CN102453726A

CN102453726A - Construction method of human Smac gene eukaryotic expression vector pcDNA3.1-Smac

Info

Publication number: CN102453726A
Application number: CN2010105293049A
Authority: CN
Inventors: 秦思达; 任宏; 杨成成
Original assignee: Individual
Current assignee: Individual
Priority date: 2010-11-01
Filing date: 2010-11-01
Publication date: 2012-05-16

Abstract

The invention discloses a construction method of human Smac gene eukaryotic expression vector pcDNA3.1-Smac, which adopts reverse transcription polymerase chain reaction (RT-PCR) technology to amplify Smac full-length gene fragments from human normal testis tissues, carries out BamHI and HindIII double digestion on the Smac gene fragments, recovers the digested target gene after agarose gel electrophoresis, prepares hollow plasmid pcDNA3.1 for transformation and amplification plasmid, extracts the plasmid, uses BamHI and HindIII double digestion on the hollow plasmid pcDNA3.1, carries out electrophoresis and recovers the digested products, and is connected with the digested target gene Smac to construct recombinant eukaryotic expression vector pcDNA3.1-Smac. After the expression vector obtained by the method is successfully sequenced, the expression vector is transfected into lung cancer A549 cells, the expression of the Smac gene in the transfected lung cancer A549 cells is verified, and a foundation is laid for further researching the apoptosis promotion effect of the Smac gene on the lung cancer cells.

Description

The construction process of a kind of people's Smac gene eukaryotic expression vector pcDNA3.1-Smac

Technical field

The present invention relates to the construction process of a kind of people's Smac gene eukaryotic expression vector pcDNA3.1-Smac.

Background technology

Lung cancer occupies first of global malignant tumour sickness rate, the mortality ratio.In China, lung cancer has replaced liver cancer to become the topmost cause of death of malignant tumour, occupies 22.7% of malignant tumour death, and M & M is also rising year by year.At present, about 80% patients with lung cancer has missed best surgical engine meeting when going to a doctor, and adopts conventional chemotherapeutics treatment can not effectively control the incidence and development of lung cancer, therefore, is necessary to explore new gene target spot and effectively treats lung cancer, to improve the prognosis of patients with lung cancer.Be accompanied by developing rapidly of molecular biosciences medical technology, cancer come from the unusual viewpoint of apoptosis conduction path reach common understanding, the gene therapy method that produces therefrom becomes one of important means of treatment cancer day by day.

In recent years discover: Smac (the second mitochondrial-derivedactivator of caspase) gene is through one of important controlling gene of plastosome approach cell death inducing.It is higher at a plurality of normal tissue expressions such as human body testis, heart, liver, spleen, kidney, ovary and prostate glands.And in cancer of the stomach, lung cancer, colorectal carcinoma, ovarian cancer, prostate cancer, rhabdosarcoma, the expression in the malignant tumor tissues such as leiomyosarcoma is all lower, points out it possibly become a kind of suppressor gene of new malignant tumour.Therefore, this gene has important researching value.

Mitochondrial protein Smac (second mitochondria-derived activator ofcaspase) claim again DIABLO (direct IAP binding protein with low PI) be 2000 by Wang ^[1]And Verhagen ^[2]A kind of albumen of finding simultaneously.In the research of cervical cancer, find that it under the apoptotic signal hormesis, is discharged into tenuigenin from plastosome, and combine with IAP, suppress its anti-apoptosis activity, promote the cervical cancer cell effect of apoptosis thereby produce.In order to study the apoptosis-promoting effect of Smac gene pairs lung carcinoma cell, at first need study the expression of Smac gene in lung carcinoma cell, just need a kind of construction process of Smac gene eukaryotic expression vector this moment.

Reference:

[1]Du?C，Fang?M，Li?Y，et.al.Smac，a?mitochondrial?proteinthat?promotes?cytochrome?c-dependent?caspase?activation?byeliminating?IAP?inhibition[J].Cell?2000，102(1)：33-42.

[2]Verhagen?AM，Ekert?PG，Pakusch?M，et?al.Identfiicationof?DIABLO，amammalian?p?rotein?that?promotes?apoptosis?bybinding?to?and?antagonizing?IAP?proteins[J].Cell?2000，102(1)：43-53.

Summary of the invention

The invention discloses the method for a kind of people's of structure Smac gene eukaryotic expression vector pcDNA3.1-Smac; The expression vector transfection that will obtain through present method is to lung cancer A549 cell; The expression in the lung cancer A549 cell after transfection of checking Smac gene is for the apoptosis-promoting effect of further studying Smac gene pairs lung carcinoma cell lays the foundation.

The present invention realizes through following technical scheme:

The construction process of a kind of people's Smac gene eukaryotic expression vector pcDNA3.1-Smac is characterized in that, may further comprise the steps:

(1) from the operation of patients with prostate cancer castration, obtains the normal testis tissue, adopt the TRIzol method from people's normal testis tissue, to extract total RNA;

(2) get the RNA that 0.1 μ g step (1) makes, become cDNA,, carry out pcr amplification Smac gene, behind the amplified production electrophoresis, reclaim the purpose fragment with the high-fidelity enzyme as template with rt test kit rt;

(3) with BamH I, HindIII respectively enzyme cut the target gene fragment that pcDNA3.1 (-) and step (2) make, dna gel reclaims test kit and extracts endonuclease bamhi;

(4) endonuclease bamhi that step (3) is made connects through ligase enzyme, obtains Smac gene eukaryotic expression vector pcDNA3.1-Smac;

(5) preparation competent escherichia coli cell, the carrier that step (4) is made transforms, increases and extracts plasmid.

