, the development of epithelial ovarian cancer.
In sum, these 5 kinds of genes of c-myc, Rb1, Chk2, p53 and BRCA1 and ovarian cancer has a close relationship.
Summary of the invention
Technical problem to be solved by this invention is: a kind of gene probe composition and test kit that detects the epithelial ovarian cancer is provided, can be used for determining the molecular pathology type of epithelial ovarian cancer, judge state of an illness prognosis, instruct individualized treatment, the assessment clinical therapeutic efficacy, the recurrence of monitoring focus and transfer.
In order to address the above problem, the technical solution used in the present invention is:
The invention provides a kind of gene probe composition that detects the epithelial ovarian cancer, comprise the c-myc gene probe, Rb1 gene probe, Chk2 gene probe, p53 gene probe and BRCA1 gene probe.
Preferably, described gene probe composition comprises:
C-myc gene probe: RP11-440N18 (UCSC genome browser);
Rb1 gene probe: RP11-305D15 (UCSC genome browser);
Chk2 gene probe: RP11-73I4 (UCSC genome browser);
P53 gene probe: RP11-1081A10 (UCSC genome browser);
BRCA1 gene probe: RP11-831F13 (UCSC genome browser).
Related gene probe is through fluorescein-labeled probe in the said gene probe compositions.
Embodiment preferred according to the present invention, c-myc, Rb1, Chk2, p53, BRCA1 individual gene probe preparation process are as follows:
1), colony screening: retrieval UCSC genome browser, NCBI Clone Registry, databases such as Ensembl Genome Browser contain c-myc respectively, Rb1, Chk2, p53, all clones of BRCA1 gene, and these clones are screened, best clone selected;
2), the clone cultivates and identifies: number according to the definite clone of screening and buy BAC clone (American I nvitrogen company), get 5-10 microlitre clone bacterium liquid and be added to the 3-5 milliliter and contain in the LB liquid nutrient medium of paraxin resistance, 37 ℃ of jolting activation culture 8-16 hour; Then bacterium liquid all is added in the LB liquid nutrient medium that the 400-500 milliliter contains the paraxin resistance, 37 ℃ jolt and cultivated 8-16 hour; BAC clone to c-myc, Rb1, Chk2, p53, BRCA1 carries out the polymerase chain reaction amplification with corresponding gene primer, with the agarose gel electrophoresis of 1-2% product is analyzed, thereby is finished clone's to be selected Molecular Identification;
3), preparation and the checking of gene probe: after obtaining the clone of goal gene, extract a large amount of DNA, with the ND-1000 ultramicrospectrophotometer plasmid is carried out concentration and purity (260nm/280nm) mensuration; Adopt the method for nick translation that plasmid DNA is carried out fluorescent mark, (select the spectral filter coupling combination of the fluorescent microscope of best fluorescence dye and microscopy, make detected fluorescence signal intensity maximum); Marked product is precipitated and concentrates; Fluorescently-labeled probe is dissolved in the hybridization buffer that contains 50% deionized formamide, and-20 ° of C lucifuges store, and adopt normal people's peripheral blood mononuclear cell to get rid of sheet and carry out the probe evaluation.
Embodiment preferred according to the present invention, c-myc, Rb1, Chk2, p53, BRCA1 gene probe preparation of compositions step are as follows:
1), colony screening: retrieval UCSC genome browser, NCBI Clone Registry, all bacterial artificial chromosomes (BAC) clone that databases such as Ensembl Genome Browser contain c-myc, Rb1, Chk2, p53 and BRCA1 gene respectively selects best clone.
2), the clone cultivates: the clone who determines according to screening numbers and buys BAC clone (American I nvitrogen company), gets 5-10 microlitre clone bacterium liquid and is added to the 3-5 milliliter and contains in the LB liquid nutrient medium of paraxin resistance, 37 ℃ of jolting activation culture 8-16 hour; Then bacterium liquid all is added in the LB liquid nutrient medium that the 400-500 milliliter contains the paraxin resistance, 37 ℃ jolt and cultivated 8-16 hour.BAC clone to c-myc, Rb1, Chk2, p53, BRCA1 carries out the polymerase chain reaction amplification with corresponding gene primer, with the agarose gel electrophoresis of 1-2% product is analyzed, thereby is finished clone's to be selected Molecular Identification;
3), the preparation of gene probe and evaluation: after obtaining the clone of goal gene, extract a large amount of DNA, the DNA that enzyme is cut after the method that adopts nick translation behind the DNA is cut enzyme carries out fluorescein-labelled, again to precipitating after c-myc, Rb1, Chk2, p53 and the combination of BRCA1 gene probe and concentrating, the probe compositions of making is dissolved in the hybridization buffer that contains 50% deionized formamide, namely get fluorescence labeling probe group hybridization mixed solution, adopt normal people's peripheral blood mononuclear cell to get rid of sheet and carry out the probe evaluation.
Superior embodiment according to the present invention contains the clone of c-myc gene optimum in the colony screening step, be numbered RP11-440N18 (UCSC genome browser);
Superior embodiment according to the present invention contains the clone of Rb1 gene optimum in the colony screening step, be numbered RP11-305D15 (UCSC genome browser);
Superior embodiment according to the present invention contains the clone of Chk2 gene optimum in the colony screening step, be numbered RP11-73I4 (UCSC genome browser);
Superior embodiment according to the present invention contains the clone of p53 gene optimum in the colony screening step, be numbered RP11-1081A10 (UCSC genome browser);
Superior embodiment according to the present invention contains the clone of BRCA1 gene optimum in the colony screening step, be numbered RP11-831F13 (UCSC genome browser).
Superior embodiment according to the present invention, the c-myc gene primer sequence of using in clone's cultivation and the authentication step is:
C-myc gene probe: upstream primer: TACTGCGACGAGGAGGAGAA (SEQ ID NO:1)
Downstream primer: CGAAGGGAGAAGGGTGTGAC (SEQ ID NO:2).
Superior embodiment according to the present invention, the Rb1 gene primer sequence of using in clone's cultivation and the authentication step is:
Rb1 gene probe: upstream primer: TGCAGTATGCTTCCACCAGG (SEQ ID NO:3)
Downstream primer: TGTTGGTGTTGGCAGACCTT (SEQ ID NO:4).
Superior embodiment according to the present invention, the Chk2 gene primer sequence of using in clone's cultivation and the authentication step is:
Chk2 gene probe: upstream primer: ATTTTGTCAGGGCCAACATACTG (SEQ ID NO:5)
Downstream primer: CCCATCGCCTCTTAGGTAAATTC (SEQ ID NO:6).
Superior embodiment according to the present invention, the P53 gene primer sequence of using in clone's cultivation and the authentication step is:
P53 gene probe: upstream primer: GAACAGCTTTGAGGTGCGTG (SEQ ID NO:7)
Downstream primer: CTTCTTTGGCTGGGGAGAGG (SEQ ID NO:8).
