CN104450592A - Method for separating denitrification desulfurizing bacteria based on biodiversity information - Google Patents
Method for separating denitrification desulfurizing bacteria based on biodiversity information Download PDFInfo
- Publication number
- CN104450592A CN104450592A CN201410850374.2A CN201410850374A CN104450592A CN 104450592 A CN104450592 A CN 104450592A CN 201410850374 A CN201410850374 A CN 201410850374A CN 104450592 A CN104450592 A CN 104450592A
- Authority
- CN
- China
- Prior art keywords
- concentration
- solution
- pseudomonas
- denitrification
- substratum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for separating denitrification desulfurizing bacteria based on biodiversity information and relates to denitrification desulfurizing bacterium screening methods. The method comprises the steps of collecting sludge, conducting high-throughput sequencing on the sludge sample, analyzing the flora abundance fluctuation and space ecological distribution of the sludge sample, adopting different screening methods according to community composite and structure characteristics, conducting anaerobic culture on a target bacterial genus by means of an interlayer culture medium with different screening methods, selecting a single colony for isolated culture, and obtaining a single bacterial colony after repeated operation. Two kinds of denitrification desulfurizing bacterial strains, namely autotrophic denitrification desulfurizing bacteria which belong to Thiobacillus, and heterotrophic denitrification desulfurizing bacteria which belong to Thauera, Azoarcus, Arcobacter and Ochrobactrum are obtained through screening. Community structure information displayed by the strain screening result is consistent with that displayed by the high-throughput sequencing result, microbial resources are provided for improving biological treatment effectiveness of wastewater. Furthermore, the metabolic characteristics of the strains are identified.
Description
Technical field
The invention belongs to environmental microbiology field, relate to the screening method of denitrification desulfurizing bacteria.
Background technology
In recent years, along with developing rapidly of the industries such as China's chemical industry, pharmacy, food-processing, petroleum refining, high density, organic wastewater with difficult degradation thereby quantity discharged increase year by year.Wherein, quite a few is the nitrogenous organic waste water of sulfur-bearing.In this type of waste water, sulfur-bearing nitrogenous compound concentration is high, toxicity large, pollute heavy, serious threat environmental and human health impacts, becomes one of primary pollution source causing the calamitous ecological damage of China's water body.At present, it is more outstanding that the problems such as this type of wastewater treatment ubiquity " suitability treatment technology lacks, process system is complicated, construction investment is huge, running cost is high, qualified discharge difficult ", especially sulphur system thing are difficult to effectively to remove the environmental pollution hidden danger caused.Therefore, administer sulfur-bearing nitrogenous organic waste water, contain its to the baneful influence of water body environment to ecological safety and Sustainable Socioeconomic Development significant.
Biological process is commonly used to administers the nitrogenous organic waste water of sulfur-bearing.The process being biological sulphur by sulphur system contamination transform can strengthen nitrogen, removal of sulphur, and thoroughly eliminates the environment hidden danger of sulfocompound.In eighties of last century seventies, the people such as Bisogni utilize the thiobacillus denitrificans of enrichment culture to carry out the autotrophic denitrification experiment of lab scale, using thiosulphate and sulfide as electron donor, experimental result shows: under anaerobic, and thiobacillus denitrificans can obtain energy using nitrate as electron acceptor(EA).After this, a large amount of research work about autotrophy desulfurization denitrifying bacterium is reported both at home and abroad.2004, the people such as Wang Aijie, Du great Zhong separated the thiobacillus denitrificans (Thiobacillus denitrificans) of a strain autotrophy, and utilized feasibility and the influence factor of its research DSR technique.2006, the people such as Wang Aijie separated the denitrifying bacterium of a strain autotrophy desulfurization from soil, belonged to Rhod (Rhodococcus sp.).2007, a plant height effect denitrification desulfurization heterotrophism bacterial strain is separated in the granule sludge that Chen Chuancong has tamed half a year in EGSB reactor, belong to Rhodopseudomonas (Pseudomonassp.), broken only have autotrophic denitrification bacterium could in denitrification sweetening process the traditional idea of accumulation elemental sulfur.Meanwhile, the people such as