During said step (2) amplification Smac gene, reaction system is 50 μ L:5 * buffer10 μ L, 2.5mM dNTP 4 μ L, each 1 μ L of upstream and downstream primer, 5U/ μ L, high-fidelity enzyme 0.5 μ L, ddH ₂O 31.5 μ L; Template DNA 2 μ L (＜200ng), amplification condition: 98 ℃ of 10s, 55 ℃ of 15s; 72 ℃ of 1min; 35 circulations, said upstream primer sequence is: 5 '-CGGGATCCCACAATGGCGGCTCTGA-3 ', the downstream primer sequence is: 5 '-CCCAAGCTTGGCCCTCAATCCTCACGC-3 '.

In the said step (3), add BamHI, HindIII respectively at primer 5 ' end, its restriction enzyme site is positioned at primer underscore part: upstream primer: 5 '-CG GGATCCCACAATGGCGGCTCTGA-3 ', downstream primer: 5 '-CCC AAGCTTGGCCCTCAATCCTCACGC-3 '.

Description of drawings:

Fig. 1 is the agarose gel electrophoresis figure of Smac gene RT-PCR amplified production, and M is DNAmarker, and 1 is the Smac pcr amplification product.Smac Gene RT-PCR amplification is the template reverse transcription with total RNA, carries out pcr amplification with the upstream and downstream primer of Smac gene, and amplified production obtains the band of 746bp through the agarose gel electrophoresis analysis, and is consistent with the intended purposes clip size.

Fig. 2 is the agarose gel electrophoresis figure after recombinant plasmid pcDNA3.1-Smac enzyme is cut; M is DNA marker; 1 singly cuts the pcDNA3.1-Smac plasmid for BamH I, and 2 are BamH I, the two pcDNA3.1-Smac plasmids of cutting of HindIII, and 3 singly cut the pcDNA3.1-Smac plasmid for HindIII.Recombinant plasmid pcDNA3.1-Smac 2 bar segment occur behind BamH I, HindIII double digestion, about 750bp and 6000bp, and the endonuclease bamhi size conforms to desired value.

Fig. 3 is Smac gene sequencing figure as a result.

Fig. 4 is Smac gene comparison result figure, and the Smac gene order that BLAST comparison result and GenBank announce is in full accord.

Embodiment

Below in conjunction with specific embodiment the present invention is further described, these embodiment only be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, usually according to the material normal condition, the condition that for example Gene RT-PCR increases or test kit is advised according to manufacturer is used.

One, experiment material:

1, main agents

(1) RT-PCR related reagent

Trizol American I nvitrogen

Rt test kit Japan TaKaRa

High-fidelity PCR test kit Japan TaKaRa

Agarose Spain biowest

Hundred Tykes, ethidium bromide (EB) Beijing

Glue reclaims test kit Japan TaKaRa

BamHI and HindIII restriction endonuclease Japan TaKaRa

Solution1 ligase enzyme Japan TaKaRa

(2) plasmid amplification related reagent

PcDNA3.1 (-) American I nvitrogen

Preserve in intestinal bacteria TOP10 laboratory

Peptone U.S. Gibco

Agar powder U.S. Gibco

Yeast extract U.S. Gibco

Sky, plasmid little extraction reagent kit Beijing root

Remove the little extraction reagent kit of intracellular toxin plasmid U.S. Omega Biotek

(3) cell cultures and transfection related reagent

The A549 Cell Lab is preserved

1640 substratum Hyclone

Foetal calf serum U.S. Gibco

Calf serum U.S. Gibco

Trypsinase U.S. Sartorius

Liposome lipofectamine2000 American I nvitrogen

DMSO Shanghai is general to fly

2, key instrument

(1) laboratory provides equipment

258 of microwave oven U.S.A

Water-bath Japan Nolan company 3751

Electric mixer Japan Nichiryo

The German SIMENS of cryogenic refrigerator (20 ℃～4 ℃)

Accurate micro-adjustable pipette Japan Nichiryo

Electronic balance plum Teller-Tuo benefit instrument (Shanghai) company

Inverted microscope Olympus BH-2

Table model high speed centrifuge Beijing Medical Centrifugal Machine Factory

Constant Temp. Oven Tianjin Tai Site instrument company

Electrothermostat Tianjin Tai Site instrument company

PCR electrophoresis apparatus U.S. BioRad

The table model high speed centrifuge Shanghai medical apparatus and instruments factory of making a leapleap forward

Refrigerated centrifuge U.S. Bekman

Bacteriological incubator U.S. Thermo

Cell cultures Bechtop Suzhou purifies

Microbial culture worktable Suzhou purifies

Microscope Japan Nikon

Gel analysis system U.S. BioRad

Constant temperature microbial culture shaking table Shanghai medical analytical instrument factory

The Tissue Culture Flask laboratory

The spirit lamp laboratory

(2) buy equipment by oneself

Filter net and the rod (disposable) of milling,

EP manages (200 μ l, 1500 μ l)

---30 minutes dresses of high temperature and high pressure steam sterilization box is subsequent use after the DEPC water treatment

Big-and-middle lancet head is some

Erlenmeyer flask, petridish, spreader---30 minutes dresses of high temperature and high pressure steam sterilization box is subsequent use

Frozen pipe, blood counting chamber, 6 orifice plates, 9 orifice plates

One of marker pen is some with the information record

(3) experimental liquid preparation

A, DEPC water

DEPC 1ml, distilled water 1000ml, shaking table shake and spend the night, high temperature high pressure process in the bottle of packing into.

B, RPMI-1640 (1000ml)

One bag RPMI-1640 powder (1000ml), NaHCO ₃1.2g, be dissolved in the 1000ml pure water, the limpid nothing deposition of magnetic agitation to liquid.Filtration sterilization and packing are kept at 4 ℃ of refrigerators.

C, 0.25% pancreatin (1000ml)

0.25g pancreatin fully is dissolved in 100ml PBS liquid, bar magnet stirs 0.5h, filtration sterilization, and-20 ℃ of packing are preserved.

