CN104450722B - Sequence and application of aptamer of escherichia coli outer membrane protein (OMP) TolC - Google Patents
Sequence and application of aptamer of escherichia coli outer membrane protein (OMP) TolC Download PDFInfo
- Publication number
- CN104450722B CN104450722B CN201410767405.8A CN201410767405A CN104450722B CN 104450722 B CN104450722 B CN 104450722B CN 201410767405 A CN201410767405 A CN 201410767405A CN 104450722 B CN104450722 B CN 104450722B
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- tolc
- sequence
- seq
- outer membrane
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a sequence and application of an aptamer of an escherichia coli outer membrane protein (OMP) TolC. The escherichia coli surface protein TolC is expressed by adopting gene recombinant plasmids, an aptamer group specially bound with the escherichia coli surface protein TolC is screened through an SELEX (systematic evolution of ligands by exponential enrichment) process, and a base sequence of the aptamer group is subjected to sequencing analysis. The sequence can serve as a probe specially bound with the escherichia coli surface protein TolC and can be used for designing and preparing markers for rapidly detecting escherichia coli, efflux pump inhibitors of escherichia coli, and the like.
Description
The present invention is 2 months 2013 Application No.s 201310062950.2 filed in 28 days, entitled " large intestine bars
The divisional application of the sequence and purposes of bacterial outer membrane protein TolC aptamers ".
Technical field
The invention belongs to molecular biology and medical microbial technical field, are related to escherichia coli outer membrane protein TolC nucleic acid
The sequence and purposes of aptamers.
Background technology
Escherichia coli (Escherichia coli) are the representative bacterium of Escherichia, be constitute human intestine in it is normal
One of flora, is important conditioned pathogen again, easily invades parenteral tissue and organ by various ways and approach, makes
Into various severe infections.With the wide clinical application of antibacterials, induction of the generation of a large amount of Pseudomonas Resistant strains, and shape
Into the bacterium to single antibiotic resistance to various antibacterials simultaneously drug resistance, by low resistant rate to high resistant rate
Exhibition, brings great difficulty to clinical treatment, causes higher case fatality rate.At present both at home and abroad to colibacillary drug resistance machine
Reason expands in-depth study.Research shows that Active efflux-pump is the important mechanisms of bacillus coli multiple drug resistance.Outside escherichia coli
Row's pump includes：Five class of RND, MFS, ABC, SMR, MATE, wherein former three must constitute transhipment altogether with outer membrane protein (OMP) TolC
Consubstantiality, can just complete the outer row to multi-medicament, it can be seen that TolC is the important composition composition for constituting escherichia coli efflux pump.
TolC is the duct albumen on adventitia, and upper end is open architecture, to provide the broad passage for pumping out to outer row's substrate；Under
Hold as enclosed construction.The change of three complex conformation of efflux pump, can make duct periodically open or closed.The change of TolC structures
The disintegration for weakening even three complex of their triple interactions can be caused.In the research with regard to escherichia coli outer membrane protein
In report, many results have pointed out TolC albumen to play vital effect in colibacillary multidrug resistant mechanism.But
Suppress drug resistance currently without reporting by changing the protein structure.
The research of aptamers (Aptamers) is new hot fields, it be can with many target molecules (albumen,
Medicine, inorganic or organic molecule) there is high affinity and the class single-chain nucleic acid (DNA or RNA) for specifically binding.So far send out
The method of existing high affine specificity aptamers is that part index concentration system launches (systematic evolution of
Ligands by exponential enrichment, SELEX).The high specific combined with ligand molecular due to aptamers with
And high-affinity, it is widely used in the aspects such as detection and drug research in medical research.Yuan etc. (Yuan L, et al,
Anal Chem, 2007,79 (3)：1082) protein chip is set up using Plasmon Surface Resonance imaging with aptamer technology,
Detect protein antibodies thrombin, VEGF (VEGF) complex adsorbed on the protein chip.(the Cao such as Cao
X, et al, Nucleic Acids Res, 2009,37 (14)：4621-8) using filtering out for staphylococcus aureuses
Aptamer is detecting staphylococcus aureuses.