Chen Chuan propose the technical thought of autotrophy-heterotrophic microorganism associating denitrification desulfurization, significantly improve sewage treatment load and the transformation efficiency to pollutent.Traditional theory thinks that autotrophy-heterotrophic microorganism is combined autotrophic bacteria in denitrification desulphurization system and carries out desulfurization denitrification, but inefficiency; Heterotrophic bacterium can only play the effect of organics removal.But we find the functional microorganism that a class is new in denitrification desulfurization research in recent years: namely a class can high efficiency synchronous metabolism organism carry out the denitrifying microorganism of desulfurization.Past, existing research confirmed the existence having facultative autotroph/heterotrophism flora in waste water denitrification desulfurization treating processes, partial organic substances can also be removed while denitrification desulfurization.But do not have using sulfide and organism simultaneously as electron donor so far, using nitrate, in the substratum of electron acceptor(EA), screening obtains the report of this kind of bacterial strain.Therefore the acquisition of this functional microorganism will propose new denitrification mechanism, provide new approaches to the simultaneous removing research of sulphur, nitrogen, carbon in waste water treatment process, be also that exploitation and the engineer applied of biological desulfurization removing nitric treatment process provides microbiology foundation simultaneously.But, because the blindness of traditional microbe to screen method and screening conditions lack special specific aim, be difficult to screen flora abundance and the different functional microorganism of space ecologicaI distribution in the denitrification desulphurization system of steady running.
Summary of the invention
The object of this invention is to provide a kind of screening method of denitrification desulfurization bacterium, the species diversity information namely provided based on high throughput sequencing technologies formulates the specific screening method for different Pseudomonas.
A kind of method based on species diversity information separated denitrification desulfurizing bacteria of the present invention, it carries out according to following steps:
One, mud sample is gathered from the CGSB of carrying out biological desulphurization denitrogenation of steady running;
Two, the high throughput sequencing technologies adopted carries out group's space structure and enrichment analysis to mud sample, obtains Bio-diversity information; Wherein, described Bio-diversity information refers to: the fluctuation of flora abundance and space ecologicaI distribution information; Simultaneously by the mud gathered in step one by volume for the ratio of 1:5 adds sterilized water, put into granulated glass sphere simultaneously, be shaking culture 24 hours under the condition of 220 revs/min at rotating speed, obtain the suspension of each Pseudomonas;
Three, to after the bacterium liquid dilution of each Pseudomonas of step 2, coat on the solid medium corresponding with each Pseudomonas, then the solid medium that lid is corresponding with this Pseudomonas is watered thereon, making the anaerobism sandwich culfure base of each Pseudomonas, is carry out Anaerobic culturel under the condition of 30 DEG C to produce bubble to substratum interlayer in constant incubator temperature;
Four, the cover part of the anaerobism sandwich culfure base of each Pseudomonas in strip step three, single bacterium colony of each Pseudomonas in picking bubble, proceeds in Liquid segregation substratum corresponding to each Pseudomonas, carries out enlarged culturing, and constant incubator 30 DEG C, culture cycle is 14 days;
Five, get the bacterium liquid that step 4 cultivates rear each Pseudomonas, the solid medium that each Pseudomonas is corresponding carries out plate loop method; Then be placed in constant incubator, carry out being cultured to the single bacterium colony of appearance under 30 DEG C of conditions, single bacterium colony of each Pseudomonas of picking proceeds in liquid culture medium corresponding to each Pseudomonas to be cultivated;
Six, the operation 3 times of repeating step three to step 5, after isolating the single bacterium colony of each Pseudomonas, namely completes the screening being separated denitrification desulfurizing function microorganism from organic waste water biological desulphurization denitrification system; Wherein, following Pseudomonas is comprised in suspension in step 2: Soxhlet Pseudomonas (Thauera sp.), fixed nitrogen Vibrio (Azoarcus sp.), arch bar Pseudomonas (Arcobactersp.), Ochrobactrum (Ochrobactrum sp.), Thiobacillus (Thiobacillus sp.), Thiospirillum (Sulfurimonas sp.), Alkaligenes (Alkaliflexus sp.), Desulfovibrio (Desulfofutls sp.) and ground Bacillaceae (Geoalkalibacter sp.).
