CN104450741A - Rice stress tolerance related gene OsSIDP336 as well as encoding protein and application thereof - Google Patents
Rice stress tolerance related gene OsSIDP336 as well as encoding protein and application thereof Download PDFInfo
- Publication number
- CN104450741A CN104450741A CN201410784056.0A CN201410784056A CN104450741A CN 104450741 A CN104450741 A CN 104450741A CN 201410784056 A CN201410784056 A CN 201410784056A CN 104450741 A CN104450741 A CN 104450741A
- Authority
- CN
- China
- Prior art keywords
- rice
- ossidp366
- gene
- paddy rice
- related gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rice stress tolerance related gene OsSIDP336 as well as encoding protein and application thereof and relates to rice genes. The nucleotide sequence of the rice stress tolerance related gene OsSIDP336 is shown in SEQ ID No: 1 in a sequence table. The amino acid sequence of the protein encoded by the rice stress tolerance related gene OsSIDP336 is shown in SEQ ID No: 2 in the sequence table. The rice stress tolerance related gene OsSIDP336 can be used for improving resistance of rice to salt stress and draught stress so as to cultivate salt-resistance and draught-resistance-enhanced rice. The salt-resistance and draught-resistance-enhanced rice can be prepared by the following steps: constructing an over-expression vector of the rice stress tolerance related gene OsSIDP336; converting the over-expression vector to rice; and screening to obtain the salt-resistance and draught-resistance-enhanced rice. The gene disclosed by the invention provides a theoretical basis for cultivating a salt-resistant and draught-resistant rice new variety.
Description
Technical field
The present invention relates to paddy gene, particularly relate to paddy rice anti contravariance related gene OsSIDP366 and proteins encoded thereof and application.
Background technology
Owing to living in physical environment, plant can face such as a series of abiotic stress such as arid, high salt, high temperature, low temperature in life, and these adverse circumstances have had a strong impact on growing of plant, and the procreation (Hirayama of offspring, T.and K.Shinozaki (2010). " Research on plant abiotic stress responses in the post-genome era:past, present and future. "
plant J61 (6): 1041-1052.).Paddy rice is monocotyledons model animals, simultaneously Ye Shi China and even global important food crop; The abiotic stress such as high salt, arid and low temperature have had a strong impact on growing of paddy rice, and cause the significantly underproduction of paddy rice.In recent years, along with the change of global climate, the continuous appearance of the problems such as the soil salinization more will propose new test (Wang to the plantation of paddy rice, W., et al. (2003). " Plant responses todrought, salinity and extreme temperatures:towards genetic engineering for stresstolerance. " Planta 218 (1): 1-14.).At present, find anti contravariance related gene, and utilize genetic engineering cultivate degeneration-resistant rice varieties become New Crop Varieties cultivate direction.
OsSIDP366 is the member of DUF1644 gene family, DUF1644 gene family comprises a DUF1644 structural domain, this structural domain is that nearly 160 amino acid, comprise the cysteine residues of 9 high conservatives at a conservative unknown function structural domain of plant camber.Still report is rarely had so far to the function of DUF1644 structural domain, Genevestigator Microarray database (https: //www.genevestigator.com) analysis shows, this family gene has the expression of different levels in the different tissues of paddy rice, and is subject to the multiple abiotic stress abduction deliverings such as arid, high salt, low temperature.Therefore the gene of paddy rice DUF1644 family may play vital role in abiotic stress responsing reaction.Li Min is to OsSIDP361 (LOC_Os01g42700), in the research of OsSIDP364 (LOC_Os02g05710), process LAN LOC_Os01g42700 gene makes degeneration-resistant associated transcription factor and LEA3 in paddy rice, the transcriptional level of the adversity genes such as Rab16 raises, and make the salt tolerant of paddy rice, drought-resistant ability improves, illustrate that DUF1644 gene plays the vital role (functional study of Li Min (2012) .DUF1644 family gene SIDP364 & SIDP361 in salt stress response in the reaction of paddy rice anti contravariance stress response, Xiamen University. Ph D dissertation).The function of OsSIDP366 gene discloses so far not yet, and the function of OsSIDP366 in raising paddy rice anti contravariance also has no report.Also contributing to understanding DUF1644 structural domain function to the further investigation of OsSIDP366 gene, and in paddy rice, participate in the molecular mechanism of degeneration-resistant responsing reaction and other biological process, providing theoretical foundation for cultivating resistance new variety.