Superior embodiment according to the present invention, the BRCA1 gene primer sequence of using in clone's cultivation and the authentication step is:
BRCA1 gene probe: upstream primer: TAGGGCTGGAAGCACAGAGT (SEQ ID NO:9)
Downstream primer: AATTTCCTCCCCAATGTTCC (SEQ ID NO:10).
The polymerase chain reaction amplification condition is: 95 ℃ of pre-sex change 5 minutes; (" 95 ℃ of sex change 1 minute; 60 ℃ of annealing 30 seconds, 72 ℃ of renaturation 30 seconds ") circulation 35 times; 72 ℃ of extensions 7 minutes.
According to a preferred method of the present invention: with the EcoR1 enzyme target DNA is carried out enzyme in the gene probe preparation process and cut, the concentration of EcoR1 enzyme is 0.1 unit/microlitre; The usage quantity of deoxyribonucleic acid polymerase I is 10 units in the 50 microlitre nick translation systems, and the deoxyribonuclease I usage quantity is 50 nanograms.
Preferred version according to the present invention, when the DNA with the good fluorescein of mark precipitates, add the unlabelled competitive CotDNA of three-type-person's class, ssDNA and tRNA tumor-necrosis factor glycoproteins thymus nucleic acid, the fluorescence background that produces during with the reduction hybridization, working concentration when wherein CotDNA, ssDNA and tRNA precipitate is 1 mg/ml, and the system of precipitation is 300 microlitres.
Preferred version according to the present invention, gene probe concentration method are that ethanol (20 ℃) precipitation concentrates, and use the lysis hybridization buffer precipitation at last.
According to a preferred embodiment of the present invention, the component of hybridization buffer comprises 50% deionized formamide, the T 500 of 2 * SSC and 0.1 grams per milliliter.
Another object of the present invention has provided a kind of epithelial ovarian cancer fluorescence in situ hybridization detection test kit, comprises the said gene probe compositions.
Preferably, described test kit also comprises hybridization buffer.More preferably, described gene probe composition dissolves is in hybridization buffer, it is fluorescence labeling probe group hybridization mixed solution, more preferably, the concentration of described c-myc gene probe is: 4ng/ μ l, and the concentration of Rb1 gene probe is: 4ng/ μ l, the concentration of Chk2 gene probe is: 4ng/ μ l, the concentration of p53 gene probe is: 4ng/ μ l, the concentration of BRCA1 gene probe is: 4ng/ μ l.
More preferably, the component of described hybridization buffer comprises 50% deionized formamide, the T 500 of 2 * SSC and 0.1 grams per milliliter.
Preferably, described test kit comprises that also DAPI redyes liquid.
Preferably, described test kit also comprises 20X SSPE washings.
Preferably, described test kit also comprises the plastic packing box of packing reagent pipe.
The present invention also provides the application of mentioned reagent box in epithelial ovarian cancer fluorescence in situ hybridization detection, comprises the steps:
1), sample selection strategy:
The multiple sample type of ovarian cancer all can be used for FISH and detects, and comprises paraffin section, frozen section, organizes printingout, cell gets rid of sheet etc.
Can adopt frozen section, paraffin section sample for the patient that went to a doctor in the past.Under the situation that various samples can both obtain, then should first-selectedly use frozen section, next selects paraffin section for use.
In the new patient who goes to a doctor, in giving patients with surgical, should select to organize klatsch-preparation.The progressive stage ovarian cancer patients patient of the ascites positive carries out the FISH detection after whether performing the operation and can directly using the ascites tumour cell specimen to get rid of sheet.
2), sample disposal and film-making:
Cell gets rid of sheet
Get the ascites specimen centrifuge and obtain the ascites tumour cell.After the washing of PBS liquid, with the red corpuscle in the KCl hypotonic medium removal ascites cells of 0.075 mol, carry out cell and get rid of sheet, fixedly spend the night with the methanol solution room temperature, 2% formaldehyde fixed is stored in after 5 minutes in-20 ℃ 70% ethanol, gradient ethanol (70%, 85%, 2 * 100% ethanol) dehydration in, 3 minutes/gradient, dry the back and use diamond pen labeled cell position, FISH detects standby.
Organize printingout
Get the ovarian cancer specimens from pri, do and organize tangent plane, dip in dehematize liquid and excessive moisture, organizing the anticreep slide glass to do printingout, drying the back fixedly spends the night with the methanol solution room temperature, be stored in-20 ℃ 70% ethanol gradient ethanol (70%, 85% on the 2nd day after 5 minutes with 2% formaldehyde fixed, 2 * 100% ethanol) dehydration in, 3 minutes/gradient, dry the back and use diamond pen labeled cell position, FISH detects standby.
Frozen section
The thick frozen section of 5 μ m fixedly spends the night with the methanol solution room temperature, is stored in-20 ℃ 70% ethanol gradient ethanol (70% after 5 minutes with 2% formaldehyde fixed, 85%, 2 * 100% ethanol) dehydration in, 3 minutes/gradient, dry the back and use diamond pen labeled cell position, FISH detects standby.
Paraffin section
65 ℃ of roasting sheets of the thick paraffin section of 4 μ m 1 hour, dimethylbenzene dewaxing 15 minutes 3 times, aquation in gradient ethanol (100%, 85%, the 70%) ethanol after 100% ethanol is developed a film, 3 minutes/gradient, in room temperature 0.2M HCl 10 minutes, PBS developed a film, at 80 ℃ of 0.01M Citrate Buffer(pH6.0) water-bath 1 hour, develop a film twice with 2 * SSC, put into dH
2O5 minute, dry the back and use diamond pen labeled cell position, FISH detects standby.
3), hybridization: after the sample disposal that will detect is good, the fluorescence labeling probe group hybridization mixed solution that adds above-mentioned preparation, 2 microlitres/sheet, add that specification is 12 * 12mm common lid slide, avoid producing bubble, with mounting glue mounting, 37 ℃ of dryings 20 minutes, slide is put into hybridization instrument, 78 ℃ of sex change 5 minutes, 37 ℃ of hybridization are spent the night.
4), develop a film: after sample hybridization is spent the night, remove cover glass, put into 4 * nucleic acid hybridization damping fluid (Saline Sodium Phosphate EDTA, SSPE) in washed twice, dewater in the gradient ethanol, put into hexane: Virahol (60:40) mixed solution 10 minutes, put into Virahol again 5 minutes, put into 100% ethanol at last 5 minutes, dry, redye with DAPI, under fluorescent microscope, observe detected result.
5), IMAQ and analysis: under fluorescent microscope, use corresponding spectral filter to observe different fluorescent signals, signal is taken pictures and counted.
The beneficial effect that the present invention has:
1, the invention provides a kind of fluorescence in situ hybridization test kit that detects ovarian cancer, overcome the market vacancy.