Current major part both at home and abroad is engaged in the scientist of aptamer research and biotech company mainly by aptamers
Apply to viral infection, cancer, autoimmune disease, the clinical treatment of vascular conditions, and become ideal clinical treatment
New tool.Its therapy mechanism mainly by be folded into certain three dimensional structure directly with pathology related protein specificity
With reference to suppressing the activity of these protein, to reach therapeutic purposes.Feng H etc. (Feng H, et al, PLoS One, 2011,
6(11)：E27862) filtered out and can have been combined with hepatitis B viruss high-affinity, the adaptation that viral interference P- ε complex is formed
Body.But there is no the aptamers of directed toward bacteria outer membrane protein to report or disclose so far, therefore be necessary that exploitation one kind can specificity in fact
With reference to the aptamer of escherichia coli outer membrane protein TolC.
The content of the invention
The present invention intends considering to be applied to change TolC protein structures effectively to block row outside escherichia coli by aptamer
Activity is arranged outside pump.Exploitation can specifically bind the aptamer of escherichia coli outer membrane protein TolC, be to suppress escherichia coli many
Weight drug resistance is provided and is provided powerful support for, with important clinical value.
It is an object of the invention to provide it is a kind of can specific bond escherichia coli outer membrane protein TolC aptamer.This is fitted
Part has following sequence：SEQ ID NO：1、SEQ ID NO：2、SEQ ID NO：3、SEQ ID NO：4、SEQ ID NO：5、
SEQ ID NO：6、SEQ ID NO：7、SEQ ID NO：8、SEQ ID NO：9、SEQ ID NO：10、SEQ ID NO：11、SEQ
ID NO：12、SEQ ID NO：13、SEQ ID NO：14、SEQ ID NO：15、SEQ ID NO：16、SEQ ID NO：17、SEQ
ID NO：18、SEQ ID NO：19 or SEQ ID NO：20.
Specifically, the SEQ ID NO：1 is：5’-TGCGTGTTTACGTGTCGATGTCCGGGTACCCTCGG-3’；
The SEQ ID NO：2 are：5’-CTCTTAGCCATTTTGGTATGCGTATTGCTCTACAG-3’；
The SEQ ID NO：3 are：5’-ATATATTGCTCTGATCGTACTCTTATTAGGTTAGT-3’；
The SEQ ID NO：4 are：5’-ATGACGCTGTGGTATTACGTCCTCCTGTATTTGCC-3’；
The SEQ ID NO：5 are：5’-TCTAAGTGGAATCTACCACCAACGTATTTTTCCTC-3’；
The SEQ ID NO：6 are：5’-TCCGCCTATTCGGGAGGGAATATTGCTGATTTGTA-3’；
The SEQ ID NO：7 are：5’-CTCTTCAGTTTTAGACAATGCACGTTTCAGCGGTG-3’；
The SEQ ID NO：8 are：5’-TCCAGGCTATAATTTCTTGGAACTCCCTCCGTTAG-3’；
The SEQ ID NO：9 are：5’-CTTTCGAAGGGACTTTAACGGGTATATCCGGTTTT-3’；
The SEQ ID NO：10 are：5’-ATTACATGCTCTGAGCTTTTTGTATGAGAAATGAT-3’；
The SEQ ID NO：11 are：5’-CGCTTAGCTTGTGATTTCATCTTTCACACAAGAAT-3’；
The SEQ ID NO：12 are：5’-CGGAGATCTGTTACACTTCGGTACGTCTTAGTTTG-3’；
The SEQ ID NO：13 are：5’-CTACCATGTTCAGTGGTTTTGGGATTTTCATACAT-3’；
The SEQ ID NO：14 are：5’-TGAGATCGGTGAGTTAGTATCTTTTATTCAGTTTT-3’；
The SEQ ID NO：15 are：5’-GCATTGCGTGACATGGCCTTGCTATCCCTGTTCGT-3’；
The SEQ ID NO：16 are：5’-TCCTAAAAGCTAGTTATAGTAAATTGAAAACTTAG-3’；
The SEQ ID NO：17 are：5’-TGGAGCTTAGATTTTGAAGCAGTTACATTTCCCGA-3’；
The SEQ ID NO：18 are：5’-TACTGCGAGCTTCATTTTTACTTGGTAGTGTTGTG-3’；
The SEQ ID NO：19 are：5’-CGAACGAATATAATTATGGCGTCCCCGGGGTTTCG-3’；
The SEQ ID NO：20 are：5’-CTAGTTATGACATTTGTGTCATTTATCCCACGCTG-3’
The escherichia coli outer membrane protein TolC nucleic acid aptamer sequences of the present invention, are obtained by following methods：
Using the external SELEX triage techniqueses of aptamer, with escherichia coli outer membrane protein TolC as Screening target, from
Random oligo DNA library (the 5 '-GGGAGCTCAGAATAAACGCTCAA-N35- of external synthesis
TTCGACATGAGGCCCGGATC-3 ') in filter out aptamer with TolC albumen specific bond.