Summary of the invention
The first object of the present invention is to provide paddy rice anti contravariance related gene OsSIDP366.
The second object of the present invention is the albumen providing paddy rice anti contravariance related gene OsSIDP366 to encode.
The third object of the present invention is to provide the application of paddy rice anti contravariance related gene OsSIDP366 in the paddy rice cultivating salt tolerant, drought resisting.
The nucleotide sequence of described paddy rice anti contravariance related gene OsSIDP366 is as shown in the SEQ ID No:1 in sequence table.
The aminoacid sequence of the albumen that described paddy rice anti contravariance related gene OsSIDP366 encodes is as shown in the SEQ ID No:2 in sequence table.
Described paddy rice anti contravariance related gene OsSIDP366 can be used for improving the resistance of paddy rice to salt stress and drought stress, cultivates salt tolerant, paddy rice that drought resistance strengthens.
The paddy rice that described cultivation salt tolerant, drought resistance strengthen can be adopted with the following method:
Build the Overexpression vector of paddy rice anti contravariance related gene OsSIDP366, and the paddy rice that by its rice transformation, screening obtains salt tolerant, drought resistance strengthens.
Described expression vector can be Ti class plasmid vector; Described method for transformation can adopt Agrobacterium_mediated method or Biolistic mediated transformation method etc., preferred agrobacterium mediation converted method.
Under salt stress and drought stress conditions, the relative plant height of the overexpression transfer-gen plant of the paddy rice anti contravariance related gene OsSIDP366 in the present invention is significantly higher than contrast, shows that the overexpression of this gene can improve the resistance of transgenic paddy rice to salt stress and drought stress.The present invention is salt tolerant, the cultivation of drought resisting new rice variety provides theoretical basis.
Accompanying drawing explanation
Fig. 1 is that the PCR of OsSIDP366 gene overexpression transgenic paddy rice in the embodiment of the present invention detects electrophorogram (amplification Hyg and 35s fragment).In Fig. 1, M is DL5000DNA marker, numbering 1 ~ 26 for transgenic rice plant DNA be template amplification, numbering wt is with wild rice plant DNA for template amplification, and numbering N is the negative control that water does template.According to Totomycin Hyg gene on final expression vector pH7WG2 and CaMV35s promoter sequence design primer, for the qualification of transfer-gen plant.
Fig. 2 is the relative expression levels of OsSIDP366 gene in OsSIDP366 gene overexpression transgenic paddy rice in the embodiment of the present invention.In Fig. 2, X-coordinate is different transgenic paddy rice strains, and wherein WT is wild rice, and OE2, OE17 are respectively T1 for OsSIDP366 gene overexpression transgenic paddy rice strain; Ordinate zou is the relative expression levels of OsSIDP366 gene, in column diagram, vertical line represents the standard error that 3 technology repeat, and " * * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has pole significant difference.
Fig. 3 be T1 for OsSIDP366 gene overexpression transfer-gen plant and wild rice plant relative plant height after 0mmol/L, 200mmol/L NaCl process 10d." * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has significant difference (P<0.05), and " * * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has pole significant difference (P<0.01).
Fig. 4 be T1 for OsSIDP366 gene overexpression transfer-gen plant and wild rice plant relative plant height after 0mmol/L, 150mmol/L Mannitol simulating drought process 10d." * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has significant difference (P<0.05), and " * * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has pole significant difference (P<0.01).
Fig. 5 is T1 for the rate-of-loss of coolant of OsSIDP366 gene overexpression transfer-gen plant and wild rice plant excised leaf.
Fig. 6 be T1 for OsSIDP366 gene overexpression transfer-gen plant and wild rice plant the relative water content in drought process.
Fig. 7 is T1 for OsSIDP366 gene overexpression transfer-gen plant and wild rice plant at 200mmol/L NaCl process and the 150mmol/L Mannitol simulating drought process 0h (H in X-coordinate
20), the relative expression quantity of stress-related genes SNAC1 (stress-responsive NAC transcription factor 1gene, NAC transcription factor 1 gene of stress response) in body after 24h." * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has significant difference (P<0.05), and " * * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has pole significant difference (P<0.01).