D, Hank ' s balanced salt damping fluid (1000ml)

CaCl20.14g, KCI0.4g, KH2P040.06g, MgCl26H2O 0.1g adds deionized water and is settled to 1000ml, autoclaving, 4 ℃ of preservations.

E, phosphate buffered saline buffer (PBS, 10x, 10 (X) ml)

1 bag PBS powder (1000ml specification) is dissolved in the 1000ml pure water, and the limpid nothing of magnetic agitation to liquid deposition divides to be filled in the 250ml vial, and autoclave sterilization can be preserved a week down for 4 ℃, the frequent autoclave sterilization of need.

F、5×TBE(1000ml)

Tris alkali 54g, boric acid 27.5g, 0.5M EDTA20ml adds deionized water constant volume 1000ml, preserves to normal temperature, and dilution is 10 times during use.

G, sepharose (1%)

Agarose 0.5g, 1 * TBE 50ml, microwave oven high-temperature digestion 1min adds EB 2.5 μ l after being cooled to 50-60 ℃, imports the glue plate, inserts comb.

H, sepharose (2%)

Agarose 1g, 1 * TBE 50ml, microwave oven high-temperature digestion 1min adds EB 2.5 μ l after being cooled to 50-60 ℃, imports the glue plate, inserts comb.

I、1M?CaCl ₂(20ml)

CaCl21.08g, pure water 100ml, the limpid nothing deposition of magnetic agitation to liquid is used the filter filtration sterilization, is kept at-20 ℃ of refrigerators.

J, LB (Luria-Bertain) liquid nutrient medium (100ml)

Sodium-chlor 1g, peptone 1g, yeast extract 0.5g adds pure water to 1L, and branch is filled to the 250ml vial or shakes in the bacterium bottle, and autoclave sterilization is stored in 4 ℃ of refrigerators.

K, LB (Luria-Bertain) solid medium (1000ml)

Sodium-chlor 1g, peptone 1g, yeast extract 0.5g, agar powder 1.6g adds pure water to 1L, and branch is filled to the 250ml vial or shakes in the bacterium bottle, and autoclave sterilization is stored in 4 ℃ of refrigerators or bed board.

Two, experimental procedure:

1, from the operation of patients with prostate cancer castration, obtains the normal testis tissue, adopt the TRIzol method, from people's normal testis tissue, extract total RNA.

(1) 50mg is organized and cuts in taking-up from liquid nitrogen, adds 1ml Trizol liquid and grinds.

(2) the lapping liquid room temperature was placed 5 minutes, added the 0.2ml chloroform then, covered tight centrifuge tube, acutely swayed centrifuge tube 15 seconds with hand.

(3) get the upper strata water in a new centrifuge tube, add the 0.5ml Virahol, room temperature was placed 10 minutes, centrifugal 10 minutes of 12000g.

(4) abandoning supernatant adds 1ml 75% ethanol, vortex mixing, centrifugal 5 minutes of 4 ℃ of following 7500g.

(5) careful abandoning supernatant, room temperature or vacuum-drying 5-10 minute then, add the water that 50 μ l do not have RNase, inhale with the rifle head and beat several times, place for 55～60 ℃ and made the RNA dissolving in 10 minutes.

2, with rt test kit rt RNA, carry out pcr amplification Smac gene, behind the amplified production electrophoresis, reclaim the purpose fragment with the high-fidelity enzyme.

(1) with Takara rt test kit reverse transcription reaction;

Reverse transcription reaction system such as following table:

The reverse transcription reaction condition is: 37 ℃ of 15min, 85 ℃ of 5sec

(2) increase with takara high-fidelity enzyme PCR test kit;

PCR reaction system such as following table:

The condition of pcr amplification Smac full length sequence and confidential reference items β-actin: 98 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 1min, 35 circulations.

Measure PCR degree of purity of production and concentration.

(3) electrophoresis and glue reclaim;

A, encapsulating:

A) take by weighing the 0.9g agarose and add 1 * TAE damping fluid 60ml, in microwave oven, heat 1min;

B) be cooled to 50-60 ℃, add ethidium bromide (EB) 3 μ l to final concentration be 0.5 μ g/ml;

C) solution is imported in the glue groove of oiling comb, room temperature is placed 20-30min, and comb is extracted in adhesive curing;

D) glue is moved into electrophoresis chamber, add the paramount plastic emitting face 1-2mm of 1 * TAE, connect power supply, the point sample hole is a negative pole.

B, application of sample and electrophoresis:

A) add 1 μ l, 6 * sample-loading buffer in the 5 μ l DNA samples, behind the mixing, add in the sample well with micropipet;

B) 100v voltage stabilizing electrophoresis 40min.

C, reclaim test kit with Takara glue and carry out glue and reclaim:

A) under uv lamp, excise the sepharose that contains target DNA and put into 1.5mlEp pipe, (reduce volume as far as possible, avoid being exposed under the uv lamp for a long time);

B) weighing blob of viscose weight is with 1mg=1 μ l volume calculated;

C) the DE-1Buffer solution of 3 gel volumes of adding in blob of viscose.(1.5% glue adds 4 volumes, and 2% glue adds 5 volumes);

D) behind the uniform mixing 75 ℃ the heating 6-10min, and be interrupted the concussion blob of viscose is fully melted;

E) the DR-2Buffer solution of adding 1/2DR-1Buffer volume, uniform mixing;

F) mixed solution is transferred among the Spin Column that is placed in Collection Tube, 12, the centrifugal 1min of 000rpm abandons filtrating;

G) the Rinse A with 500 μ l adds among the Spin Column, and 12, the centrifugal 30sec of 000rpm abandons filtrating;

H) the Rinse B with 700 μ l adds among the Spin Column, and 12, the centrifugal 30sec of 000rpm abandons filtrating;

I) repetitive operation step h);

J) Spin Column is placed on the centrifuge tube of new 1.5ml, adds sterile purified water or the Elution Buffer of 25 μ l in the central authorities of Spin Column film, room temperature leaves standstill 1min.(60 preheatings help to improve elution efficiency);

K) 12, the centrifugal 1min eluted dna of 000rpm.