Preferably, the escherichia coli outer membrane protein TolC adopts purification with the following method and obtains：
Using molecule clone technology, special primer, institute are designed according to the genome sequence of escherichia coli outer membrane protein TolC
The forward primer Pa for stating special primer is 5 '-CGGGATCCATGAAGAAATTGCTCCCCATTCTT 3 ', and primer Pb is downstream
5 ' CCGCTCGAGGTTACGGAAAGGGTTATGACCGTT 3 ', with full-length cDNA as template, PCR amplifications obtain genes of interest
Jing Bam H I and Xho I double digestions, it is same to process PET-30a plasmids, then be obtained containing TolC genes with the connection of T4 ligases
Recombiant plasmid；Recombinant plasmid transformed competence colibacillus cell BL21, chooses monoclonal from the flat board of conversion and cultivates in fluid medium,
IPTG abduction deliverings, Jing solid-liquid separation take precipitation Tris-HCl solution and dispel, Ultrasonic Pulverization, then electrophoresis；Column chromatography for separation
Protein purification.
In a specific embodiment, the preparation side of the escherichia coli outer membrane protein TolC nucleic acid aptamer sequences of the present invention
Method is：
Using molecule clone technology, special primer is designed according to the genome sequence of escherichia coli outer membrane protein TolC,
In one specific embodiment, the special primer is forward primer Pa, downstream primer Pb, with full-length cDNA as template, PCR amplifications.
Genes of interest Jing Bam H I and Xho I double digestions are obtained, it is same to process PET-30a plasmids, then contained with the connection of T4 ligases is prepared
There is the recombiant plasmid of TolC genes.
Recombinant plasmid transformed competence colibacillus cell BL21, chooses monoclonal in 1.5ml LB fluid mediums from the flat board of conversion
Culture, IPTG (0.5mM) abduction delivering take the bacterium solution of 1ml inductions, and 12000rpm is centrifuged 1min, abandons supernatant, and precipitation uses 50-
100 μ l 10mM Tris-HCl (pH8.0) solution are dispelled (amount of addition buffer is depending on biomass), Ultrasonic Pulverization (500W,
30 times, each 10s is spaced 15s).50 μ l2 × loading buffer are added, 100 DEG C are boiled 5min, electrophoresis.
Cross nickel post protein purification, collect protein peak, electrophoresis detection protein purification effect respectively (purification result is shown in Fig. 2).
Followed by the SELEX in-vitro screening technologies of aptamers, to collect TolC after purification as Screening target, from external
Random oligo DNA library (the 5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 ') of synthesis
In filter out aptamer with TolC albumen specific bond, by the sequence for screening primer P1 (5 '
GGGAGCTCAGAATAAACGCTCAA-3 ') and primer P2 (5 '-GATCCGGGCCTCATGTCGAA-3 ') expanded.By PCR
Amplified production takes 1 μ l after purification, is connected with carrier PGM-T, then it is thin to be transformed into competence in the presence of T4DNA ligases
Born of the same parents, take proper volume be spread evenly across containing IPTG, x-gal, antibiotic (Amp) LA flat boards, after 12～16 hours with inoculation
Single white colony in ring picking screening flat board is in the LB fluid mediums containing Amp, 37 DEG C of overnight incubations.Take bacterium solution lml in
In centrifuge tube, Hai Sheng works Bioisystech Co., Ltd (hereinafter referred to as Shanghai life work) sequencing after sealer, is served.
Sequence of the sequence selected from naturally occurring or synthetic, or the same sequence in any other source.