2, fluorescence in situ hybridization method in the market can detect 1-2 gene usually simultaneously; And this test kit detects when can carry out 5 kinds of genes to same sample even the single tumour cell of ovarian cancer, has significantly improved detectivity and efficient.
3, this test kit can be used for the epithelial ovarian cancer is carried out the molecular pathology somatotype.
4, test kit of the present invention can be directly used in mid-term or interval the oophoroma tumor cell the fluorescent hybridization method detect, and need not cell cultures and the high-quality Metaphase Chromosome sheet of preparation, operation is simplified greatly.
5, test kit of the present invention also can be used for matter source ovarian tumor and sexual cell source between other kind ovarian tumors such as sex cords
Ovarian tumor, and the research of other malignant diseases of gynaecology and molecular pathology somatotype.
6, the test kit of the present invention FISH that can be used for the multiple Pathologic specimen type of ovarian cancer detects, and comprises that cell gets rid of sheet, organizes printingout, frozen section and pathological section.Enlarged the kind of the sample that can be used for detecting.And a kind of sample selection strategy and flaking method of the best are provided.
Description of drawings
Fig. 1 is hybridized probe and the normal people's peripheral blood mononuclear cell made for contain the BAC clone (table 1) of BRCA1 gene with plain PromoFluor-415-aadUTP (PF415) mark of blue-fluorescence, carries out the image that the fluorescent microscope microscopy obtains again.Present two fluorescein signaling points in the showed cell nuclear as a result, show that the BAC clone who contains the BRCA1 gene can be used for making the FISH probe that detects the BRCA1 gene.
Fig. 2 is that the present invention is with the c-myc probe of the plain mark of Green-c-myc(green fluorescence of success making), the Rb1 probe of the plain mark of PF555-Rb1(red fluorescence), the Chk2 probe of the plain mark of PF590-Chk2(fluorescent orange), the p53 probe of the plain mark of HyPer5-p53(purple fluorescence), the BRCA1 probe of the plain mark of PF415-BRCA1(blue-fluorescence) after 5 kinds of probes (table 2) mix normal people's peripheral blood mononuclear cell is hybridized, carry out the image that the fluorescent microscope microscopy obtains again.The result is presented in the same nucleus, and every kind of probe obtains two fluorescent signals clearly, and 5 kinds of probes obtain 10 corresponding fluorescent signal points, the clear picture of acquisition, signal to noise ratio height altogether.
Fig. 3 is the Green-c-myc that the present invention successfully prepares, PF555-Rb1, and PF590-Chk2, HyPer5-p53, PF415-BRCA1 gene detecting kit detect the image of acquisition to progressive stage epithelial ovarian cancer patient ascites tumour cell specimen.From the image that obtains, can find that the gene copy number changing conditions of progressive stage epithelial ovarian cancer patient ascites tumour cell has nothing in common with each other, as shown in table 4.
Fig. 4 is the Green-c-myc that the present invention successfully prepares, PF555-Rb1, and PF590-Chk2, HyPer5-p53, the PF415-BRCA1 gene detecting kit is by hanging down differentiation serous cystadenocarcinoma patient ascites tumour cell sorting CD133 to an example
+ALDH
+The ovarian cancer stem cell detects the image of acquisition, can find to have three subclones in the tumor stem cell of progressive stage epithelial ovarian from the image that obtains, and is as shown in table 5.
The 1.5% agarose gel electrophoresis figure of Fig. 5 for using polymerase chain reaction (PCR) that corresponding BAC probe is identified.HGD(human genomic DNA wherein): the human genome DNA is as positive control; PD(plasmid DNA): the BAC dna probe; URC (unrelated control): irrelevant BAC clone contrast.The gel electrophoresis result shows, in the BAC clone for detection of c-myc, Rb1, Chk2, p53 and BRCA1 gene, can amplify the dna fragmentation of corresponding gene respectively, and these dna fragmentation sizes and design are consistent, and irrelevant BAC clone contrast then presents the PCR feminine gender.
Embodiment
Following the invention will be further described by specific embodiment, but do not limit protection scope of the present invention.
The preparation method of embodiment 1:BRCA1 gene probe comprises the steps:
1. colony screening: the BRCA1 gene is positioned at people's long-armed 21.2-21.31 sections of No. 17 karyomit(e)s (17q21.2-q21.31), retrieval UCSC genome browser, NCBI Clone Registry, all contain the clone of BRCA1 gene Ensembl Genome Browser database, filter out the optimum clone who includes this gene, it is as shown in table 1 to be numbered RP11-831F13().
2. the clone cultivates and identifies: buy clone RP11-831F13(American I nvitrogen company), get 8 microlitres clone bacterium liquid and be added in 5 milliliters of LB liquid nutrient mediums that contain the paraxin resistance, 37 ℃ of jolting activation culture 12 hours; Then bacterium liquid all is added in 450 milliliters of LB liquid nutrient mediums that contain the paraxin resistance, 37 ℃ jolt to cultivate and collect bacterium liquid after 12 hours.Use upstream primer: TAGGGCTGGAAGCACAGAGT (SEQ ID NO:9), downstream primer:
AATTTCCTCCCCAATGTTCC (SEQ ID NO:10) carries out pcr amplification.The polymerase chain reaction amplification condition is: 95 ℃ of pre-sex change 5 minutes; (" 95 ℃ of sex change 1 minute; 60 ℃ of annealing 30 seconds, 72 ℃ of renaturation 30 seconds ") circulation 35 times; 72 ℃ of extensions 7 minutes.Amplified production is carried out the electrophoresis checking.
3. gene probe preparation:
(1) plasmid extraction kit of use Qiagen company, extraction and the purifying of BAC cloned plasmids carried out in requirement to specifications.With the ND-1000 ultramicrospectrophotometer plasmid DNA is carried out concentration and purity (260nm/280nm) mensuration.With the EcoR1 enzyme target DNA is carried out enzyme and cut, method is as follows:
Hatched 1 hour for 37 ℃, add the 0.5M of 1 microlitre ethylenediamine tetraacetic acid (EDTA) (Ethylene Diamine Tetraacetic Acid, EDTA) (PH7.5) termination reaction, mixing, instantaneous centrifugal.
(2) deposit D NA: the 3M sodium acetate that adds total amount of liquid 1/10 volume of step (1).
(3) add total 2 times of volume 100% ethanol of amount of liquid (20 ℃) of step (2) again, mixing, instantaneous centrifugal ,-70 ℃, precipitate about 2 hours.Centrifugal 14000rpm, 4 ℃, 20 minutes, abandon supernatant with careful suction of rifle point, add 100 microlitres, 70% ethanol (4 ℃), mixing, centrifugal 14000rpm, 4 ℃, 15 minutes.Abandon supernatant with careful suction of rifle point, drying precipitated 10 minutes, with the Tris-HCl(PH8.5 of the 10mM of 10 microlitres) concussion at least 5 hours continuously on vibrator of resuspended back, rotating speed 800rpm, DNA well is placed on 4 ℃ of preservations until ligation with dissolving.