The present invention comprises following beneficial effect:
Separation and purification of the present invention goes out two class desulfurization denitrification function microorganisms, one class is autotrophic denitrification desulfurizing microorganism, can utilize inorganic carbon source, using thiosulphate as electron donor, nitrate or nitrate reductase, as electron acceptor(EA), are that nitrogen produces elemental sulfur simultaneously by nitrate; Another kind of is heterotrophic denitrification desulfurization microorganism, namely using organic carbon as electron donor by nitrite or nitrate transformation for nitrogen while can also be sulphur simple substance by sulfide-oxidation.Therefore having possessed high efficiency synchronous metabolism organic carbon, the feature of nitrate and sulfide, is a kind of unconventional biological desulphurization phenomenon.Therefore the new carbon nitrogen sulphur of proposition is removed mechanism by the acquisition of heterotrophic denitrification desulfurization microbial function microorganism altogether, new approaches are provided to the simultaneous removing research of sulphur, nitrogen, carbon in waste water treatment process, simultaneously also for the exploitation of biological desulfurization removing nitric treatment process provides microbiology foundation with engineer applied, provide Microbial resources for strengthening biological wastewater treatment usefulness.
Owing to have employed the separation method of sandwich culfure base, the aerogenesis situation of single bacterium colony can be judged by naked eyes, thus provide sound assurance for the pure culture effectively obtaining heterotrophic denitrification desulfurization bacterium fast.The flora abundance fluctuation that the present invention's foundation filters out from mud sample and space ecologicaI distribution information are according to these Bio-diversity information, establish want the target Pseudomonas of separation screening, different screening schemes is formulated for different target Pseudomonas, what the present invention proposed formulates sieve bacterium scheme based on the fluctuation of flora abundance and space ecologicaI distribution, avoid the drawbacks such as the blindness of conventional screen bacterium, poor efficiency, improve screening efficiency and success ratio.To difficult screening of cultivating functional microorganism in natural microorganisms group or artificial system, there is important practical significance.
Accompanying drawing explanation
Fig. 1 is microorganism species spatial distribution and abundance figure in the CGSB of carrying out biological desulphurization denitrogenation; Wherein, A is anthropi HS4 (Ochrobactrum) flora spatial distribution and abundance figure, B is arc bacillus HS3 (Arcobacter) flora spatial distribution and abundance figure, C is Soxhlet bacterium HS1 (Thauera), D is Thiobacillus AS1 (Thiobacillus) flora spatial distribution and abundance figure, E is fixed nitrogen vibrios HS2 (Azoarcus) flora spatial distribution and abundance figure;
Fig. 2 is the Electronic Speculum figure of Soxhlet Pseudomonas HS1 (Thauera sp.);
Fig. 3 is the Electronic Speculum figure of fixed nitrogen Vibrio HS2 (Azoarcus sp.);
Fig. 4 is the Electronic Speculum figure of arc bacillus HS3 (Arcobacter sp.);
Fig. 5 is the Electronic Speculum figure of Ochrobactrum HS4 (Ochrobactrum sp.);
Fig. 6 is the Electronic Speculum figure of Thiobacillus AS1 (Thiobacillus sp.);
Fig. 7 is the Qualitative Identification figure adding elemental sulfur before hexahydropyridine of embodiment one;
Fig. 8 is the Qualitative Identification figure adding elemental sulfur after hexahydropyridine of embodiment one.