The present invention further provides the purposes of the nucleic acid aptamer sequence, for example the sequence is in medicine or product is prepared
Application.In a specific embodiment, the present invention provides the sequence answering in escherichia coli efflux pump inhibitor is prepared
With.
Another object of the present invention is to provide the nucleic acid aptamer sequence prepare detection TolC albumen probe or
Application in target spot.
The present invention also provides application of the aptamers in escherichia coli efflux pump inhibitor is prepared.
The present invention also provides application of the aptamers in the probe or target spot for preparing detection TolC albumen.
Another object of the present invention is to provide row's activity or reduction escherichia coli outside a kind of suppression escherichia coli efflux pump
The method arranged outside efflux pump, including the aptamers given described in effective dose.
In the present invention, the aptamers that described nucleotide sequence is constituted can be tied with escherichia coli outer membrane protein TolC specificitys
Close, can be used for the design and preparation of efflux pump inhibitor medicine.The aptamers that described nucleotide sequence is constituted can also be used as inspection
Survey the probe or target spot of TolC albumen.Nucleic acid aptamer sequence provided by the present invention and the escherichia coli adventitia egg as target
White TolC has very strong affinity, thus the sequence has the advantages that high specificity；Additionally, the sequence can be a large amount of
Rapidly synthesize in vitro, and preparation method is simple, thus be easier to obtain.
Description of the drawings
Fig. 1 is that aptamers suppress the escherichia coli efflux pump mechanism of action；
Fig. 2 is escherichia coli outer membrane protein TolC purification electrophoretograms；
Description of the drawings：
Fig. 2 abscissas are represented：Swimming lane 1 is TolC supernatants；Swimming 2 is precipitated for TolC；Swimming lane M is albumen marker；Fig. 2 is vertical to be sat
Mark is represented：The molecular weight of protein, unit kD.
Specific embodiment
Hereinafter coordinate the preferred embodiments of the present invention, the present invention is expanded on further and reaches predetermined goal of the invention and is taken
Technological means.
The present invention intends considering to be applied to change TolC protein structures effectively to block row outside escherichia coli by aptamer
Activity is arranged outside pump, and obstruction principle is as shown in Figure 1.Aptamer of the exploitation for escherichia coli outer membrane protein TolC, will be suppression
Bacillus coli multiple drug resistance processed is provided and is provided powerful support for, with important clinical value.
Embodiment 1：Outer membrane protein TolC gene amplification
Using molecule clone technology, according to the genome sequence of escherichia coli outer membrane protein TolC design special primer (on
Primer Pa is swum, downstream primer Pb), with full-length cDNA as template, PCR amplifications.PCR reaction conditions：94 DEG C, denaturation 5min,
Then with 94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s carry out 3O circulation, last 72 DEG C of extensions 10min.PCR
Product Jing 1wt% agarose gel electrophoresiies, cut glue reclaim purpose fragment.
Embodiment 2：The structure of recombinant expression plasmid
(1) genes of interest Jing Bam H I and Xho I double digestions are obtained, enzyme action system is as follows：25 μ l plasmids, 2 μ l Bam H
I, 2 μ l Xho I, 8 μ 10 × Buffer of l, 43 μ l ddH2O, 37 DEG C of reaction overnights of mixture are pure with quick glue reclaim test kit
Change digestion products.
(2) PET-30a plasmids Jing Bam H I and Xho I double digestions, enzyme action system are as follows：5 μ l carriers (pET-30a) matter
Grain, 2 μ l BamH I, 2 μ l Xho I, 8 μ 10 × Buffer of l, 63 μ l ddH2O, 37 DEG C of reaction overnights of mixture, uses quick glue
QIAquick Gel Extraction Kit purification digestion products.
(3) connect the gene and PET-30a carriers of escherichia coli outer membrane protein TolC with T4 ligases, obtain restructuring matter
Grain.Linked system is as follows：1ul carriers (pET30a), 3ul PCR recovery products, 4ul ligases (Takara, DNA ligation
Kit Ver2.0), mix, react more than 30min at room temperature.