(4) survey DNA concentration and reclaim the purpose fragment.

3, with BamH I, HindIII respectively enzyme cut the target gene fragment that pcDNA3.1 empty plasmid and step 2 make, dna gel reclaims test kit and extracts endonuclease bamhi.

(1) the PCR design of primers is with synthetic;

Smac gene complete sequence is looked into the DB from the Genbank of NCBI.

1 acttccggcg?tgtgcgtctg?gcgtccgcgc?gctgcacaatggcggctctg?aagagttggc

61 tgtcgcgcag?cgtaacttca?ttcttcaggt?acagacagtgtttgtgtgtt?cctgttgtgg

121 ctaactttaa?gaagcggtgt?ttctcagaat?tgataagaccatggcacaaa?actgtgacga

181 ttggctttgg?agtaaccctg?tgtgcggttc?ctattgcacagaaatcagag?cctcattccc

241 ttagtagtga?agcattgatg?aggagagcag?tgtctttggtaacagatagc?acctctacct

301 ttctctctca?gaccacatat?gcgttgattg?aagctattactgaatatact?aaggctgttt

361 ataccttaac?ttctctttac?cgacaatata?caagtttacttgggaaaatg?aattcagagg

421 aggaagatga?agtgtggcag?gtgatcatag?gagccagagctgagatgact?tcaaaacacc

481 aagagtactt?gaagctggaa?accacttgga?tgactgcagttggtctttca?gagatggcag

541 cagaagctgc?atatcaaact?ggcgcagatc?aggcctctataaccgccagg?aatcacattc

601 agctggtgaa?actgcaggtg?gaagaggtgc?accagctctcccggaaagca?gaaaccaagc

661 tggcagaagc?acagatagaa?gagctccgtc?agaaaacacaggaggaaggg?gaggagc?ggg

721 ctgagtcgga?gcaggaggcc?tacctgcgtg?aggattgagggcctgagcac?actgccctgt

781 ctccccactc?agtggggaaa?gcaggggcag?atgccaccctgcccagggtt?ggcatgactg

841 tctgtgcacc?gagaagaggc?ggcagatcct?gccctggccaatcaggcgag?acgcctttgt

901 gagctgtgag?tgcctcctgt?ggtctcaggc?ttgcgctggacctggttctt?agcccttggg

961 cactgcaccc?tgtttaacat?ttcaccccac?tctgtacagctgctcttacc?catttttttt

1021 acctcacacc?caaagcattt?tgcctacctg?ggtcagagagaggagtcctt?tttgtcatgc

1081 ccttaagttc?agcaactgtt?taacctgttt?tcagtcttatttacgtcgtc?aaaaatgatt

1141 tagtacttgt?tccctctgtt?gggatgccag?ttgtggcagggggaggggaa?cctgtccagt

1201 ttgtacgatt?tctttgtatg?tatttctgat?gtgttctctgatctgccccc?actgtcctgt

1261 gaggacagct?gaggccaagg?agtgaaaaac?ctattactactaagagaagg?ggtgcagagt

1321 gtttacctgg?tgctctcaac?aggacttaac?atcaacaggacttaacacag?gcctcttgtt

1381 ccttcctttc?tttccgtttc?tctattgtat?ccaaaggagaagagtgtaag?attttgtttg

1441 catctgaaag?agaaaatgcg?tctctcctgg?ggtcctaaaaaaaaaaaaaa?aaaaaaaa

According to the Smac sequences Design PCR primer of being found, all primer sequences are synthetic by Shanghai Shen Gong company.

BamHI G^GATCC CCTAG^G

HindIII A^AGCTT TTCGA^A

Smac-P1 5-CGGGATCCCACAATGGCGGCTCTGA-3

Smac-P2 5-CCCAAGCTTGGCCCTCAATCCTCACGC-3

H-actin-p1?5-ATCGTGCGTGACATTAAGGAGAAG-3

H-actin-p2?5-AGGAAGGAAGGCTGGAAGAGT-3

Through blast comparison (http://www.ncbi.nlm.nih.gov/BLAST/), can not there be the non-specific amplification of approximate base number in checking, and is as shown in Figure 7.

(2) amplification of pcDNA3.1 and plasmid extract;

The preparation of A, competent escherichia coli cell:

A) intestinal bacteria TOP10 is coated in dull and stereotyped going up and cultivates, select independent circular mono-clonal bacterium colony, be inoculated in the 5mlLB liquid nutrient medium, 37 ℃ of shaking tables shake and spend the night;

B) draw 0.5ml bacterium liquid and be incorporated in the 50mlLB substratum, 37 ℃ of shaking culture 2h, this moment, bacterium was in logarithmic phase;

C) thalline is moved to the precooling centrifuge tube, place 10min on ice.Under 4 ℃ of conditions, reclaim sedimentary bacterium behind the centrifugal 10min of 800rpm;

D) abandon most supernatant, add 0.1mol/L CaCI2 solution 5ml piping and druming mixing deposition, place 30min on ice.4 ℃ with the centrifugal 10min recovery of 4000rpm cell;

E) abandon clean nutrient solution, add the glycerine of 2ml ice precooling, CaCI2 mixture (0.3ml glycerine+1.7ml 0.05mol/L CaCI2);

F) resuspended thalline.Divide to be filled to the 1.5mlEp pipe, every pipe 200 μ l place-80 ℃ and can preserve half a year.