(4) ligation:
The DNA that adopts nick-translation method that enzyme is cut carries out fluorescein-labelled, adopts PromoFluor-415-aadUTP fluorescein-labelled to the BRCA1 gene, the PF415-BRCA1(blueness) the probe mark method is as follows:
Get the EP pipe of lucifuge, add water earlier, add DNase I (10 nanograms/microlitre) and DNA polymerase I (10 units/microlitre, enzyme are placed on all the time ice chest or on ice) at last and press following reaction system liquid feeding:
Mixing, instantaneous centrifugal, 14 ℃ of overnight incubation (9-12 hour).EDTA (PH7.5) termination reaction that adds the 0.5M of 5 microlitres next day, mixing, instantaneous centrifugal, the DNA that connects is placed on-20 ℃ and keeps in Dark Place.
(5) deposit D NA:
According to following reaction system the good DNA of purpose mark is precipitated:
The sodium acetate that adds the 3M of 15 microlitres again, 100% ethanol of 630 microlitres (20 ℃) mixing, instantaneous centrifugal ,-20 ℃, precipitation is spent the night.Next day centrifugal 14000rpm, 4 ℃, 20 minutes.Abandon supernatant with careful suction of rifle point, add 70% ethanol (4 ℃) of 100 microlitres, mixing, centrifugal 14000rpm, 4 ℃, 15 minutes.Abandon supernatant, drying precipitated 10 minutes of room temperature lucifuge with careful suction of rifle point.The lysis hybridization buffer precipitation that contains 50% deionized formamide that adds 10 microlitres, on vibrator, shake at least 6 hours continuously with abundant dissolving probe, rotating speed 800rpm, dissolving probe is well put into 56 ℃ hatched 1 hour, the centrifugal 14000rpm of room temperature 20 minutes, is transferred to centrifugal good probe in the new lucifuge EP pipe, preserve in 4 ℃, if should be stored in-20 ℃ without probe for a long time.
4.PF415-BRCA1 gene probe checking:
(1) cell is prepared:
Adopt the method for density gradient centrifugation to extract normal people's peripheral blood mononuclear cell with Ficoll liquid, carry out cell after phosphoric acid buffer (PBS) washing and get rid of sheet, rotating speed 1000rpm, 3 minutes; Dry, put into the methyl alcohol room temperature and fixedly spend the night; Put into the formaldehyde solution room temperature of 1-2% next day and fix 5 minutes, put into 70% ethanol-20 ℃ preservation among the PBS after the washing; The sample that is kept in 70% the ethanol is taken out, put into dehydration in the gradient ethanol (70%, 85%, 2 * 100% ethanol), 3 minutes/gradient, dry after the dehydration, add the probe of making, 2 microlitres/sheet, add 12 * 12mm common lid slide, avoid producing bubble, with mounting glue mounting, 37 ℃ of dryings 20 minutes.
(2) hybridization:
Slide is put into hybridization instrument, 78 ℃ of sex change 5 minutes, 37 ℃ of hybridization are spent the night.
(3) washing:
The slice, thin piece that hybridization is spent the night is removed cover glass, be placed among 4 * SSPE of 47 ℃ washing 5 minutes, washing is 10 minutes among 4 * SSPE of 55 ℃; Dehydration (70%, 85%, 2 * 100% ethanol) in the gradient ethanol, 3 minutes/gradient; Put into hexane: Virahol (60:40) mixed solution 10 minutes, put into Virahol again 5 minutes, put into 100% ethanol at last 5 minutes; The air drying slice, thin piece adds the DAPI of 8 microlitres after about 10 minutes, add cover glass, avoids producing bubble, the nail varnish mounting.(4) IMAQ and analysis:
Adopt the Zeiss multicolor fluorescence microscope Axio Imager Z2 of company type, spectral filter adopts the Chroma DAPI of company (SP-100) and the PF-415 of Zeiss company (45) combination.At first under the DAPI spectral filter, select the visual field, the location, with the reorientation module records image capture position in the AxioVision Rel.4.8.2 software, use high resolution CCD (Charge-Coupled Device then, electric charge coupling original paper) camera under 63 times of oily mirrors respectively at DAPI(Emission:450-490nm) and PF-415(Emission:460-500nm) gather fluorescence information in two spectral filter paths, carry out stereoscanning 25-30 layer with imgae processing software Z-Stack acquisition module at the nucleus of each shooting, adopt depth of focus prolong module with the fluorescent hybridization signal compression of Multi Slice Mode on an image, thereby it is clear to obtain, stable, desirable image (as shown in Figure 1).
(5) result judges:
The fluorescence in situ hybridization result shows that in same normal people's peripheral blood mononuclear cell, the PF415-BRCA1 gene probe obtains two fluorescent signal points clearly.From the PF415-BRCA1(blueness that obtains) the image (Fig. 1) as can be seen, the fluorescent signal of this gene is stronger, clear picture, the signal to noise ratio height, method is reliable and stable.
Embodiment 2:c-myc, Rb1, Chk2, p53, BRCA1 gene probe preparation of compositions method comprise the steps
1. colony screening:
By retrieval UCSC genome browser, NCBI Clone Registry, databases such as Ensembl Genome Browser contain c-myc respectively, Rb1, Chk2, all clones of p53, BRCA1 gene.Filter out the optimum clone who includes this gene, numbering is followed successively by: RP11-440N18, RP11-305D15, RP11-73I4, RP11-1081A10, RP11-831F13.(as shown in table 2)
2. the clone cultivates and identifies: buy clone (American I nvitrogen company) according to clone's numbering, get 8 microlitres clone bacterium liquid and be added in 5 milliliters of LB liquid nutrient mediums that contain the paraxin resistance, 37 ℃ of jolting activation culture 12 hours; Then bacterium liquid all is added in 450 milliliters of LB liquid nutrient mediums that contain the paraxin resistance, 37 ℃ jolt to cultivate and collect bacterium liquid after 12 hours.Bacterium liquid to each gene probe correspondence carries out pcr amplification by primer, and amplified production is carried out the electrophoresis checking.As shown in Figure 5.The amplimer sequence is:
C-myc gene probe: upstream primer: TACTGCGACGAGGAGGAGAA (SEQ ID NO:1)
Downstream primer: CGAAGGGAGAAGGGTGTGAC (SEQ ID NO:2)
Rb1 gene probe: upstream primer: TGCAGTATGCTTCCACCAGG (SEQ ID NO:3)
Downstream primer: TGTTGGTGTTGGCAGACCTT (SEQ ID NO:4)
Chk2 gene probe: upstream primer: ATTTTGTCAGGGCCAACATACTG (SEQ ID NO:5)
Downstream primer: CCCATCGCCTCTTAGGTAAATTC (SEQ ID NO:6)
P53 gene probe: upstream primer: GAACAGCTTTGAGGTGCGTG (SEQ ID NO:7)
Downstream primer: CTTCTTTGGCTGGGGAGAGG (SEQ ID NO:8)
BRCA1 gene probe: upstream primer: TAGGGCTGGAAGCACAGAGT (SEQ ID NO:9)
Downstream primer: AATTTCCTCCCCAATGTTCC (SEQ ID NO:10).
Amplification condition is: 95 ℃ of pre-sex change 5 minutes; (" 95 ℃ of sex change 1 minute; 60 ℃ of annealing 30 seconds, 72 ℃ of renaturation 30 seconds ") circulation 35 times; 72 ℃ of extensions 7 minutes.
3. gene probe preparation:
(1) plasmid extraction kit of use Qiagen company, extraction and the purifying of BAC cloned plasmids carried out in requirement to specifications.With the ND-1000 ultramicrospectrophotometer plasmid DNA is carried out concentration and purity (260nm/280nm) mensuration.With the EcoR1 enzyme target DNA is carried out enzyme and cut, method is as follows:
Hatched 1 hour for 37 ℃, add EDTA (PH7.5) termination reaction of the 0.5M of 1 microlitre, mixing, instantaneous centrifugal.
(2) deposit D NA: the 3M sodium acetate that adds total amount of liquid 1/10 volume of step (1).
(3) add total 2 times of volume 100% ethanol of amount of liquid (20 ℃) of step (2) again, mixing, instantaneous centrifugal,-70 ℃, precipitate about 2 hours, centrifugal 14000rpm, 4 ℃, 20 minutes, abandon supernatant with careful suction of rifle point, add 100 microlitres, 70% ethanol (4 ℃), mixing, centrifugal 14000rpm, 4 ℃, 15 minutes.Abandon supernatant with careful suction of rifle point, drying precipitated 10 minutes, with the Tris-HCl(pH8.5 of the 10mM of 10 microlitres) concussion at least 5 hours continuously on vibrator of resuspended back, rotating speed 800rpm, DNA well is placed on 4 ℃ of preservations until ligation with dissolving.
(4) ligation:
Adopt nick-translation method to carry out fluorescein-labelled to the DNA that enzyme cuts, c-myc, Rb1, Chk2, p53, BRCA1 gene are adopted Green dUTP respectively, PromoFluor-555-aadUTP, PromoFluor-590-aadUTP, HyPer5dCTP, five kinds of fluoresceins of PromoFluor-415-aadUTP (table 3) mark, to the Green-c-myc(green), the PF555-Rb1(redness), PF590-Chk2(is orange), the HyPer5-p53(purple), the PF415-BRCA1(blueness) probe difference mark such as table 2, method is as follows:
Get the EP pipe of lucifuge, add water earlier, add DNase I (10 nanograms/microlitre) and DNA polymerase I (10 units/microlitre, enzyme are placed on all the time ice chest or on ice) at last and press following reaction system liquid feeding:
Mixing, instantaneous centrifugal, 14 ℃ of overnight incubation (9-12 hour) add EDTA (PH7.5) termination reaction of the 0.5M of 5 microlitres next day, mixing, instantaneous centrifugal, the DNA that connects is placed on-20 ℃ and keeps in Dark Place.
(5) deposit D NA:
According to following reaction system the good DNA of purpose mark is precipitated:
The sodium acetate that adds the 3M of 15 microlitres again, 100% ethanol of 630 microlitres (20 ℃) mixing, instantaneous centrifugal ,-20 ℃, precipitation is spent the night.Next day centrifugal 14000rpm, 4 ℃, 20 minutes.Abandon supernatant with careful suction of rifle point, add 70% ethanol (4 ℃) of 100 microlitres, mixing, centrifugal 14000rpm, 4 ℃, 15 minutes.Abandon supernatant, drying precipitated 10 minutes of room temperature lucifuge with careful suction of rifle point.The lysis hybridization buffer precipitation that contains 50% deionized formamide that adds 10 microlitres, on vibrator, shake at least 6 hours continuously with abundant dissolving probe compositions, rotating speed 800rpm, dissolving probe compositions is well put into 56 ℃ hatched 1 hour, the centrifugal 14000rpm of room temperature 20 minutes, is transferred to centrifugal good probe compositions in the new lucifuge EP pipe, preserve in 4 ℃, if should be stored in-20 ℃ without probe compositions for a long time.
4.Green-c-myc, PF555-Rb1, PF590-Chk2, HyPer5-p53, the checking of PF415-BRCA1 gene probe composition:
(1) cell is prepared:
Carry out density gradient centrifugation with Ficoll liquid and extract normal people's peripheral blood mononuclear cell, carry out cell after the PBS washing and get rid of sheet, cell gets rid of sheet, rotating speed 1000rpm, 3 minutes; Dry, put into the methyl alcohol room temperature and fixedly spend the night; Put into the formaldehyde solution room temperature of 1-2% next day and fix 5 minutes, put into 70% ethanol-20 ℃ preservation among the PBS after the washing; The sample that is kept in 70% the ethanol is taken out, put into dehydration in the gradient ethanol (70%, 85%, 2 * 100% ethanol), 3 minutes/gradient, dry after the dehydration, add the probe compositions of making, 2 microlitres/sheet, add 12 * 12mm common lid slide, avoid producing bubble, with mounting glue mounting, 37 ℃ of dryings 20 minutes.
(2) hybridization:
Slide is put into hybridization instrument, 78 ℃ of sex change 5 minutes, 37 ℃ of hybridization are spent the night.
(3) washing:
The slice, thin piece that hybridization is spent the night is removed cover glass, be placed among 4 * SSPE of 47 ℃ washing 5 minutes, washing is 10 minutes among 4 * SSPE of 55 ℃; Dehydration (70%, 85%, 2 * 100% ethanol) in the gradient ethanol, 3 minutes/gradient; Put into hexane: Virahol (60:40) mixed solution 10 minutes, put into Virahol again 5 minutes, put into 100% ethanol at last 5 minutes; The air drying slice, thin piece adds the DAPI of 8 microlitres after about 10 minutes, add cover glass, avoids producing bubble, the nail varnish mounting.