(4) recombinant plasmid transformed competence colibacillus cell BL21.The competent cell (BL21) that -80 DEG C of temperature are preserved is taken out, is put
Thaw slow on ice.2 water-baths are adjusted to be respectively 42 DEG C and 37 DEG C to water temperature.Connection is added to produce competent cell BL21
Thing, is placed 30 minutes on ice.42 DEG C of heat shocks 90 seconds.Put back on ice, after 2 minutes, add the nonresistant LB culture medium of 800ul (to block that
Mycin) (giving birth to work purchased from Shanghai).It is put into 45 minutes in 37 DEG C of shaking tables, 8000rpm is centrifuged 3 minutes, abandons most of supernatant, stays about
100-150ul is resuspended, and selection has the LB flat boards of corresponding resistant, coated plate.Dry, overnight incubation is inverted in 37 DEG C of incubators.
Embodiment 3：Expression of the TolC albumen in escherichia coli
Monoclonal is chosen in 1.5ml LB fluid mediums from the flat board of conversion, 37 DEG C, 200rpm is cultivated.By the bacterium of culture
Liquid is transferred to the mixing of 500mL LB fluid mediums, and 37 DEG C, 200rpm is cultivated to OD=0.6-0.8, IPTG (0.5mM) inductions
4h.With the big concentrator bowls of 400m, 6000rpm, 5min is centrifuged, supernatant is taken.Precipitation 20-30ml 10mM Tris-HCl (pH8.0)
Solution is dispelled, Ultrasonic Pulverization (500W, 30 times, each 10s is spaced 15s).Take 100 μ l it is ultrasonic after bacteria suspension, 12000rpm,
Centrifugation 10min, obtains TolC supernatants TolC precipitations respectively, takes 50 μ lTolC supernatants and manage to another EP, and TolC is precipitated with 50 μ l
10mM Tris-HCl pH8.0) solution dispels, and adds 50 μ l2 × loading buffer, and 100 DEG C are boiled 5min, electrophoresis.Electrophoresis
Figure is as shown in Figure 2.As a result being displayed in the i.e. TolC supernatants TolC of swimming lane 1 and 2 precipitations at 52kD has one substantially to increase thick albumen
Matter band (as shown in Figure 2) M is that band position of the conventional standard molecular weight marker of electrophoretic techniquess, purpose band and Marker
The identical molecular weight for being assured that purpose band is put, as a result shows that destination protein has expression in supernatant precipitation.
Embodiment 4：Protein purification
Nickel post is washed to pH7.0 with pure water, nickel is hung afterwards to pH2-3.Pure water washes post to pH7.0, uses 100mlTris-HCl
(10mM, pH8.0) solution equilibria nickel post, then contain 10mMTris-HCl (pH8.0) the solution equilibria nickel of 0.5M Sodium Chloride with 50ml
Post.Sample Outer membrane protein TolC is diluted into loading, the 10mM Tris-HCl pH8.0 of 0.5M Sodium Chloride after end of the sample, are used) it is molten
Liquid washes post, respectively with imidazoles containing 15mM, 60mM imidazoles, 10mM Tris-HCl (the pH8.0) (chlorination containing 0.5M of 300mM imidazoles
Sodium) eluant solution, collect the protein peak of 300mM imidazoles eluting.
Embodiment 5：Aptamer screening (wheel)
Shanghai life work synthesizes the ssDNA pool of 78 nt length, and upstream is the primer binding site of 23 nt, downstream
For the primer binding site of 20 nt, the middle random sequences for 35 nt, storage capacity is 435.The sequence of ssDNA is：
It is used in 5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 ' screening processes
The DNA primer of PCR amplifications is respectively：Primer P1, primer P2.
(1), during TolC albumen adds 96 hole elisa plates after being dissolved in 200 μ lPBS, 4 DEG C overnight.
(2), after albumen coating hole PBS washs 6 times, add 200 μ l3%BSA (work being given birth to purchased from Shanghai), be incubated 2 hours.
Meanwhile, add 200 μ l3%BSA37 DEG C to be incubated in the elisa plate of blank 96 hole 2 hours.
(3) ssDNA pool (first run consumption is 800pmol) is dissolved in into 200 μ 1 × SHCMK of l, 95 DEG C of degeneration 5min.