Fig. 8 is T1 for OsSIDP366 gene overexpression transfer-gen plant and wild rice plant at 200mmol/L NaCl process and the 150mmol/L Mannitol simulating drought process 0h (H in X-coordinate
20), the relative expression quantity of stress-related genes OsHAK5 (potassium transporter 5gene, paddy rice potassium translocator 5 gene) in body after 24h." * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has significant difference (P<0.05), and " * * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has pole significant difference (P<0.01).
Fig. 9 is T1 for OsSIDP366 gene overexpression transfer-gen plant and wild rice plant at 200mmol/L NaCl process and the 150mmol/L Mannitol simulating drought process 0h (H in X-coordinate
20), stress-related genes PBZ1 (probenazole-induced protein1, the relative expression quantity of probenazole inducible protein 1 gene in body after 24h." * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has significant difference (P<0.05), and " * * " represents that OsSIDP366 gene expression level between overexpression transgenic paddy rice strain and wild rice has pole significant difference (P<0.01).
Embodiment
The invention will be further described for following examples:
The acquisition of embodiment 1 paddy rice anti contravariance related gene OsSIDP366 and the structure of Overexpression vector
In paddy rice, identify a new DUF1644 gene family gene, this gene has played important effect in the degeneration-resistant response of paddy rice.According to OsSIDP366 gene cDNA nucleotide sequence row, synthetic primer OsSIDP366-F/OsSIDP366-R (SEQID No:3,4):
OsSIDP366-F：5’CACCATGGGGTCAGGAAAC3’
OsSIDP366-R：5’TTAACAGTAGACTGTTTCTACAG3’
In forward primer OsSIDP366-F, introduce the recognition site CACC of TOPO clone, facilitate the use TOPO cloning process by OsSIDP366 gene clone to pENTR/D-TOPO carrier.
With rice leaf cDNA for template, utilize above-mentioned primer to carry out pcr amplification, obtain the cDNA fragment of OsSIDP366 gene.
Pcr amplification condition is 95 DEG C of denaturation 5min, 95 DEG C of sex change 30s, 55 DEG C of return of goods 30s, and 72 DEG C extend 1min, 30 circulations; 72 DEG C extend 5min.
Reclaim object cDNA fragment, with reference to pENTR
tMdirectional
the operation instructions of Cloning Kits (purchased from Invitrogen, USA) test kit, is cloned into pENTR/D-TOPO carrier by object cDNA fragment, selects positive colony and checks order, the plasmid called after pENTR/OsSIDP366 that sequencing result is correct; Get pENTR/OsSIDP366 and Overexpression vector pH7WG2, with reference to Gateway LR clonase II Enzyme Mix (Invitrogen, USA) operation steps preparation reaction system, is connected to Overexpression vector by Gateway LR recombining reaction by the cDNA fragment of OsSIDP366 gene.PH7WG2 expression vector data see reference document (Karimi, M., et al. (2002). " GATEWAY vectors forAgrobacterium-mediated plant transformation. "
trends Plant Sci7 (5): 193-195.).
Bacterium colony PCR qualification is carried out, screening positive clone, the plasmid called after pH7WG2/OsSIDP366 checking order correct with OsSIDP366-F/OsSIDP366-R primer; Get 1 μ g pH7WG2 plasmid DNA transformation Agrobacterium EHA105; Bacterium colony PCR identifies Agrobacterium colonies, after positive colony enlarged culturing, adds final concentration 15% glycerine, be stored in-80 DEG C for subsequent use.
Embodiment 2 paddy rice stress-related genes OsSIDP366 gene overexpression vector paddy rice and PCR Testing and appraisal
Agrobacterium AAM nutrient solution is prepared: with the EHA105 Agrobacterium of 1: 1000 ratio inoculation containing pH7WG2/OsSIDP366 plasmid, 28 DEG C of shaking culture are spent the night, collected by centrifugation thalline, resuspended with AAM nutrient solution is 0.5 ~ 1 to OD600, adds the Syringylethanone of final concentration 50mg/L.