(4) IMAQ and analysis:
Adopt the Zeiss multicolor fluorescence microscope Axio Imager Z2 of company type, spectral filter adopts Chroma company to be respectively: DAPI (SP-100), Spectrum Green
TM(MF101), Cy3
TMV1 (SP-102), Texas Red (SP-107) and the Cy5(50 of Zeiss company), PF-415 (45) combination.At first under the DAPI spectral filter, select the visual field, the location, with the reorientation module records image capture position in the AxioVision Rel.4.8.2 software, use high resolution CCD (Charge-Coupled Device then, electric charge coupling original paper) camera under 63 times of oily mirrors respectively at DAPI(Emission:450-490nm), Spectrum Green
TM(Emission:512-542nm), Cy3
TMV1(Emission:559.5-574.5nm), Texas Red(Emission:619.5-642.5nm), Cy5(Emission:665-715nm), PF-415(Emission:460-500nm) gather fluorescence information in six spectral filter paths, carry out stereoscanning 25-30 layer with imgae processing software Z-Stack acquisition module at the nucleus of each shooting, adopt depth of focus prolong module with the fluorescent hybridization signal compression of Multi Slice Mode on an image, thereby it is clear, stable to obtain, desirable multicolor image.Take 3 zones and amount to 200 cells, record c-myc gene, Rb1 gene, Chk2 gene, the fluorescent signal number of p53 gene and BRCA1 gene.
(5) result judges:
The fluorescence in situ hybridization result shows that in the same nucleus, every kind of probe obtains two fluorescent signals clearly, and 5 kinds of probes obtain 10 corresponding fluorescent signal points altogether.From the Green-c-myc(green that obtains), the PF555-Rb1(redness), PF590-Chk2(is orange), the HyPer5-p53(purple), the PF415-BRCA1(blueness) in the multicolor image (Fig. 2) as can be seen, 5 heterogeneic fluorescent signals of Jian Ceing are all stronger simultaneously, clear picture, signal to noise ratio height.Method is reliable and stable.
Embodiment 3: a kind of epithelial ovarian cancer fluorescence in situ hybridization detection test kit (50 person-portion), composed as follows:
1) fluorescence labeling probe group hybridization mixed solution 100 microlitres; 1 pipe
2) DAPI redyes liquid 500 microlitres; 1 pipe
3) the 20XSSPE washings is 20 milliliters; 1 bottle
4) specification sheets is 1 part.
Wherein c-myc gene probe concentration is in the fluorescence labeling probe group hybridization mixed solution: 4ng/ μ l, Rb1 gene probe concentration is: 4ng/ μ l, Chk2 gene probe concentration is: 4ng/ μ l, p53 gene probe concentration is: 4ng/ μ l, BRCA1 gene probe concentration is: 4ng/ μ l.
Embodiment 4: the using method of epithelial ovarian cancer fluorescence in situ hybridization detection test kit
Collect clinical progress phase epithelial ovarian cancer patient ascites tumour cell specimen 58 examples, epithelial ovarian cancer fluorescence in situ hybridization detection test kit detects described in the use embodiment 3, and method is as follows:
1. sample disposal and film-making:
Get the ascites specimen centrifuge and obtain the ascites tumour cell.After the washing of PBS liquid, red corpuscle with in the KCl hypotonic medium removal ascites cells of 0.075 mol carries out cell and gets rid of sheet (800rpm, 5 minutes), fixedly spend the night with the methanol solution room temperature, 2% formaldehyde fixed is stored in after 5 minutes in-20 ℃ 70% ethanol, gradient ethanol (70%, 85%, 2 * 100% ethanol) dehydration in, 3 minutes/gradient, dry the back and use diamond pen labeled cell position, FISH detects standby.
2. hybridization:
After the sample disposal that will detect is good, add the fluorescence labeling probe group hybridization mixed solution in embodiment 3 test kits, 2 microlitres/sheet add that specification is 12 * 12mm common lid slide, avoid producing bubble, with mounting glue mounting, and 37 ℃ of dryings 20 minutes.Slide is put into hybridization instrument, 78 ℃ of sex change 5 minutes, 37 ℃ of hybridization are spent the night.
3. develop a film:
The slice, thin piece that hybridization is spent the night is removed cover glass, be placed among 4 * SSPE of 47 ℃ washing 5 minutes, washing is 10 minutes among 4 * SSPE of 55 ℃; Dehydration (70%, 85%, 2 * 100% ethanol) in the gradient ethanol, 3 minutes/gradient; Put into hexane: Virahol (60:40) mixed solution 10 minutes, put into Virahol again 5 minutes, put into 100% ethanol at last 5 minutes; The air drying slice, thin piece adds the DAPI of 10 microlitres after about 10 minutes, add cover glass, avoids producing bubble, the nail varnish mounting.
4. IMAQ and analysis:
Adopt the Zeiss multicolor fluorescence microscope Axio Imager Z2 of company type, spectral filter adopts Chroma company to be respectively: DAPI (SP-100), Spectrum Green
TM(MF101), Cy3
TMV1 (SP-102), Texas Red (SP-107) and the Cy5(50 of Zeiss company), PF-415 (45) combination.At first under the DAPI spectral filter, select the visual field, the location, with the reorientation module records image capture position in the AxioVision Rel.4.8.2 software, use high resolution CCD (Charge-Coupled Device then, electric charge coupling original paper) camera under 63 times of oily mirrors respectively at DAPI(Emission:450-490nm), Spectrum Green
TM(Emission:512-542nm), Cy3
TMV1(Emission:559.5-574.5nm), Texas Red(Emission:619.5-642.5nm), Cy5(Emission:665-715nm), PF-415(Emission:460-500nm) gather fluorescence information in six spectral filter paths, adjust focal length, different levels at nuclear find signaling point, the number of each probe in each cell observed in record, carry out 5 layers of stereoscannings with imgae processing software Z-Stack acquisition module at the nucleus of each shooting, adopt depth of focus prolong module with the fluorescent hybridization signal compression of Multi Slice Mode on an image, thereby it is clear to obtain, stable, desirable multicolor image.Take 10 zones for every and amount to several 200 tumour cells.Record c-myc gene, Rb1 gene, Chk2 gene, the fluorescent signal number of p53 gene and BRCA1 gene.
5. the result judges:
By record c-myc gene, Rb1 gene, Chk2 gene, the fluorescent signal number of p53 gene and BRCA1 gene.The gene copy number changing conditions of finding progressive stage epithelial ovarian cancer patient ascites tumour cell have nothing in common with each other (Fig. 3); Detect by the low differentiation of example serous cystadenocarcinoma patient ascites tumour cell sorting CD133+ALDH+ ovarian cancer stem cell, can find to exist in the ovarian cancer stem cell three subclones (Fig. 4).From the Green-c-myc(green that obtains), the PF555-Rb1(redness), PF590-Chk2(is orange), the HyPer5-p53(purple), PF415-BRCA1(blueness) in the multicolor image (Fig. 3,4) as can be seen, 5 heterogeneic fluorescent signals of Jian Ceing are all stronger simultaneously, clear picture, the signal to noise ratio height, method is reliable and stable.