It is immediately placed on 10min on ice so as to be rapidly decreased to room temperature, it is to avoid ssDNA renaturation is into double-strand.
(4), in the blank ELISA holes for adding PBS to wash 6 times ssDNA, 37 DEG C are incubated 2 hours.
(5) supernatant proceed to PBS wash 6 times albumen coating hole in, 37 DEG C incubation 2 hours after PBS wash 6 times.
(6) the enzyme mark hole for combining ssDNA is resuspended with 200 μ l elution buffers, 95 DEG C of heating 5min, takes supernatant, passes through
Ethanol precipitation DNA, is dissolved in Millipore water, used as the template of next round screening.
(8) 5 μ lPCR products being taken and being splined on 5wt% agaroses (work being given birth to purchased from Shanghai), whether observation pillar location is correct.
From after the first run, the amount in ssDNA level storehouse of input is gradually decreased, and 12 circulations are so repeated.
Embodiment 6：Aptamer is cloned
The amplification of the 12nd wheel screening product and purification：The ssDNA sequences that 12nd wheel screening is obtained, use primer P1, primer
P2 is expanded.100 μ lPCR amplification after system add 500pl with reference to liquid BB (20mmol/L Hepes (pH7.35),
120mmol/L NaCl, 5mmol/L KCl, 1mmol/L CaCl2,1mmol/LMgCl2,1%BSA), fully mix.By upper one
Step resulting solution add adsorption column EC in (adsorption column is put in collecting pipe), room temperature place lmin, 12000rpm centrifugation 30～
60s, outwells the waste liquid in collecting pipe.Add 700pmol rinsings WB (with reference to liquid BB+0.05%Tween20), 12000rpm centrifugations
30s, discards waste liquid.500pmol rinsing liquid WB, 12000rpm centrifugation 30s is added, waste liquid is discarded.Adsorption column EC is put back to into empty receipts
In collector, 12000rpm centrifugation 2min.Adsorption column EC is taken out, is put in a clean centrifuge tube, in the pars intermedia of adsorbed film
Position plus the elution buffer EB of 20pmol65 DEG C of water-bath preheating, room temperature place 2min, 12,000rpm centrifugation lmin.By what is obtained
Solution is rejoined in adsorption column, recentrifuge lmin.
The clone of PCR purified products：1 μ l amplified productions are taken, are connected in the presence of T4DNA ligases with carrier PGM-T,
Be transformed into competent cell again, take proper volume be spread evenly across containing IPTG, x-gal, antibiotic (Amp) (they point
Gou Ziyu Shanghai life work) LA flat boards, be inverted culture dish, cultivating 12-16 hours in 37 DEG C carries out " indigo plant-white macula screening ".
Sequencing：With the single white colony in inoculating loop picking screening flat board in the LB fluid mediums containing Amp, 37 DEG C of trainings
Support overnight.Bacterium solution lml is taken in centrifuge tube, the raw work sequencing in sea after sealer, is served.Sequencing result finds wherein have 20 nucleic acid to fit
Ligand sequence has very strong affinity with escherichia coli outer membrane protein TolC, and 20 sequences are respectively：
5’-TGCGTGTTTACGTGTCGATGTCCGGGTACCCTCGG-3’(SEQ ID NO：1)；
5’-CTCTTAGCCATTTTGGTATGCGTATTGCTCTACAG-3’(SEQ ID NO：2)；
5’-ATATATTGCTCTGATCGTACTCTTATTAGGTTAGT-3’(SEQ ID NO：3)；
5’-ATGACGCTGTGGTATTACGTCCTCCTGTATTTGCC-3’(SEQ ID NO：4)；