B, empty plasmid pcDNA3.1 (-) transformed competence colibacillus cell:

A) get 200 μ l competent cells under the aseptic condition, add pDNA3.1 (-) DNA 2 μ l, rotate mixing gently, ice bath 30min (content is no more than 50ng, and volume is no more than 10 μ l, makes when linking of 10 μ l);

B) 42 ℃ of water-bath thermal shocking 90s place 5min on ice rapidly behind the thermal shock;

C) add 1mlLB substratum (not containing Amp), 37 ℃ of constant temperature jolt 45-60min behind the mixing, make bacterium the restore normal growth state and the resistant gene of expression plasmid;

D) 2, the centrifugal 5min of 000rpm abandons supernatant 1ml;

E) get 100 μ l after above-mentioned bacterium liquid is shaken up, evenly coat on the screen plate of Amp (final concentration that the Ampicillin Trihydrate adds LB is 50 μ g/ml, and promptly the Amp of 50 μ l 0.1g/ml adds among the LB of 100ml);

F) forehand face is upwards placed half a hour, treats bacterium fully by after the substratum absorption, and the inversion petridish was cultivated 16-24 hour for 37 ℃;

G) feminine gender is set, positive control (negative control: replace plasmid with zero(ppm) water; Positive control: dull and stereotyped) with not containing antibiotic LB;

H) get the mono-clonal bacterium with the rifle choicest, squeeze in the Erlenmeyer flask of the 50ml LB liquid nutrient medium that contains Amp.Bottleneck is pine slightly, and shaking culture is spent the night;

I) frozen bacterium liquid: 850 μ l bacterium liquid+150 μ l glycerine.

C, from step B bacterium liquid, extract plasmid, use day little extraction reagent kit of root plasmid:

A) column equilibration: the CP3 adsorption column is put into collection tube, and Xiang Zhuzhong adds 500 μ l balance liquid BL, and 12, centrifugal 1 minute of 000rpm outwells the waste liquid in the collection tube, adsorption column is relay reclaim in the collector;

B) get the bacterium liquid of 1-5ml incubated overnight, add centrifuge tube, 12, centrifugal 1 minute of 000rpm, sucking-off supernatant as far as possible;

C) in the centrifuge tube that leaves bacterial sediment, add 250 μ l solution P1, make its thorough mixing with pipettor suspension bacterial precipitation;

D) in centrifuge tube, add 250 μ l solution P2, gentleness spins upside down and makes the abundant cracking of thalline for 6-8 time.Do not want concuss, in order to avoid interrupt DNA, the time was difficult for above 5 minutes;

E) in centrifuge tube, add 350 μ l solution P3, produce white flocks.Gentleness spins upside down 6-8 time immediately, and abundant mixing is in order to avoid localized precipitation.12, centrifugal 10 minutes of 000rpm makes to be deposited in the formation of pipe bottom;

F) supernatant that will go up step collection is transferred among the adsorption column CP3, not the sucking-off deposition.Be inserted in collection tube, 12, the centrifugal 30-60 of 000rpm second outwell the waste liquid in the collection tube, CP3 puts into collection tube with adsorption column;

G) in adsorption column, add 600 μ l rinsing liquid PW, 12, the centrifugal 30-60 of 000rpm second outwell the waste liquid in the collection tube, adsorption column is put into collection tube;

H) repeating step g);

I) 2, centrifugal 2 minutes of 000rpm uncaps and placed several minutes, thoroughly rinsing liquid residual in the adsorption column is removed;

J) adsorption column CP3 is placed a clean centrifuge tube, to the middle part of adsorption film Dropwise 5 0-100 μ l elution buffer EB, room temperature was placed 2 minutes, and 12, centrifugal 1 minute of 000rpm collects plasmid solution in the centrifuge tube;

K) behind the extraction plasmid, survey its concentration.

(3) enzyme of empty plasmid pcDNA3.1 and goal gene Smac is cut;

A, the Smac gene after glue reclaimed, with BamHI, Hi ndIII double digestion:

Endonuclease reaction system such as following table;

Add reagent	Volume
		The PCR product	25μl
10×K?Buffer	4μl
		BamHI	2μl
HindIII	2μl
		Sterilization ddH2O	7μl
Total	40μl

37 ℃ of endonuclease reaction 3h (or spending the night), 60 ℃ of heating 15min make enzyme denaturation.

B, with empty plasmid pcDNA3.1, with BamHI, HindIII double digestion:

1 μ g plasmid adds 1 μ l enzyme and calculates endonuclease reaction system such as following table;

Add reagent	Volume
		Plasmid	20μl
10×K?Buffer	4μl
		BamHI	2μl
HindIII	2μl
		Sterilization ddH2O	12μl
Total	40μl

(4) empty plasmid pcDNA3.1 and goal gene Smac endonuclease bamhi purifying;

Record one 1% sepharose, 80v voltage 50min, electrophoresis enzyme cut back PCR product.Uv lamp downcuts the little gel that contains the purpose band of trying one's best down, reclaims test kit with Takara glue and reclaims purifying.

4, ligase enzyme section makes up and obtains Smac gene eukaryotic expression vector pcDNA3.1-Smac.

Reclaim test kit with dna gel and reclaim purified pcr product, ligation system such as following table:

Add reagent	Volume
		Smac purifying fragment	3μl
PcDNA3.1	1μl
		Solution?I	5μl
Sterilization DD H2O	1μl
		Total	10μl

16 ℃ of ligation 5h obtain Smac gene eukaryotic expression vector pcDNA3.1-Smac, and ligase enzyme is that Solution I or T4 ligase enzyme all can.

5, the amplification of carrier for expression of eukaryon pcDNA3.1-Smac and extraction.

(1) pcDNA3.1-Smac plasmid transformation escherichia coli TOP10 competent cell;

A) get 200 μ l competent cells under the aseptic condition, add pcDNA3.1-Smac DNA 10 μ l, rotate mixing gently, ice bath 30mi n;

D) 2, the centrifugal 5min of 000rpm abandons supernatant 1ml;

H) get a plurality of mono-clonal bacteriums with the rifle choicest, squeeze into respectively in the Erlenmeyer flask of 50ml LB liquid nutrient medium of a plurality of Amp of containing, bottleneck is pine slightly, and shaking culture is spent the night;

I) the frozen bacterium liquid of taking a sample respectively: 850 μ l bacterium liquid+150 μ l glycerine;

J) the bacterium liquid with different mono-clonal microbial culture send order-checking, preserves the frozen bacterium liquid of successful connection.