Still do not have at present and can be applicable to the clinical FISH detection kit for the epithelial ovarian cancer, test kit of the present invention has been filled up this blank.Can realize kinds of tumor cells clone in the same sample is carried out the polygene comprehensive detection simultaneously by test kit of the present invention, can better must carry out the molecular pathology somatotype, understanding the clone constitutes, research and the process of following the tracks of genomic abnormality continuous accumulation in oophoroma tumor cell even tumor stem cell in disease generation and evolution, better judging prognosis, instruct personalized treatment, judge curative effect and the monitoring course of disease.
Table 1BRCA1 gene fragment mark
Table 2c-myc, Rb1, Chk2, p53 and BRCA1 gene detecting kit gene fragment mark
The fluorescein-labeled dUTP of table 3
Table 4 progressive stage epithelial ovarian cancer patient's ascites tumour cell subclone kind (3 kinds)
The low differentiation of table 5 routine ovary serous cystadenocarcinoma tumor stem cell subclone kind (3 kinds)
Above content is to further describing that the present invention does in conjunction with concrete preferred implementation, but content of the present invention is not limited in the above-described embodiment, knowledgeable people in the same area can propose other embodiment easily within technical director's thought of the present invention, but this embodiment comprises within the scope of the present invention.
Claims (10)
1. gene probe composition that detects the epithelial ovarian cancer, it is characterized in that: this gene probe composition comprises the c-myc gene probe, Rb1 gene probe, Chk2 gene probe, p53 gene probe and BRCA1 gene probe.
2. gene probe composition according to claim 1, it is characterized in that: described gene probe composition comprises:
C-myc gene probe: RP11-440N18 (UCSC genome browser);
Rb1 gene probe: RP11-305D15 (UCSC genome browser);
Chk2 gene probe: RP11-73I4 (UCSC genome browser);
P53 gene probe: RP11-1081A10 (UCSC genome browser);
BRCA1 gene probe: RP11-831F13 (UCSC genome browser).
3. gene probe composition according to claim 1 and 2, it is characterized in that: described c-myc gene probe, Rb1 gene probe, Chk2 gene probe, p53 gene probe and BRCA1 gene probe are through fluorescein-labeled probe.
4. each described gene probe preparation of compositions method of claim 1-3 is characterized in that: comprise the steps:
1), colony screening: retrieval UCSC genome browser, NCBI Clone Registry, Ensembl Genome Browser database contains all bacterial artificial chromosomes (BAC) clone of c-myc, Rb1, Chk2, p53, BRCA1 gene respectively, and these clones are screened, select best clone;
2), the clone cultivates and identifies: number according to the definite clone of screening and buy BAC clone (American I nvitrogen company), get 5-10 microlitre clone bacterium liquid and be added to the 3-5 milliliter and contain in the LB liquid nutrient medium of paraxin resistance, 37 ℃ of jolting activation culture 8-16 hour; Then bacterium liquid all is added in the LB liquid nutrient medium that the 400-500 milliliter contains the paraxin resistance, 37 ℃ jolt and cultivated 8-16 hour; BAC clone to c-myc, Rb1, Chk2, p53, BRCA1 carries out the polymerase chain reaction amplification with corresponding gene primer, with the agarose gel electrophoresis of 1-2% product is analyzed, thereby is finished clone's to be selected Molecular Identification;
3), the preparation of gene probe and evaluation: after obtaining the clone of goal gene, extract a large amount of DNA, the DNA that enzyme is cut after the method that adopts nick translation behind the DNA is cut enzyme carries out fluorescein-labelled, again to c-myc, Rb1, Chk2, precipitate after the combination of p53 and BRCA1 gene probe and concentrate, the probe compositions of making is dissolved in the hybridization buffer that contains 50% deionized formamide, namely get fluorescence labeling probe group hybridization mixed solution, adopt normal people's peripheral blood mononuclear cell to get rid of sheet and carry out the probe evaluation.
5. method according to claim 4 is characterized in that: contain the clone of c-myc gene optimum in the described colony screening step, be numbered RP11-440N18; Contain the clone of Rb1 gene optimum, be numbered RP11-305D15; Contain the clone of Chk2 gene optimum, be numbered RP11-73I4; Contain the clone of p53 gene optimum, be numbered RP11-1081A10; Contain the clone of BRCA1 gene optimum, be numbered RP11-831F13.
6. according to claim 4 or 5 described methods, it is characterized in that: the primer sequence that uses in clone's cultivation and the authentication step is:
C-myc gene probe: upstream primer: TACTGCGACGAGGAGGAGAA (SEQ ID NO:1)
Downstream primer: CGAAGGGAGAAGGGTGTGAC (SEQ ID NO:2)
Rb1 gene probe: upstream primer: TGCAGTATGCTTCCACCAGG (SEQ ID NO:3)
Downstream primer: TGTTGGTGTTGGCAGACCTT (SEQ ID NO:4)
Chk2 gene probe: upstream primer: ATTTTGTCAGGGCCAACATACTG (SEQ ID NO:5)
Downstream primer: CCCATCGCCTCTTAGGTAAATTC (SEQ ID NO:6)
P53 gene probe: upstream primer: GAACAGCTTTGAGGTGCGTG (SEQ ID NO:7)
Downstream primer: CTTCTTTGGCTGGGGAGAGG (SEQ ID NO:8)
BRCA1 gene probe: upstream primer: TAGGGCTGGAAGCACAGAGT (SEQ ID NO:9)
Downstream primer: AATTTCCTCCCCAATGTTCC (SEQ ID NO:10).
7. an epithelial ovarian cancer fluorescence in situ hybridization detection test kit is characterized in that: comprise each described gene probe composition of claim 1-3.
8. test kit according to claim 7, it is characterized in that: described test kit also comprises hybridization buffer.Preferably, described gene probe composition dissolves is in hybridization buffer, it is fluorescence labeling probe group hybridization mixed solution, more preferably, the concentration of c-myc gene probe is: 4ng/ μ l, and the concentration of Rb1 gene probe is: 4ng/ μ l, the concentration of Chk2 gene probe is: 4ng/ μ l, the concentration of p53 gene probe is: 4ng/ μ l, the concentration of BRCA1 gene probe is: 4ng/ μ l.
9. test kit according to claim 8, it is characterized in that: the component of described hybridization buffer comprises 50% deionized formamide, the T 500 of 2 * SSC and 0.1 grams per milliliter.
10. the application of each described test kit of claim 7-9 in epithelial ovarian cancer fluorescence in situ hybridization detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310155757.3A CN103276060B (en) | 2013-04-28 | 2013-04-28 | Gene probe composition and kit for detecting epithelial ovarian cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310155757.3A CN103276060B (en) | 2013-04-28 | 2013-04-28 | Gene probe composition and kit for detecting epithelial ovarian cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103276060A true CN103276060A (en) | 2013-09-04 |
| CN103276060B CN103276060B (en) | 2014-12-17 |
Family
ID=49058676
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310155757.3A Active CN103276060B (en) | 2013-04-28 | 2013-04-28 | Gene probe composition and kit for detecting epithelial ovarian cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103276060B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450899A (en) * | 2014-11-27 | 2015-03-25 | 武昌理工学院 | Preparation method of RBM5 FISH probe for lung cancer detection |
| CN105420396A (en) * | 2015-12-30 | 2016-03-23 | 广州安必平医药科技股份有限公司 | TERC gene and/or MYC gene detection probe, preparation method thereof and reagent kit |
| CN107419001A (en) * | 2016-05-23 | 2017-12-01 | 益善生物技术股份有限公司 | BRCA1, PTEN gene unconventionality detection kit and detection method |
| CN114292916A (en) * | 2021-12-30 | 2022-04-08 | 广州安必平医药科技股份有限公司 | FISH probe combination for three-gene joint detection and application thereof |
| CN114410779A (en) * | 2021-12-29 | 2022-04-29 | 苏州方科生物科技有限公司 | Probe pool for detecting ovarian cancer molecular typing and preparation, application and use methods thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994630A (en) * | 2012-09-24 | 2013-03-27 | 中山大学达安基因股份有限公司 | Ovarian clear cell carcinoma diagnostic kit and preparation method thereof |
-
2013
- 2013-04-28 CN CN201310155757.3A patent/CN103276060B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102994630A (en) * | 2012-09-24 | 2013-03-27 | 中山大学达安基因股份有限公司 | Ovarian clear cell carcinoma diagnostic kit and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| 吴月莲等: "荧光原位杂交技术在卵巢癌相关研究中的应用", 《中国医学文摘.计划生育妇产科学》 * |
| 黄宇婷等: "上皮性卵巢癌中c-myc基因扩增和Rb1基因缺失及临床意义", 《中国肿瘤临床》 * |
| 黄宇婷等: "定量多基因荧光原位杂交技术在卵巢癌研究中的初步探索", 《现代妇产科进展》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450899A (en) * | 2014-11-27 | 2015-03-25 | 武昌理工学院 | Preparation method of RBM5 FISH probe for lung cancer detection |
| CN105420396A (en) * | 2015-12-30 | 2016-03-23 | 广州安必平医药科技股份有限公司 | TERC gene and/or MYC gene detection probe, preparation method thereof and reagent kit |
| WO2017114005A1 (en) * | 2015-12-30 | 2017-07-06 | 广州安必平医药科技股份有限公司 | Terc gene and/or myc gene detection probe, preparation method therefor, and reagent kit |
| CN107419001A (en) * | 2016-05-23 | 2017-12-01 | 益善生物技术股份有限公司 | BRCA1, PTEN gene unconventionality detection kit and detection method |
| CN114410779A (en) * | 2021-12-29 | 2022-04-29 | 苏州方科生物科技有限公司 | Probe pool for detecting ovarian cancer molecular typing and preparation, application and use methods thereof |
| CN114410779B (en) * | 2021-12-29 | 2023-09-19 | 苏州方科生物科技有限公司 | Probe pool for detecting ovarian cancer molecular typing and preparation, application and using methods thereof |
| CN114292916A (en) * | 2021-12-30 | 2022-04-08 | 广州安必平医药科技股份有限公司 | FISH probe combination for three-gene joint detection and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103276060B (en) | 2014-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102978279B (en) | Gene probe composition and kit for acute lymphocytic leukemia detection | |
| Katabi et al. | Consistent PLAG1 and HMGA2 abnormalities distinguish carcinoma ex-pleomorphic adenoma from its de novo counterparts | |
| Pham-Ledard et al. | IRF4 gene rearrangements define a subgroup of CD30-positive cutaneous T-cell lymphoma: a study of 54 cases | |
| CN103276060B (en) | Gene probe composition and kit for detecting epithelial ovarian cancer | |
| JP2019531741A (en) | Group division and prognosis prediction system based on biological characteristics of gastric cancer | |
| CN102399772B (en) | Preparation method for probes related to breast cancer molecular markers and application of same | |
| Naus et al. | Characterization of complex chromosomal abnormalities in uveal melanoma by fluorescence in situ hybridization, spectral karyotyping, and comparative genomic hybridization | |
| Forus et al. | Dedifferentiation of a well-differentiated liposarcoma to a highly malignant metastatic osteosarcoma:: amplification of 12q14 at all stages and gain of 1q22–q24 associated with metastases | |
| JPH11513567A (en) | Amplification of chromosomal region 20q13 as a prognostic indicator in breast cancer | |
| CN102465172B (en) | Preparation method of non-small cell lung cancer molecular marker related probes and application thereof | |
| Bentz et al. | Rapid detection of the t (11; 14) translocation in mantle cell lymphoma by interphase fluorescence in situ hybridization on archival cytopathologic material | |
| CN103114128A (en) | Novel high-resolution quantitative multicolor fluorescent in-situ hybridization method and application thereof | |
| Schmidt-Wolf et al. | Chromosomal aberrations in 130 patients with multiple myeloma studied by interphase FISH: diagnostic and prognostic relevance | |
| CN109825587B (en) | Glioma prognostic marker CPVL and application thereof | |
| WO2017114007A1 (en) | Pml gene and rara gene detection probe, preparation method therefor, and test kit | |
| CN101899504B (en) | Reagent for detecting copy number of EGFR gene and ploidy of chromosome 7 | |
| CN105603087B (en) | Detect gene probe composition and kit that Huppert's disease clone evolves | |
| CN107858422A (en) | Detect the chromosome and gene probe composition and kit of RAEB | |
| CN109182519B (en) | It is a kind of for diagnosing the probe combinations and its application of ACTA2-MITF transposition blood vessel week epithelioid cell's tumour | |
| CN109793749A (en) | MiR-145-3p is preparing the application in Apoptosis and autophagy reinforcing agent | |
| Bandyopadhyay et al. | Development and gene expression profiling of a metastatic variant | |
| Hodge et al. | Molecular and cytogenetic characterization of plexiform leiomyomata provide further evidence for genetic heterogeneity underlying uterine fibroids | |
| WO2017114006A1 (en) | Aml1 gene and eto gene detection probe, preparation method therefor, and test kit | |
| CN103131757B (en) | Ovarian cancer individualized treatment detection reagent case and application thereof | |
| WO2017114010A1 (en) | Top2a gene detection probe, preparation method therefor, and test kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 300020 No. 288, Nanjing Road, Heping District, Tianjin Patentee after: Hematology Hospital of Chinese Academy of Medical Sciences (Institute of Hematology, Chinese Academy of Medical Sciences) Patentee after: Cancer Hospital Affiliated to Tianjin Medical University Address before: 300020 No. 288, Nanjing Road, Heping District, Tianjin Patentee before: Hematology Hospital of Chinese Academy of Medical Sciences (Institute of Hematology) Patentee before: Cancer Hospital Affiliated to Tianjin Medical University |