5’-TCTAAGTGGAATCTACCACCAACGTATTTTTCCTC-3’(SEQ ID NO：5)；
5’-TCCGCCTATTCGGGAGGGAATATTGCTGATTTGTA-3’(SEQ ID NO：6)；
5’-CTCTTCAGTTTTAGACAATGCACGTTTCAGCGGTG-3’(SEQ ID NO：7)；
5’-TCCAGGCTATAATTTCTTGGAACTCCCTCCGTTAG-3’(SEQ ID NO：8)；
5’-CTTTCGAAGGGACTTTAACGGGTATATCCGGTTTT-3’(SEQ ID NO：9)；
5’-ATTACATGCTCTGAGCTTTTTGTATGAGAAATGAT-3’(SEQ ID NO：10)；
5’-CGCTTAGCTTGTGATTTCATCTTTCACACAAGAAT-3’(SEQ ID NO：11)；
5’-CGGAGATCTGTTACACTTCGGTACGTCTTAGTTTG-3’(SEQ ID NO：12)；
5’-CTACCATGTTCAGTGGTTTTGGGATTTTCATACAT-3’(SEQ ID NO：13)；
5’-TGAGATCGGTGAGTTAGTATCTTTTATTCAGTTTT-3’(SEQ ID NO：14)；
5’-GCATTGCGTGACATGGCCTTGCTATCCCTGTTCGT-3’(SEQ ID NO：15)；
5’-TCCTAAAAGCTAGTTATAGTAAATTGAAAACTTAG-3’(SEQ ID NO：16)；
5’-TGGAGCTTAGATTTTGAAGCAGTTACATTTCCCGA-3’(SEQ ID NO：17)；
5’-TACTGCGAGCTTCATTTTTACTTGGTAGTGTTGTG-3’(SEQ ID NO：18)；
5’-CGAACGAATATAATTATGGCGTCCCCGGGGTTTCG-3’(SEQ ID NO：19)；
5’-CTAGTTATGACATTTGTGTCATTTATCCCACGCTG-3’(SEQ ID NO：20)；
The above is only the preferred embodiments of the present invention, not does any pro forma restriction to the present invention, though
So the present invention is disclosed above with preferred embodiment, but is not limited to the present invention, any to be familiar with this professional technology people
Member, in the range of without departing from technical solution of the present invention, when using the technology contents of the disclosure above make it is a little change or repair
The Equivalent embodiments for equivalent variations are adornd, as long as being the content without departing from technical solution of the present invention, according to the technology reality of the present invention
Any simple modification, equivalent variations and modification that confrontation above example is made, still fall within the scope of technical solution of the present invention
It is interior.
Claims (4)
1. the aptamer of specific bond escherichia coli outer membrane protein TolC, the aptamer are following sequence：SEQ
ID NO：14.
2. aptamers as described in claim 1, it is characterised in that the escherichia coli outer membrane protein TolC is adopted with the following method
Purification is obtained：
Using molecule clone technology, special primer, the spy are designed according to the genome sequence of escherichia coli outer membrane protein TolC
The forward primer Pa of different primer is 5 '-CGGGATCCATGAAGAAATTGCTCCCCATTCTT 3 ', and primer Pb is 5 ' downstream
CCGCTCGAGGTTACGGAAAGGGTTATGACCGTT 3 ', with full-length cDNA as template, PCR amplifications obtain genes of interest Jing
Bam H I and Xho I double digestions, it is same to process PET-30a plasmids, then the weight containing TolC genes is obtained with the connection of T4 ligases
Group plasmid；Recombinant plasmid transformed competence colibacillus cell BL21, chooses monoclonal from the flat board of conversion and cultivates in fluid medium, IPTG
Abduction delivering, Jing solid-liquid separation take precipitation Jing Ultrasonic Pulverization, then electrophoresis；Again using outside escherichia coli described in column chromatography purification
Memebrane protein TolC.
3. aptamers as described in claim 1 or 2, it is characterised in that sequence of the sequence for synthetic, or it is any its
The same sequence that he originates.