After ripe rice paddy seed is shelled, with 15% chlorine bleach liquor's surface sterilization 30min, sterile water wash 4 ~ 6 times; After aseptic filter paper dries, 26 DEG C of light culture 14 ~ 20d evoked callus on inducing culture NBD; After pinching bud, callus is transferred to succeeding transfer culture 10 ~ 14d on subculture medium NBD, select cadmium yellow and solid callus cultivates 1h in the AAM substratum of Agrobacterium, proceed to the lower 23 DEG C of Dual culture 3d of dark condition in Dual culture base NBD-AS after drying up, sterile water wash callus number is cultivated containing the enterprising row filter of antibiotic screening culture medium NBS all over being transferred to after (until scavenging solution is transparent in muddy); 2 ~ 3 take turns screening (each about 15d) afterwards dead callus grows faint yellow kanamycin-resistant callus tissue; Break up under kanamycin-resistant callus tissue being transferred to the upper 23 DEG C of illumination conditions of division culture medium RGH; When indefinite bud grows to 5 ~ 8cm, transfer them to root induction in root media MSR, the transgenic seedlings that root system has been grown is transplanted and is cultivated to field after water planting hardening.Wherein said AAM nutrient solution, NBD inducing culture, NBD-AS Dual culture substratum, NBS screening culture medium, RGH division culture medium, MSR prescription of rooting medium is with reference to (Hiei such as Hiei, Y., et al. (1994). " Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundariesof the T-DNA. " Plant J 6 (2): 271-282.) and (Lin such as Lin, Y.J.and Q.Zhang (2005). " Optimising the tissue culture conditions for high efficiency transformation ofindica rice. " Plant Cell Rep 23 (8): 540-547.) document.
Get the blade of above-mentioned transfer-gen plant respectively, extract genomic dna as template, carry out PCR detection (SEQ ID No:5 ~ 8) with Totomycin and 35s special primer:
Hyg-F：5’ACTGTGCCACCAAGCGTAAGG3’
Hyg-R：5’CGTTGAAGGAGCCACTGAGCC3’
35s-F：5’GAAGGGTCTTGCGAAGGATA 3’
35s-R：5’CGACGGAGAAGGTGACGATA3’
Due to primer Hyg-F/Hyg-F target hygromycin gene DNA, primer 35s-F/35s-R target cauliflower mosaic virus (CaMV) 35s promoter DNA, thus may be used for the detection of positive transgenic plant, and the detected result of WT lines is negative.After PCR Testing and appraisal is carried out to transfer-gen plant, agarose gel electrophoresis result shows, 1 ~ 26 transfer-gen plant detected result is positive, the Hyg gene fragment of 1338bp that can increase and the CaMV35s promoter fragment of 840bp, and the PCR detected result that WT lines genomic dna is template is negative, the object that cannot increase fragment (Fig. 1).
Embodiment 3T1 is for the OsSIDP366 gene expression dose in OsSIDP366 gene overexpression transfer-gen plant, and the Analysis of Resistance to salt stress, Drought stress simulation
Respectively for the OsSIDP366 gene expression dose of excessive transfer-gen plant strain and WT lines, quantitative analysis and salt stress, drought stress Resistance Identification are carried out to two T1.Get T1 for the seed of OsSIDP366 gene overexpression transfer-gen plant and wild type control, sow respectively in 1/2MS substratum, after two weeks, for the OsSIDP366 gene expression dose of OsSIDP366 transgenic line, quantitative analysis is carried out to WT lines and two T1, and identify the resistance of transfer-gen plant to salt stress, drought stress.
Concrete operation method is as follows:
Clip WT lines and OsSIDP366 gene overexpression rotaring gene plant blade respectively, extracts total serum IgE, then its reverse transcription is become cDNA.Respectively with these cDNA for template, respectively quantitative analysis is carried out to Actin gene and OsSIDP366 gene with gene specific primer Actin-qF/Actin-qR and OsSIDP366-qF/OsSIDP366-qR.Adopt 2
-Δ Δthe method of CT relative quantification (Livak, K.J.and T.D.Schmittgen (2001). " Analysis of relative geneexpression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. "
methods25 (4): 402-408.) goal gene relative expression quantity is analyzed.The repetition of 3, each sample, each experiment repetition more than 2 times.The reaction system of quantitative fluorescent PCR is:
premix Ex Taq
tMi I 5 μ L, Primer-F/R (10 μm of ol/L) each 0.4 μ L, ROX Reference Dye 0.2 μ L, cDNA template 1 μ L, ddH2O 3 μ L; Reaction conditions: 95 DEG C of 30s, 95 DEG C of 5s, 60 DEG C of 30s, 40 circulations, extend last 5s each circulation 60 DEG C and carry out fluorescent collecting.
Primer sequence following (SEQ ID No:9-12):
OsSIDP366-qF：5’GATGAAGAAGGTGGTGAG 3’
OsSIDP366-qR：5’ACAGCATTGTGAGGGTAA 3’
Actin-qF：5’CGGAGCGTGGTTACTCATTC 3’
Actin-qR：5’CCTCAGGGCAGCGGAAAC 3’
OsSIDP366 gene is analyzed at T1 for the relative expression levels in OsSIDP366 gene overexpression transfer-gen plant and WT lines by aforesaid method, result shows, and OsSIDP366 gene is about 89 times of wild-type and 29 times (Fig. 2) at two T1 respectively for the relative expression levels in OsSIDP366 gene overexpression transgenic line.
By wild-type and T1 for overexpression transfer-gen plant planting seed in the 1/2MS substratum containing 0mmol/L and 200mmol/L NaCl and 0mmol/L and 150mmol/L Mannitol N.F,USP MANNITOL, add up the relative plant height of plant after growth 12d, qualification transfer-gen plant is to the resistance of salt stress.Relative plant height utilizes SPSS software to be averaged the significance of difference analysis of value.Carry out statistical study to two transgenic lines with the relative plant height of WT lines, each strain at least measures 20 plant, and experiment is carried out 3 times and repeated.Result shows, and after 200mM NaCl process 10d, two T1 are for OsSIDP366 gene overexpression transfer-gen plant OE2, and the relative plant height of OE17 is respectively 26.9%, 28.3%, and the relative plant height of wild-type is 18.9% (Fig. 3).After N.F,USP MANNITOL simulating drought process 10d, two T1 are for OsSIDP366 gene overexpression transfer-gen plant OE2, and the relative plant height of OE17 is respectively 63.7%, 60.6%, and the relative plant height of wild-type is 42.7% (Fig. 4).Result shows, compared with WT lines, T1 significantly strengthens for the resistance of OsSIDP366 gene overexpression transfer-gen plant to salt stress and Drought stress simulation.
The drought resistance of embodiment 4OsSIDP366 overexpression transfer-gen plant and relative water content, percentage of water loss analysis
Transgenic seed is germinateed in physical environment, waits that growing to 3 leaf after dates enters in keg by seedling kind, second half plantation Wild type control plants of half plantation transfer-gen plant in each keg.Plant grew to for 4 leaf phases under normal growing conditions, and the drought stress 10-15d that carries out cutting off the water supply rolls up entirely to blade, then rehydration 7d, and take pictures and add up the surviving rate of plant, experiment is carried out 3 times and repeated.
Rate-of-loss of coolant (Water loss rate) and the computing reference Xiang etc. of relative water content (RWC) carry out (Xiang with the method for Mao etc., Y., et al. (2008). " Characterization of OsbZIP23as a key player of thebasic leucine zipper transcription factor family for conferring abscisic acidsensitivity and salinity and drought tolerance in rice. "
plant Physiol148 (4): 1938-1952., Mao, X., et al. (2010). " TaSnRK2.4; an SNF1-type serine/threonine proteinkinase of wheat (Triticum aestivum L.); confers enhanced multistress tolerance inArabidopsis. " J Exp Bot 61 (3): 683-696.), experiment is carried out 3 times and is repeated.
Rate-of-loss of coolant: the rice leaf that clip 3 ~ 64 leaf phases launch completely, is placed in the natural dehydration of metastable environment, and first time weighs and was designated as 0 moment, and every 1h surveys a fresh weight, until considerable change (about needing 6 ~ 8h) no longer occurs fresh weight later.0 moment fresh weight deducts each time point fresh weight and is each time point fluid loss, then is each some percentage of water loss divided by 0 moment fresh weight.
Relative water content: the rapidly rice leaf that launches completely of clip 3 ~ 64 leaf phases, uses electronic balance weighing fresh weight, is recorded as m1.Blade is put in 50ml centrifuge tube, after the 2h that is soaked in water, surface-moisture is dried, weigh rapidly, be recorded as m2.Blade being placed in 65 DEG C of loft drier is dried to without loss of water (about 8 ~ 10h), weighs dry weight record m3.Calculation formula:
Leaf r elative water content (%)=(m1-m3)/(m2-m3) × 100%
After result display rehydration, wild type control survival rate only has an appointment 45%, and the survival rate of process LAN transfer-gen plant is to more than 85%.The rate-of-loss of coolant of process LAN transfer-gen plant excised leaf is significantly slower than contrast (Fig. 5).Relative water content is determined at following point in time sampling DR0d (non-leaf roll), DR3d (the micro-volume of blade), DR7d (blade is rolled up entirely), DR10d (serious leaf roll); Result shows that the relative water content that process LAN transfer-gen plant is put at one time under drought stress state is significantly higher than wild type control (Fig. 6).
Embodiment 5OsSIDP366 overexpression is on the impact of abiotic stress related gene expression level
Distinguish the blade of the WT lines after clip regular culture conditions and 200mM NaCl and 150mmol/L Mannitol treatment with mannitol 24h and OsSIDP366 gene overexpression transfer-gen plant, extract total serum IgE, reverse transcription to become after cDNA as template, carries out quantitative analysis with stress-related genes special primer to stress-related genes in sample.During analyzing gene expression level, with Actin gene for reference gene, analyze the relative expression levels in stress-related genes wild-type under various circumstances and transfer-gen plant by relative expression quantity method of calculation (as described in Example 3).In the quantitative analysis of genetic expression, each gene at least repeats 2 fluorescent quantitative PCR experiments, and each Setup Experiments 3 technology repeat.
Stress-related genes is analyzed at T1 for the relative expression levels in OsSIDP366 gene overexpression transfer-gen plant and WT lines by aforesaid method, result shows, under normal operation or under stress conditions, stress-related genes SNAC1, OsHAK5, PBZ1 all has up-regulated expression (see Fig. 7-9) in various degree at two T1 for the relative expression levels in OsSIDP366 gene overexpression transgenic line, illustrates that OsSIDP366 gene strengthens the resistance of transfer-gen plant to salt stress and drought stress by the expression level raising stress-related genes.
The primer sequence is (SEQ ID No:13-18):
SNAC1-qF：GCCAAGAAGGGATCTCTCAGGTTG
SNAC1-qR：TCTTCTTGTTGTACAGCCGACAC
OsHAK5-qF：CATTGTGGACTATTTTGAAAGAA
OsHAK5-qR：GGAGAACTACAGAAAAGCCAATC
PBZ1-qF：ACGCCGCAAGTCATGTCCTAAAG
PBZ1-qR：TCGAGTGTGACTTGAGCTTCCC
Paddy rice stress-related genes of the present invention can be used for improving the resistance of paddy rice to salt stress and drought stress, cultivates the paddy rice that high salt and drought resistance strengthen.The relative plant height of overexpression transfer-gen plant strain T1 generation under 200mmol/LNaCl hypersaline environment and 150mmol/L mannitol N.F,USP MANNITOL simulating drought environment of paddy rice stress-related genes OsSIDP366 is all significantly higher than wild type control, and the rate-of-loss of coolant of process LAN transfer-gen plant is lower than wild type control, and the relative water content in drought process is higher than wild type control.Show that the transfer-gen plant of this gene of overexpression can significantly improve the resistance of paddy rice to high salt and drought environment.This gene is for cultivating high salt, and the paddy rice that drought resistance strengthens provides important channel.The cultivation of high salt, drought resistance paddy rice, the increase of grain yield is significant.
Claims (7)
1. paddy rice anti contravariance related gene OsSIDP366, is characterized in that its nucleotide sequence is as shown in the SEQ ID No:1 in sequence table.
2. the albumen of paddy rice anti contravariance related gene OsSIDP366 coding, is characterized in that its aminoacid sequence is as shown in the SEQ ID No:2 in sequence table.
3. paddy rice anti contravariance related gene OsSIDP366 is improving the resistance of paddy rice to salt stress and drought stress as claimed in claim 1, cultivates salt tolerant, applies in paddy rice that drought resistance strengthens.
4. apply as claimed in claim 3, it is characterized in that the paddy rice that described cultivation salt tolerant, drought resistance strengthen is adopted with the following method:
Build the Overexpression vector of paddy rice anti contravariance related gene OsSIDP366, and the paddy rice that by its rice transformation, screening obtains salt tolerant, drought resistance strengthens.
5. apply as claimed in claim 4, it is characterized in that described expression vector is Ti class plasmid vector.
6. apply as claimed in claim 4, it is characterized in that the method for described conversion adopts Agrobacterium_mediated method or Biolistic mediated transformation method.
7. apply as claimed in claim 6, it is characterized in that the method for described conversion adopts agrobacterium mediation converted method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410784056.0A CN104450741A (en) | 2014-12-16 | 2014-12-16 | Rice stress tolerance related gene OsSIDP336 as well as encoding protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410784056.0A CN104450741A (en) | 2014-12-16 | 2014-12-16 | Rice stress tolerance related gene OsSIDP336 as well as encoding protein and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104450741A true CN104450741A (en) | 2015-03-25 |
Family
ID=52897492
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410784056.0A Pending CN104450741A (en) | 2014-12-16 | 2014-12-16 | Rice stress tolerance related gene OsSIDP336 as well as encoding protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450741A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754959A (en) * | 2016-12-13 | 2017-05-31 | 江苏省中国科学院植物研究所 | One new plant salt tolerance gene ZmDUF1644 and its expression vector and application |
-
2014
- 2014-12-16 CN CN201410784056.0A patent/CN104450741A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| NCBI: "GenBank：AK072507.1", 《NCBI》 * |
| 李敏 等: "DUF1644家族基因SIDP364&SIDP361在盐胁迫应答中的功能研究", 《全国园艺植物生长繁殖技术及应用研讨会论文集》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754959A (en) * | 2016-12-13 | 2017-05-31 | 江苏省中国科学院植物研究所 | One new plant salt tolerance gene ZmDUF1644 and its expression vector and application |
| CN106754959B (en) * | 2016-12-13 | 2020-04-07 | 江苏省中国科学院植物研究所 | Novel plant salt-tolerant gene ZmDUF1644 and expression vector and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20090158466A1 (en) | Plants having increased tolerance to heat stress | |
| CN110699361B (en) | Rice salt stress resistance related gene Os16 and encoding protein and application thereof | |
| CN102766618B (en) | Rice OsICL protein and coding gene thereof, and application of the two | |
| CN108368515A (en) | Drought tolerant corn | |
| CN110408650A (en) | Application of the protein of NOR-like1 gene and its coding in regulation tamato fruit yield | |
| CN101096681A (en) | Improving salt tolerance capacity by employing rice protein kinase gene OsCIPK15 | |
| CN109797157A (en) | A kind of resisting abiotic adverse circumstance transcription factor PbrbHLH92 and its primer, the albumen of coding and application | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN102399268B (en) | Plant stress tolerance-related transcription factor GmNAC11, coding gene and application thereof | |
| CN103951740B (en) | Bermuda grass CCAAT transcription factor CdtNF-YC1 as well as coding gene and application thereof | |
| Li et al. | Gene cloning and expression of the pyrroline-5-carboxylate reductase gene of perennial ryegrass (Lolium perenne) | |
| CN102899333B (en) | Rice salt stress related gene SIDP364 and coding protein and application thereof | |
| Li et al. | Analysis of physiological characteristics of abscisic acid sensitivity and salt resistance in Arabidopsis ANAC mutants (ANAC019, ANAC072 and ANAC055) | |
| CN102449154B (en) | Methods and compositions for stress tolerance in plants | |
| CN103602644A (en) | Vacuole proton pyrophosphatase as well as encoding gene and application thereof | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN108864264B (en) | Corn OXS2a gene, and encoding protein and application thereof | |
| CN104450741A (en) | Rice stress tolerance related gene OsSIDP336 as well as encoding protein and application thereof | |
| CN107326030A (en) | A kind of WRKY transcription factors of low potassium tolerance of regulation and control and its application | |
| CN103468711B (en) | Pongamia pinnata stress tolerance relative gene MpZFP as well as coded protein and application thereof | |
| CN112608938A (en) | Application of OsAO2 gene in controlling drought resistance of rice | |
| CN112501181A (en) | Rice stress resistance related gene OsTZF7 and encoding protein and application thereof | |
| CN105254730A (en) | Protein capable of improving salt tolerance and drought tolerance of plants as well as coding gene and application of protein | |
| CN110407922A (en) | Rice cold tolerance gene qSCT1 and its application | |
| CN110373425A (en) | Application of the protein of NOR-like1 gene and its coding after regulation tamato fruit is adopted in dehydration |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150325 |