(2) from bacterium liquid, extract plasmid pcDNA3.1-Smac (omega removes the little extraction reagent kit of intracellular toxin plasmid);

A) above-mentioned bacterium liquid 10-15ml is packed in the 15ml centrifuge tube, centrifugal 10 minutes of 4000 * g is with precipitum under the room temperature;

B) pour out substratum, in deposition, add 500 μ l Solution/RNaseA liquid, bacterium is suspended fully with pipettor;

C) suspension moves to the 2ml centrifuge tube, adds 500 μ lSolution, puts upside down mixing gently 10-15 time;

D) add 250 μ l ice bath BufferN3, gentleness turns upside down centrifuge tube for several times, forms white precipitate;

E)＞centrifugal 10 minutes of 12,000 * g room temperature;

F) supernatant is poured in the new 1.5ml centrifuge tube, added the ETR blue solution of 0.1 times of volume, put upside down test tube for several times, ice bath 10 minutes;

G) above-mentioned lysate is 42 ℃, and is 5 minutes, muddy again.Centrifugal 3 minutes of 12000 * g, ETR solution will be in test tube bottom layering;

H) supernatant is moved to another new 2ml test tube, add the absolute ethyl alcohol of 1/2 volume, put upside down 6-7 time gently, room temperature was placed 1-2 minute;

I) get a clean HiBind Mini columns and be contained on the collection tube, suct clearly 700 μ l to post, room temperature 10000 centrifugal 1 minute;

J) abandon filtrating, filter remaining supernatant, centrifugal;

K) abandon filtrating, add 500 μ l HB Buffer, centrifugal 1 minute of 10,000 * g removes albumen;

L) abandon filtrating, add 700 μ l DNA Wash Buffer (to use alcohol dilution), centrifugal 1 minute of room temperature 10,000 * g abandons filtrating;

M) repeat 1);

N) room temperature centrifugal＞the centrifugal void column of 13,000 * g 2 minutes, remove ethanol;

O) pillar is put in the new 1.5Ep pipe, adds 80-100 μ l Elution Buffer.Room temperature left standstill 2 minutes.＞13, centrifugal 1 minute of 000 * g can get 70-85%DNA.

But the pcDNA3.1-Smac direct transfection cell that obtain this moment.

Among the present invention, primer design is followed following principle:

1, primer length is 15-30bp, and is commonly used for about 20bp.Sufficiently long primer has guaranteed that sequence is unique, and reduces with other fragment bonded possibilities in the sequence.But length is long, such as greater than 24 bases but and do not mean that specificity is higher.Long sequence is hybridized with mismatch sometimes, thereby has reduced the specificity of primer, and long sequence annealed is slower, and goal gene amplification output is reduced.

2, primer amplification zone, routine is advisable with 200-500bp, and specified conditions can increase down and grow to the fragment of 10kb.

3, avoid between primer inside and primer, having complementary sequence as far as possible, reduce joint efficiency in order to avoid primer self combines with template.

4, selecting GC content is 40% to 60%, too high or too lowly all is unfavorable for combining of primer and DNA.A, T, G, four best stochastic distribution of base of C avoid purine or pyrimidine bunchiness more than 5 to arrange as far as possible.

5, design intermediate zone 5 ' end is the primer of C or G.Primer is increased with the stability of aim sequence hybridization and primer.

6, avoid the pairing of 3 ' terminal bases to make a mistake.Because template combines with 3 ' terminal nucleosides and extends along this direction amplification.

7, avoid 3 ' end to be rich in GC.Need guarantee during design of primers 3 A or T at 5 nucleosides at least significant end.

8, avoid 3 ' end the complementary sequence of primer to occur, otherwise might form primer dimer, thereby suppress pcr amplification.

The concentration of every primer is given birth to needed result with lower primer volume production and get final product between 10～100pmol to 0.1～1umol, may cause mispairing and produces non-specific amplification when primer concentration is higher, and can increase the chance of primer dimer formation.

Sometimes, primer 5 ' end can add the non-existent sequence of script on some aim sequences, such as promotor, and restriction site etc., this does not influence specificity of primer and combines with template.Need to detect the inside secondary structure and the primer complementarity of full sequence, but when calculating the Tm value, can not comprise these sequences.Understand under the infull situation at sequence information,, can design degenerate primer as only knowing aminoacid sequence.Various different possibly base mixing of certain occurrence of amino acid are about to encode.Can use table through reference password number, increase primer specificity.Will not annex the base design at 3 ' end at primer, make a mistake in the site because the combination of 3 ' terminal last several bases may make amplification.And to reduce merger property as far as possible, use preference with the base that adapts to different biological sequences.In addition, note primer concentration, because the primer in many merger mixtures is not exclusively to the goal gene template, so need to use higher primer concentration (1 μ M is to 3 μ M) assurance annealing normally to carry out.

Among the present invention; Pcr amplification is divided into sex change-annealing-three steps of extension, adopts three temperature spot methods to accomplish PCR:1. usually and unwinds 90～95 ℃ of double-stranded DNA sex change, 2. is cooled to 40～60 ℃ of annealing rapidly; Primer is attached on the corresponding site of target sequence; 3. be rapidly heated to 70～75 ℃, through the catalysis of Taq archaeal dna polymerase, primer strand is pressed the base complementrity pairing along template and is extended.Sometimes adopting two temperature spot method pcr amplification length is the shorter target gene of 100～300bp, and wherein, 94 ℃ of denaturation temperatures are constant, will anneal can unite two into one with elongating temperature, and about about 65 ℃, this moment, Taq DNA enzyme still had greater activity.

1, denaturation temperature and time: if denaturation temperature is low excessively, can causes and unwind not exclusively that this is one of main reason that causes the PCR failure.Common 93 ℃～94 ℃, the template DNA sex change was unwind in 1 minute, also can be lower than 93 ℃ of time expands.But can not use excessive temperature, because too high temperature can make the activity of enzyme be affected.If can not make the complete sex change of template DNA, will cause the pcr amplification failure.

2, annealing temperature and time: annealing temperature also is one, and to influence PCR specific than important factor.Because template DNA is complicated more more than primer, temperature is quickly cooled to 40 ℃～60 ℃ after sex change, and collision bonded probability combines height a lot of than the collision between the template complementary strand between primer and the template, thereby is easy to make primer and template to combine.Annealing temperature and time, depend on several factors: comprise the length of target motif row, the based composition of primer, length, concentration etc.Tm value and annealing temperature can be calculated through following formula:

Tm value (melting temperature(Tm))=4 (G+C)+2 (A+T)

Renaturation temperature=Tm value-(5～10 ℃)

Such as: account for the primer of 20 half the Nucleotide for G+C content, the starting point of right annealing temperature can be 55 ℃.

Higher renaturation temperature can reduce nonspecific combination the between primer and template, but must in Tm value allowed band, select, and makes the specificity of PCR reaction be improved.Be combined into the conventional annealing time fully between 30-60 primer second and the template.Two primers should have proximate Tm value, more are prone to obtain optimum.When differing, the Tm of two primers surpasses 5 ℃, if use lower annealing temperature in circulation is initial, to make mistakes.Can carry out 5 circulations earlier,, carry out remaining circulation according to the annealing temperature of low Tm design then according to the annealing temperature of higher Tm.Like this, under comparatively tight condition, can obtain the purpose template amplification preferably.

Formula only provides the Tm value of an estimation, and annealing temperature is a starting point that experiment is groped.In carrying out for the first time the target gene PCR experiment, can carry out the pcr amplification of annealing temperature gradient.Minimum annealing temperature is Tm-5 ℃ of estimation, with 2 ℃ be incremental change, progressively improve annealing temperature, general 5-6 Grad gets final product.

3, the temperature commonly used of the extension of elongating temperature and time: PCR reaction is 72 ℃, is typically chosen between 70～75 ℃ to get final product.It is slow excessively that elongating temperature is crossed low extension, and the too high primer that is unfavorable for of temperature combines with template.The BA of Taq archaeal dna polymerase: 55 ℃, 24 Nucleotide/S/ enzyme molecule; 70 ℃ of 60 Nucleotide/S/ enzyme molecules; 70～80 ℃ of 150 Nucleotide/S/ enzyme molecules; When being higher than 90 ℃, DNA is synthetic almost can not to carry out.According to the length of the amplified fragments decision PCR extension time, generally extend time 1min and can increase 1Kb, can the increase fragment of 3～4kb of 3～4min, the amplification 10-15min long segment about 10Kb that can increase with interior dna fragmentation.The concentration of template is low excessively, needs to prolong proliferation time, but extends overlong time, the non-specific amplification band can occur, thereby influence the PCR reaction result.

Among the present invention, concentration of reactants will be noted the following aspects:

1, enzyme and concentration thereof: the Taq archaeal dna polymerase in two kinds of sources is arranged at present, and a kind of genetically engineered enzyme is the colibacillus synthetic, and another kind is that natural enzyme purifies from the living bacillus of hot water.The concentration of enzyme is suitable, and concentration is crossed low then synthetic product amount and reduced, and too highly can cause non-specific amplification again.The PCR reaction that general catalyzed reaction volume is 100ul needs enzyme amount 2.5U approximately.

2, the quality of dNTP and concentration: quality and the concentration of pcr amplification efficient and dNTP are closely related; When dNTP solution uses; Should be made into high density with 1M NaOH or 1M Tris earlier, the damping fluid with HCl is adjusted to 7.0～7.5 with its PH again, is stored in-20 ℃ of refrigerators after the packing in a small amount.The dNTP powder is particulate state and is prone to prolonged preservation, but also can sex change lose BA as preservation is improper.The volumetric molar concentration of 4 kinds of dNTP in the PCR reaction will equate that the meeting higher or on the low side of any concentration causes mispairing, and total dNTP is about 50～200umol/L, and mistake participated in when excessive concentration can promote to extend, and crosses the low output that then can cause and reduces.

3, the concentration of primer: primer concentration is 0.2-1 μ mol/L in the general PCR reaction system, and PCR product amount is basic identical in this scope.Primer concentration is too high can to promote the primer misguidance, causes non-specific amplification, also can increase primer dimer and form; When primer concentration is lower than 0.2 μ mol/L, PCR output can descend.Non-specific amplification and primer dimer can be used as the substrate of PCR reaction again, with target sequence competitor dna polysaccharase and dNTP substrate, thereby target sequence amplification amount are reduced.Can promptly confirm primer concentration through measuring OD260 at the OD value of 260nm.

4, Mg2+ concentration: Mg2+ influences the activity of the archaeal dna polymerase of PCR, and primer annealing can remarkable influence output and specificity.In general PCR reaction, Mg2+ concentration is that 0.5～2.5mmol/L is advisable.Mg2+ concentration is crossed the low activity of Taq archaeal dna polymerase that can make and is reduced, and reduces reaction product.Excessive concentration can increase output, reduces atopic, non-specific amplification occurs, reduces fidelity.DNTP and template combine with mg ion, have reduced the amount of the needed free mg ion of enzymic activity.To all different with template, the typical PCR initial concentration that still comprises 200 μ M dNTP is 1.5mM to best magnesium ion concentration for different primers.If there is EDTA in the solution, living has other inner complexs or dna profiling in the primer storage liquid, can disturb Mg2+ effective concentration, needs this moment Mg2+ to improve consumption.

The present invention adopts RT-PCR amplification Smac gene, and makes up recombinant eukaryon expression vector pcDNA3.1-Smac through collecting the human body normal testis tissue that 1 routine patients with prostate cancer castration operation is excised.In building process; During design primer amplification Smac full length gene; Need to insert before the initiator codon respectively two restriction enzyme sites and protection base and after the terminator codon; To note simultaneously two restriction enzyme sites front and back orders should with plasmid enzyme restriction site sequence consensus, insert empty carrier to guarantee Smac gene forward.Simultaneously, during the long PCR primer of design product, be difficult to avoid forming primer dimer or the inner hairpin structure of primer, need improve the formation that the Tm value reduce primer dimer when annealing or hairpin structure this moment through the proper extension primer.In addition; The used carrier for expression of eukaryon pcDNA3.1 of the present invention (-) is initial transcribing under human cytomegalic inclusion disease virus promotor (CMV) control; Contain the polyclone restriction enzyme site, translate enhanser, BGH Transcription Termination and critical elements such as polyA tailing signal, ammonia benzyl and Xin Meisu opposing gene, be a carrier that can in mammalian cell, efficiently express and be easy to screen.

The gene table

< 110>Fu Jianfang is coated with sunshine and pays the chrysanthemum virtue

< 120>gene order of anti-vibrio alginolyticus idiotype monoclonal antibodies variable region

<160>2

<210>vh\vl

<211>123\113

<212>DNA；

< 213>artificial sequence

<220>

<221>intron

<222>(1)...(371)\(1)...(339)

<400>vh

1?CG?GCC?GAG?GTG?AAG

15?CTG?AAG?GAG?TCT?GGG?GCT?GAG?CTG?GTA?AGG?CCT?GGG?ACT?TCA?GTG

60?AAG?GTG?TCC?TGC?AAG?GCT?TCT?GGA?TAC?GCC?TTT?ACT?AAT?TAC?TTG

--------------CDR1------------

105?ATA?GAG?TGG?GTA?AAG?CAG?AGG?CCT?GGA?CAG?GGC?CTT?GAG?TGG?ATT

-----

150?GGA?GTG?ATT?AAT?CCT?GGA?AGT?GGT?GGT?ACT?AAC?TAC?AAT?GAG?AAG

------------------------CD2---------------------------

195?TTC?AAG?GGC?AAG?GCA?ACA?CTG?ACT?GCA?GAC?AAA?TCC?TCC?AGC?ACT

-----------

240?GCC?TAC?ATG?CAG?CTC?AGC?AGC?CTG?ACA?TCT?GAT?GAC?TCT?GCG?GTC

285?TAT?TTC?TGT?GCA?AGA?GGG?CGG?TTC?CCC?CAT?TAC?TAT?GCT?ATG?GAC

------------------CDR3-----------------

330?TAC?TGG?GGT?CAA?GGA?ACC?TCA?GTC?ACC?GTG?TCG?ACA?GGT?GGA?371

<400>vl

1?GAC?ATC?CAG

10?ATG?ACA?CAG?ACT?CCA?CTC?TCC?CTG?CCT?GTC?AGT?CTT?GGA?GAT?CAA

55?GCC?TCC?ATC?TCT?TGC?GGA?TCT?AGT?CAG?AGC?CTT?GTA?CAC?AGT?AAT

-------------------------CDR1---------

100?GGA?AAC?ACC?TAT?TTA?CAT?TGG?TAC?CTG?CAG?AAG?CCA?GGC?CAG?TCT

---------------------

145?CCA?AAG?CTC?CTG?ATC?TAC?AAA?GTT?TCC?AAC?CGA?TTT?TCT?GGG?GTC

-------------CDR2---------

190?CCA?GAC?AGG?TTC?AGT?GGC?AGT?GGA?TCA?GGG?ACA?GAT?TTC?ACA?CTC

235?AAG?ATC?AGC?AGA?GTG?GAG?GCT?GAG?GAT?CTG?GGA?GTT?TAT?TTC?TGC

280?TCT?CAA?AGT?ACA?CAT?GTT?CCG?CTC?ACG?TTC?GGT?GCT?GGG?ACC?AAG

---------------CDR3---------------

325?CTG?GAG?CTG?AAA?CGT?339

Claims

1. the construction process of a people Smac gene eukaryotic expression vector pcDNA3.1-Smac is characterized in that, may further comprise the steps:

2. the construction process of a kind of people's according to claim 1 Smac gene eukaryotic expression vector pcDNA3.1-Smac; It is characterized in that: during step (2) amplification Smac gene, reaction system is 50 μ L:5 * buffer10 μ L, 2.5mM dNTP 4 μ L; Each 1 μ L of upstream and downstream primer; 5U/ μ L, high-fidelity enzyme 0.5 μ L, ddH ₂O 31.5 μ L; Template DNA 2 μ L (＜200ng), amplification condition: 98 ℃ of 10s, 55 ℃ of 15s; 72 ℃ of 1min; 35 circulations, said upstream primer sequence is: 5 '-CGGGATCCCACAATGGCGGCTCTGA-3 ', the downstream primer sequence is: 5 '-CCCAAGCTTGGCCCTCAATCCTCACGC-3 '.

3. the construction process of a kind of people's according to claim 1 Smac gene eukaryotic expression vector pcDNA3.1-Smac; It is characterized in that: in the step (3); Add BamHI, HindIII respectively at primer 5 ' end, its restriction enzyme site is positioned at primer underscore part: upstream primer: 5 '-CG GGATCCCACAATGGCGGCTCTGA-3 ', downstream primer: 5 '-CCC AAGCTTGGCCCTCAATCCTCACGC-3 '.