4. application of the aptamers any one of a kind of claim 1-3 in the probe for preparing detection TolC albumen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410767405.8A CN104450722B (en) | 2013-02-28 | 2013-02-28 | Sequence and application of aptamer of escherichia coli outer membrane protein (OMP) TolC |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310062950.2A CN103103195B (en) | 2013-02-28 | 2013-02-28 | Sequence of aptamer for outer membrane protein TolC of escherichia coli and application of sequence |
| CN201410767405.8A CN104450722B (en) | 2013-02-28 | 2013-02-28 | Sequence and application of aptamer of escherichia coli outer membrane protein (OMP) TolC |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310062950.2A Division CN103103195B (en) | 2013-02-28 | 2013-02-28 | Sequence of aptamer for outer membrane protein TolC of escherichia coli and application of sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450722A CN104450722A (en) | 2015-03-25 |
| CN104450722B true CN104450722B (en) | 2017-03-22 |
Family
ID=52897473
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410767405.8A Expired - Fee Related CN104450722B (en) | 2013-02-28 | 2013-02-28 | Sequence and application of aptamer of escherichia coli outer membrane protein (OMP) TolC |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450722B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101143216A (en) * | 2007-07-10 | 2008-03-19 | 中山大学 | Escherichia coli TolC antibody targeting effect improving drug-resistant bacteria sensitivity to antibiotic technology |
| CN101974072A (en) * | 2010-10-12 | 2011-02-16 | 中山大学 | Escherichia coli TolC antigen as well as antibody and application thereof |
-
2013
- 2013-02-28 CN CN201410767405.8A patent/CN104450722B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101143216A (en) * | 2007-07-10 | 2008-03-19 | 中山大学 | Escherichia coli TolC antibody targeting effect improving drug-resistant bacteria sensitivity to antibiotic technology |
| CN101974072A (en) * | 2010-10-12 | 2011-02-16 | 中山大学 | Escherichia coli TolC antigen as well as antibody and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| A novel screening method for competitive FRET-aptamers applied to E. coli assay development;John G. Bruno et al.;《J Fluoresc》;20100505;1211-1223 * |
| 适配体筛选方法研究进展;王巍 贾凌云;《分析化学》;20090331;第37卷(第3期);454-460 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450722A (en) | 2015-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104073496B (en) | The sequence of escherichia coli outer membrane protein TolC aptamer and purposes | |
| CN104450722B (en) | Sequence and application of aptamer of escherichia coli outer membrane protein (OMP) TolC | |
| CN104561012B (en) | Sequence and use of escherichia coli outer membrane protein TolC aptamer | |
| CN104450719B (en) | Sequence and application of aptamer of escherichia coli outer membrane protein (OMP) TolC | |
| CN104450716B (en) | The sequence and purposes of escherichia coli outer membrane protein TolC aptamers | |
| CN104099335B (en) | Sequence and application of aptamer of escherichia coli outer membrane protein TolC | |
| CN103103195B (en) | Sequence of aptamer for outer membrane protein TolC of escherichia coli and application of sequence | |
| CN104404047B (en) | The sequence and purposes of escherichia coli outer membrane protein TolC aptamers | |
| CN104450718B (en) | The sequence and purposes of escherichia coli outer membrane protein TolC aptamers | |
| CN104450720B (en) | The sequence and purposes of escherichia coli outer membrane protein TolC aptamers | |
| CN104450721B (en) | The sequence and purposes of escherichia coli outer membrane protein TolC aptamers | |
| CN104450715B (en) | The sequence and purposes of escherichia coli outer membrane protein TolC aptamers | |
| CN104450723B (en) | The sequence and purposes of escherichia coli outer membrane protein TolC aptamers | |
| CN104073495B (en) | Sequence and use of aptamer of colibacillus outer membrane protein TolC | |
| CN104087590B (en) | The sequence of escherichia coli outer membrane protein TolC aptamer and purposes | |
| CN104450717B (en) | The sequence and purposes of escherichia coli outer membrane protein TolC aptamers | |
| CN107365384A (en) | A kind of targeting Reg3A single-chain antibody | |
| CN104073498B (en) | The sequence of escherichia coli outer membrane protein TolC aptamer and purposes | |
| CN104073497B (en) | The sequence of escherichia coli outer membrane protein TolC aptamer and purposes | |
| CN104087589B (en) | The sequence of escherichia coli outer membrane protein TolC aptamer and purposes | |
| CN104073494B (en) | The sequence of escherichia coli outer membrane protein TolC aptamer and purposes | |
| CN104093855B (en) | Specific bond and the method for targeting DNA RNA heteroduplexes | |
| CN103755813A (en) | Targeting anti-tumor fusion protein, and encoding gene and expression plasmid thereof | |
| CN103497236B (en) | Specific heptapeptide targeting to WISP-1 protein and application thereof | |
| CN106834328A (en) | A kind of S ribosylhomocysteines lyase gene recombinant expression carrier and its expression and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170322 Termination date: 20190228 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |