CN107365384A - A kind of targeting Reg3A single-chain antibody - Google Patents

Abstract

The invention provides a kind of single-chain antibody of energy specific recognition Reg3A albumen, including the weight of the albumen, the nucleotide sequence and amino acid sequence of light chain variable district are encoded, and determine the CDR region of antibody specificity.The present invention by phage antibody library filter out targeting Reg3A albumen high-affinity single-chain antibody, then by build, express, purify acquisition Reg3A single-chain antibodies.The Reg3A single-chain antibodies of the present invention can be specifically bound with Reg3A, therefore can treat or detect related disease excessive to Reg3A expression, abnormal.

Description

A kind of targeting Reg3A single-chain antibody

Technical field

The invention belongs to biological technical field, and in particular to a kind of screening of targeting Reg3A single-chain antibodies, light and heavy chain can Become the acquisition of region sequence, the structure of expression vector, the preparation of Reg3A single-chain antibodies, the measure of affinity and its biological activity Checking.

Background technology

Reg family proteins, full name are Regenerating protein family (Reg), are in research pancreatitis and pancreas Found in the breeding of island.Reg families belong to Ca-dependent phytolectin superfamily, and C-terminal carries a calcium type aggegation Plain spline structure domain (C-type lectin domain), N-terminal contain the signal peptide of individual amino acid composition about more than 20.According to Reg bases Because of the primary structure of encoding proteins, Reg families can be divided into 4 hypotypes (I, II, III, IV), and they have similar gene knot Structure, containing 5 intrones and 6 extrons, TATA boxes and CCAAT boxes are located at 27 and 100bp of transcription initiation site upstream Place, the secretory protein that 158~175 amino acid lengths of coding do not wait.The albuminoid includes the signal peptide of 22 amino acid compositions And 1 conservative Ca-dependent hydrocarbon identification domain.

Reg3A is regenerated protein Reg family members, and positioned at human chromosome 2P12.11, the position in human genome is Between nt79347594-m80875993.Reg3A full length gene 2747bp, possess 3 mRNA shearing mutant, coded sequence phase The same secreted protein factor.The signal peptide molecule of 26 amino acid lengths of Reg3A protein N terminals main code, its three-level structure What picture analysis showed has the domain of polysaccharide binding function mainly in C-terminal, and family is similar with c-type agglutinant protein.

Reg3A expressions in gastroenteric tumor cell are too high, can promote the propagation of tumour cell, and Reg3A Height expression is higher with tumor size, differentiation degree and neoplasm staging correlation, and makes the reduction of patient's survival rate.Pass through structure Colon cancer (CRC) cell line --- LoVo, RKO of Reg3A gene knockouts, propagation capable of inhibiting cell, increase G1 phase cell colonys And apoptosis rate, significantly inhibit cell migration and invasion and attack, Reg3A is overexpressed activation AKT and ERK1/2 paths, improve AKT and ERK1/2 phosphorylations, so as to promote CRC tumorigenic pathways.Reg3A high expression can promote the invasion and attack and migration of liver cancer cells, Hepatic carcinoma tissue is proved by SABC (IHC), real-time quantitative PCR (RT-PCR) and Western blotting (Western blot) Middle Reg3A expression is higher than neighbouring non-cancer tissue, and by stages relevant with vascular invasion with late tumor, passes through specific siRNA Silence Reg3A expression can be observed, and liver cancer cell lines Huh7 and Hep3B migration substantially weaken with invasive ability.

Winter in 1994 et al. creates phage antibody library technique, is most ripe, most widely used so far The technology of antibody is prepared, Antibody library provides good technology platform for the screening of human antibody, and it is different from monoclonal antibody Necessary hybridoma technology in development, it is not necessary to can obtain various antibody genes and Antibody molecule fragments by immunologic process. The peripheral blood of employment prepares antibody library, and different specific antibody or the expression of its function fragment (Fab, Fv, ScFv) are being bitten Phage surface, the carrier of expression product is carried out with immobilization antigen to wash in a pan sieve, taken turns " absorption-washing-elution-amplification " by number Process, until obtaining high-affinity, high specificity antibody.

The content of the invention

Goal of the invention：

The object of the invention one is to provide a kind of heavy chain and light chain variable district nucleotides sequence of targeting Reg3A single-chain antibodies Row.

The object of the invention two is to provide a kind of heavy chain and chain variable region amino acid sequence of targeting Reg3A single-chain antibodies Row.

The object of the invention three is to provide a kind of targeting Reg3A single-chain antibodies with potential medical science and pharmacy value.

The detailed description of the present invention：

The invention provides the screening of targeting Reg3A single-chain antibodies, encodes the nucleic acid and amino acid sequence of this antibody, targets The structure of Reg3A single-chain antibodies, preparation method, the checking of affinity measure and its biological activity.

In one embodiment, the invention provides specific binding Reg3A single-chain antibody, it is characterised in that：

The heavy chain of antibody variable region provided and chain variable region gene such as SEQ ID NO：Shown in 1~16；There is provided Heavy chain of antibody variable region and chain variable region amino acid sequence such as SEQ ID NO：Shown in 17~32.

In one embodiment, the invention provides a kind of sonioation method, for isolating and purifying above-mentioned antibody.

In one embodiment, the invention provides a kind of biomembrane interference technique, for detecting the affinity of antibody.

The present invention relates to high-affinity specific binding Reg3A single-chain antibody, including but not limited to single-chain antibody.In reality Apply in scheme, antibody of the invention includes specific architectural feature, such as includes the CDR region of specific amino acid sequence.

In embodiments, antibody of the invention is recombinant protein, protein isolate matter or substantially pure protein.Point From the protein material that it is generally combined in native state at least with some, depending on situation, the protein of separation It may make up 5% to 99.9% (by weight) of total protein content.

In one embodiment, antibody of the present invention can specifically bind Reg3A albumen, suppress high expression The growth of Reg3A albuminous cells.

Beneficial effect：

The high expression in colon cancer cell of 1.Reg3A albumen, can be obviously promoted propagation, invasion and attack and the migration of tumour cell, Apoptosis is resisted, aggravates the undifferentiated degree of cancer cell, and promotes tumour cell to produce tolerance to chemotherapeutics.Therefore, it is special The opposite sex blocks the single-chain antibody of Reg3A protein functions to possess antineoplastic action in theory.

It is to be to specifically bind the characteristics of antibody drug 2. application development of the antibody drug in antitumor field is rapid Target antigen, close target molecule function or killing target cell.Single-chain antibody is as genetic engineering antibody of new generation, in closed protein matter There is great superiority in terms of molecular function.Therefore, the Reg3A albumen of tumour high-expression is identified using single-chain antibody, and then It is feasible to suppress Reg3A protein functions.

Brief description of the drawings

Fig. 1 is with screening statistical chart of the phage antibody library to Reg3A scFv.Wherein Figure 1A is described in screening process, and four Take turns the statistics block diagram of the rate of recovery；Figure 1B describes the bacteriophage monoclonal Elisa block diagrams of screening.

Fig. 2 is IMGT-VQUEST database analysis Reg3A scFv V_HAnd V_LCDR region gene order.Wherein Fig. 2A is retouched That state is Reg3A scFv V_HCDR region gene order；Fig. 2 B describe Reg3A scFv V_LCDR region gene order.

Fig. 3 is the structure electrophoretogram that Reg3A scFv express engineering bacteria.Wherein Fig. 3 A are that PCR expands Reg3A scFv bases Cause, swimming lane M are DNA Marker, and swimming lane 1,2 is that PCR expands Reg3A scFv genes, and gene size is about 750bp.Fig. 3 B are Reg3A scFv genes insert pET-22b expression plasmid figure.

Fig. 4 is the SDS-PAGE figures of Reg3A scFv expression.Swimming lane M is standard molecular weight albumen, and swimming lane 1 induces for IPTG Preceding bacteria liquid sample, swimming lane 2 are the bacteria liquid sample after IPTG inductions, and swimming lane 3 is collection liquid before loading, and swimming lane 4 is 150mM imidazoles Eluent washes post collection liquid.

Affinity of the Fig. 5 between BLI technology for detection Reg3A scFv and Reg3A albumen.Various concentrations are described in figure Affinity between the Reg3A scFv and Reg3A of (650nM, 433nM, 288nM, 192nM), is finally given by data analysis Kd be 4.4 × 10^-10。

Fig. 6 is that MTT detects the line chart that Reg3A scFv suppress LoVo growth of tumour cell.Various concentrations are described in figure The growth inhibition ratio of (0nM, 30nM, 60nM, 125nM, 250nM, 500nM) to LoVo cells.

Embodiment

To enable the above-mentioned purpose of the present invention, feature more obvious understandable, below to the embodiment of the present invention It is described in detail.

The phage antibody library of embodiment 1 screens anti-Reg3A single-chain antibody

1. antigen Reg3A

The Reg3A albumen (Q06141-1) that the present invention uses is purchased from the limited public affairs of Yi Qiao Divine Land, Beijing biotechnology, contains 175 Individual Amino acid profile, purity ＞ 97%.

2. prepare the e. coli host bacteria TG1 with sex pili

By TG1 out of glycerine cryopreservation tube plate streaking, be inoculated in M9 culture medium flat plates, 37 DEG C are inverted culture 36h.Picking list Colonies, it is seeded in 5ml 2 × YT culture mediums, 37 DEG C of shaking table cultures are stayed overnight.Second day, 1/100 dilution was inoculated in fresh 2 × YT culture mediums in, 37 DEG C of shaking table cultures to logarithmic phase (OD₆₀₀For 0.4~0.6), then infect bacteriophage.

3. prepare helper phage

Helper phage is added to (OD in 200 μ L TG1 bacteria culture fluids₆₀₀For 0.5), after 37 DEG C of water-baths 30 minutes, add Enter in the H-TOP agar (42 DEG C) melted to 3mL, be then layered on the TYE flat boards of warm, 37 DEG C of overnight incubations after cooling.Choose Take single bacterium colony to be inoculated into 3~4mL to be in the TG1 cultures of logarithmic phase, 37 DEG C of shaking table culture 2h.Be transferred to 500mL 2 × In TY fluid nutrient mediums (2L shaking flasks), continue cultivate 1h, then add the 25mg/mL kanamycins aqueous solution, to final concentration 50~ 70 μ g/mL, continue 8~16h of culture.10800g, 4 DEG C centrifuge 15 minutes, collect supernatant, add 1/5 volume PEG/NaCl (20% PEG, 2.5mol/LNaCl), place 30 minutes on ice.10800g again, 4 DEG C centrifuge 15 minutes, and precipitation is resuspended in 2mL PBS and delayed In fliud flushing, 0.45 μm of membrane filtration is degerming.Titre is determined, is diluted to 1 × 10¹²p.f.u/mL。

4. expand phage antibody library

A. the phage antibody library (about 1 × 10 for taking 1mL to preserve¹⁰P.f.u) it is inoculated into 500mL 2 × TY culture mediums (containing 100 μ g/mL ampicillins and 1% glucose).37 DEG C of shaking table cultures are to logarithmic phase (OD₆₀₀For 0.4~0.6), about 1.5~2h.

B. 25mL nutrient solutions (about 1 × 10 are taken¹⁰Individual bacterium), infected with helper phage VCS-M13.Infection proportion is thin Bacterium number/helper phage number=1/20.In 37 DEG C of water-baths, 30min is stood.3300g, 4 DEG C of centrifugation 10min, precipitation is resuspended (contain 100 μ g/mL ampicillins and 25 μ g/mL kanamycins) in 30mL 2 × TY culture mediums.Above-mentioned bacterium solution is added (contain 100 μ g/mL ampicillins and 25 μ g/mL kanamycins) into 470mL 2 × TY culture mediums of 37 DEG C of pre-temperatures, 30 DEG C of shaking table cultures are stayed overnight.

C.10800g, 4 DEG C of centrifugations 10min or 3300g, 4 DEG C of centrifugation 30min.Supernatant is collected, adds 1/5 volume PEG/ NaCl (20%PEG, 2.5mol/L NaCl), 4 DEG C of placement 1h after being thoroughly mixed.10800g again, 4 DEG C of centrifugation 10min, precipitation It is resuspended in 40mL water and 8mL PEG/NaCl (20%PEG, 2.5mol/L NaCl).10800g, 4 DEG C of centrifugation 10min or 3300g, Centrifugation supernatant is abandoned in 4 DEG C of centrifugation 30min, suction.Precipitation is resuspended again, again 10800g, 4 DEG C of centrifugation 10min, thoroughly inhales and abandon supernatant.

D. precipitation is resuspended in 5mL PBS, 11600g, centrifuges 10min, remove bacterial debris (precipitation).

5. screening that solid phase is affine

A. take 4mL CBS dilute albumen (the 1st to the 5th wheel elutriation immobilized antigen concentration be respectively 80,80,40,25, 15 μ g/mL), it is added in immunotubes, room temperature coating is overnight.

B. supernatant is abandoned, washes pipe rapidly with PBS 3 times.3%BSA-PBS, 37 DEG C of closing 2h are filled in immune pipe.Abandon confining liquid, Rinse immune pipe rapidly with PBS 3 times.By phage antibody library (10¹²~10¹³P.f.u) it is added in immune pipe, adds 3% BSA to 4mL,.After room temperature reverses 30min repeatedly, in being stored at room temperature more than 90min,

C. when carrying out first round screening, pipe is washed 10 times with the PBS containing 0.1%Tween-20, then pipe is washed 10 times with PBS Remove detergent.The later screening of second wheel, washing the increase of pipe number, (second to fourth round elutriation is 20 times, and the 5th wheel is 30 It is secondary).After PBS is blotted, adding 1mL 100mmol/L triethylamines, [700 μ L triethylamines (7.18mol/L) are added to 50mL water In], room temperature is reversed repeatedly is incubated 10min, carries out specific elution.

D. the bacteriophage specifically eluted is neutralized rapidly with 0.5mL 1mol/L Tris-HCl (pH7.4).After neutralization Bacteriophage can it is direct 4 DEG C preserve or for infecting TG1 bacterium.Added into immune pipe in 200 μ L 1mol/L Tris (pH7.4) With remnants bacteriophage.Take 9.25mL to be in the TG1 bacterial cultures of logarithmic phase to mix with the bacteriophage that 0.75mL is eluted, 4mL is added into immune pipe in addition and is in logarithmic phase TG1 bacterial cultures.37 DEG C of water-baths stand 30min simultaneously for both.

E. 100 μ L are taken respectively from the two kinds of TG1 for having infected bacteriophage bacterial cultures, and do respectively 4~5 times 100 times It is serially diluted, the bacteriophage coating TYE flat boards of grade dilution (is then contained into 100 μ g/mL ampicillins and 1% grape Sugar), 37 DEG C of overnight incubations.The remaining two kinds TG1 bacterial cultures 3300g for having infected bacteriophage, 4 DEG C centrifuge 10min, thalline Precipitation is resuspended in 1mL 2 × TY culture mediums, and spreading large-scale TYE flat boards using Nunc Bio-Assay Dish (contains 100 μ g/mL Ampicillin and 1% glucose).Until there is the visible clone of naked eyes in 30 DEG C of overnight incubations.

F. 5mL is added into the Nunc Bio-Assay Dish flat boards for cover with bacterial clone and contains 15% 2 × TY of glycerine trainings Support base and scrape bacterium with glass spreading rod and collect thalline suspension.100 μ L thalline suspensions are taken to be added to 2 × TY of 100mL cultures (contain 100 μ g/mL ampicillins and 1% glucose) in base, 37 DEG C of shaking table cultures to OD₆₀₀≈ 0.5 (about 2h).

G. helper phage VCS-M13 infection is added, infection proportion number is bacterial population/helper phage number=1/20.37 DEG C water-bath stands 30min.By bacterium solution 3300g, 4 DEG C of centrifugation 10min, bacterial sediment, which is resuspended in 50mL 2 × TY culture mediums, (to be contained There are 100 μ g/mL ampicillins and 25 μ g/mL kanamycins).30 DEG C of shaking table cultures are stayed overnight.

H. 40mL overnight cultures, 10800g, 4 DEG C of centrifugations 10min or 3300g, 4 DEG C of centrifugation 30min are taken.Collect supernatant, 1/5 volume PEG/NaCl (20%PEG, 2.5mol/L NaCl) is added, 4 DEG C of placement more than 1h after being thoroughly mixed.Again 10800g, 4 DEG C of centrifugation 10min, precipitation are resuspended in 40mL water and 8mL PEG/NaCl.10800g, 4 DEG C centrifugation 10min or Supernatant is abandoned in 3300g, 4 DEG C of centrifugation 30min, suction.Precipitation is resuspended in 2mL PBS, 11600g, 4 DEG C of centrifugation 10min, is removed as far as possible Bacterial debris.The 4 DEG C of preservations of 1mL bacteriophages are taken, another 1mL bacteriophages are used for the affine screening of next round.

6. the four-wheel of table one screens the rate of recovery

Number of screening round	1	2	3	4
					Input titre	2×1013	3×1013	7×1012	4×1013
Export titre	3×105	4×106	6×107	1.2×109
					The rate of recovery	1.5×10-8	1.3×10-7	8×10-6	3×10-5

7. monoclonal phage ELASA

A. 95 plants of area monoclonal bacterial strain and blank control (only plus culture medium) are chosen at random from the flat board of the 5th wheel to 96 hole U In type Bacteria Culture plate, 37 DEG C of overnight incubations.The μ L of bacterium solution 2 are taken out per hole, are added in another block of 96 new hole Bacteria Culture plates； After 37 DEG C of culture 1h, the μ L of 2 × TY-AG culture mediums 25 and 1 × 10 are added per hole⁹Pfu helper phages VCS-M13；It is quiet at 37 DEG C Only after 30min, shaking table culture 1h.1800 × g centrifuges 10min, abandons supernatant.Bacterial sediment is resuspended in 200 μ L 2 × TY- In AG culture mediums, 30 DEG C of shaking table cultures are stayed overnight.1800 × g centrifuges 10min, takes the μ L of supernatant 100 to be tested for ELISA.

B. 10 μ gmL are coated with^-1Antigen, (37 DEG C of closing 2h) is closed with 3%BSA-PBS, after washing 3 times with PBS, often Hole corresponds to the μ L of supernatant (using BSA as negative control) 100 added in a respectively, and room temperature places 90min；PBST (contains 0.5% Tween-20 PBS) and PBS wash respectively 3 times, add the goat-anti M13 polyclonal antibodies 100 μ L of 1: 5000 dilution per hole, 37 DEG C Place 90min；PBST and PBS is washed 3 times respectively, does not have the μ of HRP- rabbit-anti sheep IgG polyclonal antibodies 100 that hole adds 1: 5000 dilution L, 37 DEG C of placement 90min；PBST and PBS is washed 3 times respectively, and after adding TMB colour developings 30min, 1M H are added per hole₂SO₄50 μ L are terminated Reaction.Using double-wavelength method in reading data on ELIASA.

Embodiment 2Reg3A scFv sequencing and analysis

Sequencing result is shown, successfully obtains five kinds of Reg3A scFv gene orders, using IMGT/V-QUEST (http：// www.imgt.org/) Reg3A scFv gene orders are analyzed, analysis result shows：It is named as A5 Reg3A scFv weights, light chain The area's gene order of variable region and its CDR1~3 is as shown in SEQ ID NO.1~8；Reg3A scFv weights, the light chain for being named as C2 can Become the area's gene order of area and its CDR1~3 as shown in SEQ ID NO.9~16.

Embodiment 3Reg3A scFv preparation and purifying

PCR expands Reg3A scFv genes

By the use of the correct monoclonal of filtered out from phage library and sequencing analysis as template, to Reg3A scFv genes Enter performing PCR amplification.Carry out primer as upstream and downstream restriction enzyme site from EcoR I and Xho I respectively using Primer5.0 and set Meter, wherein A5-F, C2-F (sense primer) and A5-R, C2-R (anti-sense primer) sequence are：

A5-F CCGGAATTCCAGGTGGCAGCTGCAGGAGT

A5-R CCGCTCGAGACGTTTGATATCCACTTTGGTCCC

C2-F CCGGAATTCTCCAGGTACCTTGAAGGAGTCTGG

C2-R CCGCTCGAGACGTTTGATCTCCACCTTGGTCC

Reaction system is 50 μ L, and reaction condition is 94 DEG C of 4min, 94 DEG C of 30s, 57 DEG C of 45s, 72 DEG C of 1min, and 29 circulate, 72 DEG C of 10min, 4 DEG C of preservations.5 μ L end-products are taken to be identified on 1% agarose gel electrophoresis.It is left that PCR amplifications obtain 750bp Right Reg3A scFv genes.Purifying recovery is carried out to PCR primer with glue reclaim kit (raw work biology).

1.PCR products and carrier double digestion

With the small extraction reagent kit of plasmid (raw work biology) extraction pET-22b plasmids.Again by PCR primer and pET-22b plasmids point Double digestion is not carried out, and selected restriction enzyme site is EcoR I and Xho I.Reaction system is 50 μ L.PET-22b plasmid double digestions are anti- Answer condition：37℃4h；PCR primer double digestion reaction condition：37 DEG C overnight.Digestion products are used after 1% agarose gel electrophoresis Glue reclaim kit (raw work biology) carries out purifying recovery.

2. the connection of digestion products

The digestion products Reg3A scFv genetic fragments of recovery and pET-22b plasmids are established into 25 μ Ls company at 7: 1 in molar ratio Junctor system, with the 16 DEG C of connections of T4 ligases overnight.

3. the conversion and identification of connection product

Using CaCl₂Conversion method converts connection product into competence E.coli BL21.Concrete operations are as follows：

A. the E.coli BL21 single bacterium colonies that picking activates on LB flat boards, are inoculated in 3mL LB fluid nutrient mediums, 37 DEG C, 220rpm constant-temperature shaking cultures 12 hours or so, be the logarithmic growth later stage.The bacteria suspension is connect with 1: 100-1: 50 ratio Kind is in 100mL LB fluid nutrient mediums, 37 DEG C, 220rpm constant-temperature shaking culture 1.5-2h, to measure OD₆₀₀About 0.5.

B. nutrient solution is transferred in the sterile 2mL centrifuge tubes of precooling, is positioned in ice and places 10min, 4 DEG C, 2400 × g from Heart 5min.

C. supernatant discarding, with the 0.1M CaCl of 2mL precoolings₂Cell precipitation is gently resuspended, 4 DEG C again, 2400 × g centrifugations 5min。

D. supernatant discarding, 80 μ L 0.1M CaCl are added₂Solution, gently suspension cell.

E. the competent cell of 80 μ L preparations is drawn in sterile EP pipes, and 10 μ l connections are drawn with the sterile pipette tips of precooling Product is added in EP pipes, is gently rocked to mix inclusion, in placing 30min on ice.

F. EP pipes are quickly put into 2min in 42 DEG C of water-baths, are sure not to shake EP pipes.

G. EP pipes are gone into 1~2min of cooling in ice bath rapidly, the μ L of SOC culture mediums 800 is added in EP pipes, are put into 37 DEG C In constant-temperature table, low speed, which shakes, incubates 45min.

H. take in right amount the solution containing competent cell be transferred to the LB solid medium flat boards containing 100 μ g/mL Amp On, 37 DEG C incubated all to be absorbed to liquid.It is inverted flat board, 37 DEG C of overnight incubations.

Choose area's single bacterium colony and overnight incubation in LB liquid medium at random from LB solid mediums, draw a small amount of bacterium solution and enter Row bacterium colony PCR, gene sequencing analysis is carried out through 1% agarose gel electrophoresis Preliminary Identification, then by positive colony.

4.Reg3A scFv expression, purifying

The recombinant strains built are inoculated in LB (100 μ g/mL Amp) fluid nutrient medium, 37 DEG C are activated overnight. The inoculum concentration of next day one 1% connects and fresh LB (100 μ g/mL Amp) fluid nutrient medium.Work as OD₆₀₀Final concentration is added when reaching 0.8 0.2mM IPTG, in 20 DEG C of induced expression 20h.

4 DEG C, 8000rpm centrifugations 15min collects the zymotic fluid thalline of induced expression, by every gram of thalline 10mL bacterial lysate Ratio bacterial lysate is added into bacterial sediment, be stirred continuously with glass bar, during which sequentially add PMSF, lysozyme and DNA enzymatic, stir to not sticky.Thalline mixture is put into Ultrasonic Cell Disruptor, probe gos deep into liquid bottom and carries out ultrasonic break Broken 30min.The mixed liquor 12000rpm crushed is centrifuged into 20min, supernatant is collected, with 0.22 μm of membrane filtration.

Sample after filtering is purified with nickel affinity column chromatography, then with containing various concentrations imidazoles (20mM, 50mM, 100mM, 250mM, 500mM) gradient elution is carried out, while collect eluent.The sample collected with 12%SDS-PAGE analyses, will Finally -70 DEG C of preservations after dialysis is concentrated by ultrafiltration of protein sample after purification.

Embodiment 4BLI technologies determine affinity of antibody

The Reg3A albumen that marked biotin is connected on Streptavidin (SA) sensor, respectively to different dense The antibody of degree carries out gradient detection.The concentration of setting is 0nM, 192nM, 288nM, 433nM, 650nM.With ForteBio calculating Software carries out calculating processing, and the Dissociation equilibrium constant KD of acquisition is respectively 4.44 × 10^-10、1.91×10^-8。

Embodiment 5MTT detects the antitumor activity of antibody

LoVo cells are digested to single cell suspension with 0.25% trypsin-EDTA solutions.With 10%FBS cell culture Base dilutes LoVo cells, spreads 96 orifice plates, and final adjustment cell concentration is 3000/hole, per the μ L of hole 100, cultivates 24h.To 96 holes Every hole cell in plate carries out agent-feeding treatment, and medicine final concentration is 500nM, 250nM, 125nM, 60nM, 30nM respectively.Dosing is made After 48h, 11 μ L MTT (5mg/mL) is added per hole, continues to cultivate 4h.After 3000rpm centrifugations 5min, supernatant is suctioned out, is added DMSO dissolves 10min, and ELIASA detects the light absorption value at 570nm and 630nm.

Claims (9)

1. a kind of weight chain variable district and light chain variable district of Reg3A single-chain antibodies, it is characterised in that described Reg3A is single-stranded anti- The weight chain variable region nucleotide sequence of body such as SEQ ID NO：Shown in 1, wherein weight chain variabl area sequence includes such as SEQ ID NO：2 The nucleotide sequence in the area of CDR1 shown in~4~3；Described Reg3A single-chain antibody light chain variable region nucleotide sequences such as SEQ ID NO：Shown in 5, wherein light-chain variable sequence includes such as SEQ ID NO：The nucleotides sequence in the area of CDR1 shown in 6~8~3 Row.

2. a kind of weight chain variable district and light chain variable district of Reg3A single-chain antibodies, it is characterised in that described Reg3A is single-stranded anti- The heavy chain nucleotide sequence of body such as SEQ ID NO：Shown in 9, wherein weight chain variabl area sequence includes such as SEQ ID NO：10~12 The variable region nucleotide sequence in the area of shown CDR1~3；Described Reg3A single-chain antibody light chain variables region nucleotide sequence is such as SEQ ID NO：Shown in 13, wherein light-chain variable sequence includes such as SEQ ID NO：The core in the area of CDR1 shown in 14~16~3 Nucleotide sequence.

3. a kind of weight chain variable district and light chain variable district of Reg3A single-chain antibodies, it is characterised in that described Reg3A is single-stranded anti- The heavy chain variable amino acid sequence of body such as SEQ ID NO：Shown in 17, wherein weight chain variabl area sequence includes such as SEQ ID NO： The amino acid sequence in the area of CDR1 shown in 18~20~3；Described Reg3A single-chain antibody chain variable region amino acids sequence is such as SEQ ID NO：Shown in 21, wherein light-chain variable sequence includes such as SEQ ID NO：The ammonia in the area of CDR1 shown in 22~24~3 Base acid sequence.

4. a kind of weight chain variable district and light chain variable district of Reg3A single-chain antibodies, it is characterised in that described Reg3A is single-stranded anti- The heavy chain variable amino acid sequence of body such as SEQ ID NO：Shown in 25, wherein weight chain variabl area sequence includes such as SEQ ID NO： The amino acid sequence in the area of CDR1 shown in 26~28~3；Described Reg3A single-chain antibody chain variable region amino acids sequence is such as SEQ ID NO：Shown in 29, wherein light-chain variable sequence includes such as SEQ ID NO：The ammonia in the area of CDR1 shown in 30~32~3 Base acid sequence.

5. a kind of polynucleotide sequence or combination, it is characterised in that the polynucleotide sequence or combination comprising claim 1 and Any variable region sequences described in 2, and comprising the heavy chain described in claim 1 and 2 or one or more CDR regions of light chain Different arrangement modes.

A kind of 6. more peptide or proteins, it is characterised in that described more peptide or proteins include claim 3 and 4 described in it is any can Become region sequence, and include the heavy chain or the different arrangement modes of one or more CDR regions of light chain described in claim 3 and 4.

7. a kind of recombinant dna expression vector, it is characterised in that the recombinant dna expression vector includes more described in claim 5 Nucleotide sequence or combination.

8. a kind of recombinant dna expression vector, it is characterised in that more described in the recombinant dna expression vector coding claim 6 Peptide and protein sequence or combination.

9. a kind of host cell, it is characterised in that described host cell includes the recombinant DNA table described in claim 7 and 8 Up to carrier, the host cell includes but is not limited to e. coli bl21.