CN103103195B - Sequence of aptamer for outer membrane protein TolC of escherichia coli and application of sequence - Google Patents

Abstract

The invention relates to a sequence of an aptamer for outer membrane protein TolC of escherichia coli and an application of the sequence. According to the invention, surface protein TolC of the escherichia coli is expressed by a genetic recombinant plasmid, a nucleic acid apatamer group combined with the specificity of the surface protein TolC is selected through an SELEX (Systematic Evolution of Ligands by Exponential Enrichment) process, and a base sequence of the aptamer group is sequenced and analyzed. The sequence can be used as a specifically combined probe for the surface protein TolC of the escherichia coli, and is used for designing and preparing quick detection markers and efflux pump inhibitors for the escherichia coli.

Description

The sequence of escherichia coli outer membrane protein TolC aptamer and purposes

Technical field

The invention belongs to molecular biology and medical microbial technical field, relate to sequence and the purposes of escherichia coli outer membrane protein TolC aptamer.

Background technology

Intestinal bacteria (Escherichia coli) are the representative bacterium of Escherichia, it is one of normal microflora formed in human intestine, be again important conditioned pathogen, very easily invade parenteral tissue and organ by various ways and approach, cause various severe infections.Along with the wide clinical application of antibacterials, induction of the generation of this Pseudomonas Resistant strain a large amount of, and define this bacterium to single antibiotic resistance to multiple antibacterials resistance simultaneously, by the development of low resistant rate to high resistant rate, bring great difficulty to clinical treatment, cause higher case fatality rate.Domestic and international at present deep research is expanded to colibacillary Resistance Mechanism.Research shows, Active efflux-pump is the important mechanisms of bacillus coli multiple resistance.Intestinal bacteria efflux pump comprises RND, MFS, ABC, SMR, MATE five class, wherein former three must form with outer membrane protein (OMP) TolC and transports community, just can complete the outer row to multi-medicament, TolC is the important composition composition forming intestinal bacteria efflux pump as can be seen here.TolC is the duct albumen be positioned on adventitia, and upper end is open architecture, provide the broad passage pumped to outer row's substrate; Lower end is enclosed construction.The change of efflux pump three mixture conformation, can make duct regularly open or closed.The change of TolC structure can cause the disintegration weakening even three mixtures of their triple interactions.In the research about escherichia coli outer membrane protein is reported, a lot of result has pointed out TolC albumen to play vital effect in colibacillary multidrug resistant mechanism.But do not report at present and suppress resistance by changing this protein structure.

The research of aptamers (Aptamers) is a new hot fields, and it with many target molecules (albumen, medicine, inorganic or organic molecule), the class single-chain nucleic acid (DNA or RNA) of high affinity and specific binding can occur.So far find that the method for high affine specificity aptamers is that part index concentration system launches (systematic evolution of ligands by exponential enrichment, SELEX).The high specific be combined with ligand molecular due to aptamers and high-affinity, be widely used in detection and drug research etc. in medical research.(the Yuan L such as Yuan, et al, Anal Chem, 2007,79 (3): 1082) utilize Plasmon Surface Resonance imaging and aptamer technology to set up protein chip, detect protein antibodies zymoplasm, vascular endothelial growth factor (VEGF) mixture that this protein chip adsorbs.Cao X etc. (Cao X, et al, Nucleic Acids Res, 2009,37 (14): 4621-8) utilize the aptamer for streptococcus aureus filtered out to detect streptococcus aureus.

At present both at home and abroad major part is engaged in the clinical treatment that aptamers is mainly applied to virus infection, cancer, autoimmune disease, vascular conditions by the scientist of aptamer research and biotech company, and becomes the new tool of ideal clinical treatment.Its therapy mechanism mainly by being folded into certain three-dimensional structure directly and pathology related protein specific binding, suppresses the activity of these protein, to reach therapeutic purpose.Feng H etc. (Feng H, et al, PLoS One, 2011,6 (11): e27862) have filtered out and can be combined with hepatitis B virus high-affinity, the aptamers that viral interference P-ε mixture is formed.But there is no the aptamers report or open of directed toward bacteria outer membrane protein so far, therefore real be necessary to develop a kind of can the aptamer of specific binding escherichia coli outer membrane protein TolC.

Summary of the invention

The present invention intends considering aptamer to be applied to and changes TolC protein structure and effectively block intestinal bacteria efflux pump and arrange activity outward.Exploitation can the aptamer of specific binding escherichia coli outer membrane protein TolC, providing powerful support for, having important clinical value for suppressing bacillus coli multiple resistance to provide.

The object of this invention is to provide a kind of can the aptamer of specific combination escherichia coli outer membrane protein TolC.This aptamers has following sequence: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQID NO:18, SEQ ID NO:19 or SEQ ID NO:20.

Particularly, described SEQ ID NO:1 is 5 '-TGCGTGTTTACGTGTCGATGTCCGGGTACCCTCGG-3 ';

Described SEQ ID NO:2 is 5 '-CTCTTAGCCATTTTGGTATGCGTATTGCTCTACAG-3 ';

Described SEQ ID NO:3 is 5 '-ATATATTGCTCTGATCGTACTCTTATTAGGTTAGT-3 ';

Described SEQ ID NO:4 is 5 '-ATGACGCTGTGGTATTACGTCCTCCTGTATTTGCC-3 ';

Described SEQ ID NO:5 is 5 '-TCTAAGTGGAATCTACCACCAACGTATTTTTCCTC-3 ';

Described SEQ ID NO:6 is 5 '-TCCGCCTATTCGGGAGGGAATATTGCTGATTTGTA-3 ';

Described SEQ ID NO:7 is 5 '-CTCTTCAGTTTTAGACAATGCACGTTTCAGCGGTG-3 ';

Described SEQ ID NO:8 is 5 '-TCCAGGCTATAATTTCTTGGAACTCCCTCCGTTAG-3 ';

Described SEQ ID NO:9 is 5 '-CTTTCGAAGGGACTTTAACGGGTATATCCGGTTTT-3 ';

Described SEQ ID NO:10 is 5 '-ATTACATGCTCTGAGCTTTTTGTATGAGAAATGAT-3 ';

Described SEQ ID NO:11 is 5 '-CGCTTAGCTTGTGATTTCATCTTTCACACAAGAAT-3 ';

Described SEQ ID NO:12 is 5 '-CGGAGATCTGTTACACTTCGGTACGTCTTAGTTTG-3 ';

Described SEQ ID NO:13 is 5 '-CTACCATGTTCAGTGGTTTTGGGATTTTCATACAT-3 ';

Described SEQ ID NO:14 is 5 '-TGAGATCGGTGAGTTAGTATCTTTTATTCAGTTTT-3 ';

Described SEQ ID NO:15 is 5 '-GCATTGCGTGACATGGCCTTGCTATCCCTGTTCGT-3 ';

Described SEQ ID NO:16 is 5 '-TCCTAAAAGCTAGTTATAGTAAATTGAAAACTTAG-3 ';

Described SEQ ID NO:17 is 5 '-TGGAGCTTAGATTTTGAAGCAGTTACATTTCCCGA-3 ';

Described SEQ ID NO:18 is 5 '-TACTGCGAGCTTCATTTTTACTTGGTAGTGTTGTG-3 ';

Described SEQ ID NO:19 is 5 '-CGAACGAATATAATTATGGCGTCCCCGGGGTTTCG-3 ';

Described SEQ ID NO:20 is 5 '-CTAGTTATGACATTTGTGTCATTTATCCCACGCTG-3 ';

The escherichia coli outer membrane protein TolC nucleic acid aptamer sequence of the present invention, is obtained by following method:

Adopt the external SELEX triage techniques of aptamer, with escherichia coli outer membrane protein TolC for Screening target, from the random oligo DNA library of external synthesis (5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 '), filter out the aptamer with TolC albumen specific combination.

Preferably, described escherichia coli outer membrane protein TolC adopts purifying with the following method and obtains:

Adopt molecule clone technology, according to the genome sequence design special primer of escherichia coli outer membrane protein TolC, the upstream primer Pa of described special primer is 5 ' ?CGGGATCCATGAAGAAATTGCTCCCCATTCTT ?3 ', its downstream primer Pb be 5 ’ ?CCGCTCGAGGTTACGGAAAGGGTTATGACCGTT ?3 ', take full-length cDNA as template, pcr amplification, obtain goal gene through Bam H I and Xho I double digestion, same process PET-30a plasmid, then connect the obtained recombinant plasmid containing TolC gene with T4 ligase enzyme; Recombinant plasmid transformed competence colibacillus cell BL21, choose mono-clonal to liquid nutrient medium from the flat board transformed and cultivate, IPTG abduction delivering, through solid-liquid separation, gets precipitation Tris-HCl solution and dispels, ultrasonication, then electrophoresis; Column chromatographic isolation and purification protein.

In a specific embodiment, the preparation method of the escherichia coli outer membrane protein TolC nucleic acid aptamer sequence of the present invention is:

Adopt molecule clone technology, according to the genome sequence design special primer of escherichia coli outer membrane protein TolC, in a specific embodiment, this special primer is upstream primer Pa, downstream primer Pb, take full-length cDNA as template, pcr amplification.Obtain goal gene through Bam H I and Xho I double digestion, same process PET-30a plasmid, then connect the obtained recombinant plasmid containing TolC gene with T4 ligase enzyme.

Recombinant plasmid transformed competence colibacillus cell BL21, choose mono-clonal from the flat board transformed to cultivate to 1.5ml LB liquid nutrient medium, IPTG(0.5mM) abduction delivering, get the bacterium liquid of 1ml induction, 12000rpm, centrifugal 1min, abandons supernatant, precipitation 50-100 μ l10mM Tris-HCl(pH8.0) solution dispels (adding the amount of damping fluid depending on biomass), ultrasonication (500W, 30 times, each 10s, interval 15s).Add 50 μ l2 × loading buffer, 100 DEG C are boiled 5min, electrophoresis.

Cross nickel post protein purification, collect protein peak respectively, electrophoresis detection protein purification effect (purification result is shown in Fig. 2).

Utilize the SELEX in-vitro screening technology of aptamers subsequently, to collect the TolC after purifying for Screening target, from the random oligo DNA library of external synthesis

The aptamer with TolC albumen specific combination is filtered out, sequence primer the P1(5 '-GGGAGCTCAGAATAAACGCTCAA-3 ' by screening in (5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 ')) and primer P2(5 '-GATCCGGGCCTCATGTCGAA-3 ') increase.1 μ l will be got after pcr amplification product purifying, be connected under the effect of T4DNA ligase enzyme with carrier PGM-T, be transformed into competent cell again, get the LA that proper volume is spread evenly across containing IPTG, x mono-gal, microbiotic (Amp) dull and stereotyped, after 12 ~ 16 hours with the single white colony on transfering loop picking screening flat board in the LB liquid nutrient medium containing Amp, 37 DEG C of overnight incubation.Get bacterium liquid lml in centrifuge tube, after sealer, serve Hai Sheng work Bioisystech Co., Ltd (hereinafter referred to as the raw work in Shanghai) order-checking.

Described sequence is selected from the sequence of natural existence or synthetic, or the same sequence in any other source.

The present invention further provides the purposes of described nucleic acid aptamer sequence, such as this sequence is preparing the application in medicine or goods.In a specific embodiment, the invention provides the application of described sequence in preparation intestinal bacteria efflux pump inhibitor.

Another object of the present invention is to provide described nucleic acid aptamer sequence preparing the application in the probe or target spot detecting TolC albumen.

The present invention also provides the application of described aptamers in preparation intestinal bacteria efflux pump inhibitor.

The present invention also provides described aptamers preparing the application in the probe or target spot detecting TolC albumen.

Another object of the present invention is to provide a kind of method suppressing intestinal bacteria efflux pump to arrange activity outward or reduce that intestinal bacteria efflux pump arranges outward, comprise the described aptamers giving significant quantity.

In the present invention, the aptamers that described nucleotide sequence is formed can with escherichia coli outer membrane protein TolC specific binding, can be used for design and the preparation of efflux pump inhibitor medicine.The aptamers that described nucleotide sequence is formed also can as probe or the target spot detecting TolC albumen.Nucleic acid aptamer sequence provided by the present invention has very strong affinity with the escherichia coli outer membrane protein TolC as target, and thus described sequence has the advantage of high specificity; In addition, described sequence can be synthesized in a large number rapidly in vitro, and preparation method is simple, thus obtains than being easier to.

Accompanying drawing explanation

Fig. 1 is that aptamers suppresses the intestinal bacteria efflux pump mechanism of action.

Fig. 2 is escherichia coli outer membrane protein TolC purifying electrophorogram.

Accompanying drawing illustrates:

Fig. 2 X-coordinate represents: swimming lane 1 is TolC supernatant; Swimming lane 2 is TolC precipitation; Swimming lane M is albumen marker.Fig. 2 ordinate zou represents: the molecular weight of protein, unit kD.

Embodiment

Below coordinating the preferred embodiments of the present invention, setting forth the technique means that the present invention takes for reaching predetermined goal of the invention further.

The present invention intends considering aptamer to be applied to and changes TolC protein structure and effectively block intestinal bacteria efflux pump and arrange activity outward, blocks principle as shown in Figure 1.Develop the aptamer for escherichia coli outer membrane protein TolC, will provide powerful support for for suppressing bacillus coli multiple resistance to provide, there is important clinical value.

embodiment 1: Outer membrane protein TolC gene amplification

Adopting molecule clone technology, according to genome sequence design special primer (upstream primer Pa, its downstream primer Pb) of escherichia coli outer membrane protein TolC, take full-length cDNA as template, pcr amplification.PCR reaction conditions: 94 DEG C, denaturation 5min, then with 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, carry out 3O circulation, and last 72 DEG C extend 10min.PCR primer, through 1wt% agarose gel electrophoresis, is cut glue and is reclaimed object fragment.

embodiment 2: the structure of recombinant expression plasmid

(1) obtain goal gene through Bam H I and Xho I double digestion, it is as follows that enzyme cuts system: 25 μ l plasmids, 2 μ l Bam H I, 2 μ l Xho I, 8 μ l10 × Buffer, 43 μ l ddH ₂o, mixture 37 DEG C of reaction overnight, reclaim kits digestion products with quick glue.

(2) PET-30a plasmid is through Bam H I and Xho I double digestion, and it is as follows that enzyme cuts system: 5 μ l carrier (pET-30a) plasmids, 2 μ l BamH I, 2 μ l Xho I, 8 μ l10 × Buffer, 63 μ l ddH ₂o, mixture 37 DEG C of reaction overnight, reclaim kits digestion products with quick glue.

(3) connect gene and the PET-30a carrier of escherichia coli outer membrane protein TolC with T4 ligase enzyme, obtain recombinant plasmid.Linked system is as follows: 1ul carrier (pET30a), and 3ul PCR reclaims product, 4ul ligase enzyme (Takara, DNA ligation Kit Ver2.0), mixing, at room temperature reacts more than 30min.

(4) recombinant plasmid transformed competence colibacillus cell BL21.Take out the competent cell (BL21) that-80 DEG C of temperature are preserved, be placed on and slowly thaw on ice.2 water-bath to water temperatures are adjusted to be respectively 42 DEG C and 37 DEG C.Competent cell BL21 is added connection product, places 30 minutes on ice.42 DEG C of heat shocks 90 seconds.Put back on ice, after 2 minutes, add the nonresistant LB substratum (kantlex) of 800ul (purchased from the raw work in Shanghai).Put into 37 DEG C of shaking tables 45 minutes, centrifugal 3 minutes of 8000rpm, abandons most of supernatant, stays about 100-150ul resuspended, selects the LB having corresponding resistant dull and stereotyped, coated plate.Dry, in 37 DEG C of incubators, be inverted overnight incubation.

the expression of embodiment 3:TolC albumen in intestinal bacteria

Choose mono-clonal to 1.5ml LB liquid nutrient medium, 37 DEG C from the flat board transformed, 200rpm cultivates.The bacterium liquid of cultivation is transferred to the mixing of 500mL LB liquid nutrient medium, 37 DEG C, 200rpm, is cultured to OD=0.6-0.8, IPTG(0.5mM) induce 4h.With the large concentrator bowl of 400ml, 6000rpm, centrifugal 5min, gets supernatant.Precipitation 20-30ml10mM Tris-HCl(pH8.0) solution dispels, ultrasonication (500W, 30 times, each 10s, interval 15s).Get 100 μ l ultrasonic after bacteria suspension, 12000rpm, centrifugal 10min, obtain cleer and peaceful TolC precipitation on TolC respectively, get 50 μ lTolC supernatants to manage to another EP, TolC precipitation is with 50 μ l10mM Tris-HCl(pH8.0) solution dispels, and adds 50 μ l2 × loading buffer, 100 DEG C are boiled 5min, electrophoresis.Electrophorogram as shown in Figure 2.Result is presented at cleer and peaceful TolC precipitation on 52kD place swimming lane 1 and 2 i.e. TolC all has one obviously to increase the standard molecular weight marker that thick protein band (as shown in Figure 2) M is electrophoretic technique routine, the object band molecular weight that just can determine object band identical with that pillar location of Marker, result shows that target protein all has expression in upper cleer and peaceful precipitation.

embodiment 4: protein purification

Wash nickel post to pH7.0 with pure water, rear extension nickel is to pH2-3.Pure water washes post to pH7.0, with 100mlTris-HCl(10mM, pH8.0) solution equilibria nickel post, then the 10mMTris-HCl(pH8.0 of 0.5M sodium-chlor is contained with 50ml) solution equilibria nickel post.By sample Outer membrane protein TolC dilution loading, with the 10mM Tris-HCl(pH8.0 of 0.5M sodium-chlor after end of the sample) solution washes post, respectively with the 10mM Tris-HCl(pH8.0 containing 15mM imidazoles, 60mM imidazoles, 300mM imidazoles) (containing 0.5M sodium-chlor) eluant solution, collect the protein peak of 300mM imidazoles wash-out.

embodiment 5: aptamer screening (takes turns)

The raw work in Shanghai synthesizes the ssDNA pool of 78 nt length, and upstream is the primer binding site of 23 nt, and downstream is the primer binding site of 20 nt, and centre is the stochastic sequence of 35 nt, and storage capacity is 4 ³⁵.The sequence of ssDNA is:

DNA primer for pcr amplification in 5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 ' screening process is respectively: primer P1, primer P2.

(1) TolC albumen adds in 96 hole elisa plates after being dissolved in 200 μ l PBS, and 4 DEG C are spent the night.

(2), after albumen bag is washed 6 times by hole PBS, 200 μ l3%BSA(are added purchased from the raw work in Shanghai), hatch 2 hours.Meanwhile, add 200 μ l3%BSA37 DEG C in blank 96 hole elisa plates and hatch 2 hours.

(3) ssDNA pool (first run consumption is 800pmol) is dissolved in 200 μ l1 × SHCMK, 95 DEG C of sex change 5min.Be placed in 10min on ice immediately, make it be down to room temperature rapidly, avoid ssDNA renaturation to become double-strand.

(4) ssDNA being added PBS washs in the blank ELISA hole of 6 times, hatches 2 hours for 37 DEG C.

(5) supernatant proceeds to PBS and washs the albumen bag of 6 times by hole, 37 DEG C hatch 2 hours after PBS wash 6 times.

(6) the enzyme mark hole combining ssDNA is resuspended with 200 μ l elution buffers, and 95 DEG C of heating 5min, get supernatant, through alcohol settling DNA, be dissolved in Millipore water, as the template of next round screening.

(8) get 5 μ lPCR products and be splined on 5wt% agarose (purchased from the raw work in Shanghai), whether correctly observe pillar location.After the first run, the amount in ssDNA level storehouse of input reduces gradually, so repeatedly carries out 12 circulations.

embodiment 6: aptamer is cloned

12nd takes turns the amplification and purifying of screening product: take turns the ssDNA sequence of screening and obtaining by the 12nd, use primer P1, primer P2 increases.After 100 μ lPCR increase, system adds 500pl in conjunction with liquid BB(20mmol/L Hepes (pH7.35), 120mmol/L NaCl, 5mmol/L KCl, 1mmol/L CaCl2,1mmol/LMgCl2,1%BSA), fully mix.Previous step gained solution is added (adsorption column puts into collection tube) in adsorption column EC, and room temperature places the centrifugal 30 ~ 60s of lmin, 12000rpm, outwells the waste liquid in collection tube.Add 700pmol rinsing liquid WB (in conjunction with liquid BB+0.05%Tween20), the centrifugal 30s of 12000rpm, discards waste liquid.Add 500pmol rinsing liquid WB, the centrifugal 30s of 12000rpm, discards waste liquid.Adsorption column EC is put back in sky collection tube, the centrifugal 2min of 12000rpm.Take out adsorption column EC, put into a clean centrifuge tube, add the elution buffer EB of 20pmol65 DEG C of water-bath preheating in the middle part of adsorption film, room temperature places the centrifugal lmin of 2min, 12,000rpm.The solution obtained is rejoined in adsorption column, recentrifuge lmin.

The clone of PCR purified product: get 1 μ l amplified production, be connected under the effect of T4DNA ligase enzyme with carrier PGM-T, be transformed into competent cell again, get the LA that proper volume is spread evenly across containing IPTG, x-gal, microbiotic (Amp) (they are respectively purchased from work raw in Shanghai) dull and stereotyped, be inverted culture dish, within 12-16 hour, carry out " indigo plant-hickie screening " in 37 DEG C of cultivations.

Order-checking: with the single white colony on transfering loop picking screening flat board in the LB liquid nutrient medium containing Amp, 37 DEG C of overnight incubation.Get bacterium liquid lml in centrifuge tube, after sealer, serve Hai Shenggong order-checking.Sequencing result find wherein have 20 nucleic acid aptamer sequence and escherichia coli outer membrane protein TolC to have very strong affinity, these 20 sequences respectively:

5’-TGCGTGTTTACGTGTCGATGTCCGGGTACCCTCGG-3’（SEQ?ID?NO：1）；

5’-CTCTTAGCCATTTTGGTATGCGTATTGCTCTACAG-3’（SEQ?ID?NO：2）;

5’-ATATATTGCTCTGATCGTACTCTTATTAGGTTAGT-3’（SEQ?ID?NO：3）；

5’-ATGACGCTGTGGTATTACGTCCTCCTGTATTTGCC-3’（SEQ?ID?NO：4）;

5’-TCTAAGTGGAATCTACCACCAACGTATTTTTCCTC-3’（SEQ?ID?NO：5）;

5’-TCCGCCTATTCGGGAGGGAATATTGCTGATTTGTA-3’（SEQ?ID?NO：6）;

5’-CTCTTCAGTTTTAGACAATGCACGTTTCAGCGGTG-3’（SEQ?ID?NO：7）;

5’-TCCAGGCTATAATTTCTTGGAACTCCCTCCGTTAG-3’（SEQ?ID?NO：8）;

5’-CTTTCGAAGGGACTTTAACGGGTATATCCGGTTTT-3’（SEQ?ID?NO：9）;

5’-ATTACATGCTCTGAGCTTTTTGTATGAGAAATGAT-3’（SEQ?ID?NO：10）;

5’-CGCTTAGCTTGTGATTTCATCTTTCACACAAGAAT-3’（SEQ?ID?NO：11）;

5’-CGGAGATCTGTTACACTTCGGTACGTCTTAGTTTG-3’（SEQ?ID?NO：12）;

5’-CTACCATGTTCAGTGGTTTTGGGATTTTCATACAT-3’（SEQ?ID?NO：13）;

5’-TGAGATCGGTGAGTTAGTATCTTTTATTCAGTTTT-3’（SEQ?ID?NO：14）;

5’-GCATTGCGTGACATGGCCTTGCTATCCCTGTTCGT-3’（SEQ?ID?NO：15）;

5’-TCCTAAAAGCTAGTTATAGTAAATTGAAAACTTAG-3’（SEQ?ID?NO：16）;

5’-TGGAGCTTAGATTTTGAAGCAGTTACATTTCCCGA-3’（SEQ?ID?NO：17）;

5’-TACTGCGAGCTTCATTTTTACTTGGTAGTGTTGTG-3’（SEQ?ID?NO：18）;

5’-CGAACGAATATAATTATGGCGTCCCCGGGGTTTCG-3’（SEQ?ID?NO：19）;

5’-CTAGTTATGACATTTGTGTCATTTATCCCACGCTG-3’（SEQ?ID?NO：20）；

The above is only the preferred embodiments of the present invention, not any pro forma restriction is done to the present invention, although the present invention discloses as above with preferred embodiment, but and be not used to limit the present invention, any those skilled in the art, not departing from the scope of technical solution of the present invention, make a little change when the technology contents of above-mentioned announcement can be utilized or be modified to the Equivalent embodiments of equivalent variations, in every case be the content not departing from technical solution of the present invention, according to any simple modification that technical spirit of the present invention is done above embodiment, equivalent variations and modification, all still belong in the scope of technical solution of the present invention.

Claims (4)

1. the aptamer of specific combination escherichia coli outer membrane protein TolC, described aptamer is sequence as shown in SEQ ID NO:20.

2., by aptamers according to claim 1, it is characterized in that, described escherichia coli outer membrane protein TolC adopts purifying with the following method and obtains:

Adopt molecule clone technology, according to the genome sequence design special primer of escherichia coli outer membrane protein TolC, the upstream primer Pa of described special primer is 5 '-CGGGATCCATGAAGAAATTGCTCCCCATTCTT ?3 ', its downstream primer Pb be 5 ’ ?CCGCTCGAGGTTACGGAAAGGGTTATGACCGTT ?3 ', take full-length cDNA as template, pcr amplification, obtain goal gene through Bam H I and Xho I double digestion, same process PET-30a plasmid, then connect the obtained recombinant plasmid containing TolC gene with T4 ligase enzyme; Recombinant plasmid transformed competence colibacillus cell BL21, chooses mono-clonal to liquid nutrient medium from the flat board transformed and cultivates, IPTG abduction delivering, through solid-liquid separation, gets precipitation through ultrasonication, then electrophoresis; Adopt escherichia coli outer membrane protein TolC described in column chromatography purification again.

3. by the aptamers described in claim 1 or 2, it is characterized in that, described sequence is the sequence of synthetic, or the same sequence in any other source.

4. the aptamers according to any one of a claim 1-3 detects the application in the probe of TolC albumen in preparation.