Embodiment
Embodiment one: a kind of method based on species diversity information separated denitrification desulfurizing bacteria of present embodiment, it carries out according to following steps:
One, mud sample is gathered from the CGSB of carrying out biological desulphurization denitrogenation of steady running;
Two, the high throughput sequencing technologies adopted carries out group's space structure and enrichment analysis to mud sample, obtains Bio-diversity information; Wherein, described Bio-diversity information refers to: the fluctuation of flora abundance and space ecologicaI distribution information; Simultaneously by the mud gathered in step one by volume for the ratio of 1:5 adds sterilized water, put into granulated glass sphere simultaneously, be shaking culture 24 hours under the condition of 220 revs/min at rotating speed, obtain the suspension of each Pseudomonas;
Three, to after the bacterium liquid dilution of each Pseudomonas of step 2, coat on the solid medium corresponding with each Pseudomonas, then the solid medium that lid is corresponding with this Pseudomonas is watered thereon, making the anaerobism sandwich culfure base of each Pseudomonas, is carry out Anaerobic culturel under the condition of 30 DEG C to produce bubble to substratum interlayer in constant incubator temperature;
Four, the cover part of the anaerobism sandwich culfure base of each Pseudomonas in strip step three, single bacterium colony of each Pseudomonas in picking bubble, proceeds in Liquid segregation substratum corresponding to each Pseudomonas, carries out enlarged culturing, and constant incubator 30 DEG C, culture cycle is 14 days;
Five, get the bacterium liquid that step 4 cultivates rear each Pseudomonas, the solid medium that each Pseudomonas is corresponding carries out plate loop method; Then be placed in constant incubator, carry out being cultured to the single bacterium colony of appearance under 30 DEG C of conditions, single bacterium colony of each Pseudomonas of picking proceeds in liquid culture medium corresponding to each Pseudomonas to be cultivated;
Six, the operation 3 times of repeating step three to step 5, after isolating the single bacterium colony of each Pseudomonas, namely completes the screening being separated denitrification desulfurizing function microorganism from organic waste water biological desulphurization denitrification system; Wherein, following Pseudomonas is comprised in suspension in step 2: Soxhlet Pseudomonas (Thauera sp.), fixed nitrogen Vibrio (Azoarcus sp.), arch bar Pseudomonas (Arcobactersp.), Ochrobactrum (Ochrobactrum sp.), Thiobacillus (Thiobacillus sp.), Thiospirillum (Sulfurimonas sp.), Alkaligenes (Alkaliflexus sp.), Desulfovibrio (Desulfofutls sp.) and ground Bacillaceae (Geoalkalibacter sp.).
According to the Bio-diversity information obtained in the application's step 2, establish the target Pseudomonas that will be separated, formulate different screening schemes for different target Pseudomonas.
Embodiment two: present embodiment and embodiment one unlike: the CGSB of carrying out biological desulphurization denitrogenation from steady running in step one gathers mud sample, refers to that the CGSB of carrying out biological desulphurization denitrogenation from all reaching the steady running of 99% to carbon organic waste water, nitrogen, amounts of sulphur contaminants clearance gathers mud sample.Other is identical with embodiment one.
Embodiment three: present embodiment and embodiment one unlike: gathering mud in step one is that the CGSB of carrying out biological desulphurization denitrogenation of never level steady running collects.Other is identical with embodiment one.
Embodiment four: present embodiment and embodiment one unlike: the Bio-diversity information obtained in step 2 refers to the Bio-diversity information obtaining organic waste water biological desulphurization denitrification system.Other is identical with embodiment one.
Embodiment five: present embodiment and embodiment one unlike: the solid medium that described each Pseudomonas is corresponding, Liquid segregation substratum and liquid culture medium component are as follows:
The component of the solid medium of Soxhlet Pseudomonas (Thauera sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the acetate solution of 1.0g/L, concentration is the MgSO of 0.1g/L
47H
2o solution, concentration are the NaHCO of 0.5g/L
3solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 0.75g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
4solution; Wherein, the pH of each substratum of Soxhlet Pseudomonas (Thauera sp.) is 8.0;
The component of the solid medium of fixed nitrogen Vibrio (Azoarcus sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the acetate solution of 0.68g/L, concentration is the KNO of 0.63g/L
3solution, concentration are the K of 50mg/L
2hPO
4solution and concentration are the NH of 50mg/L
4cl solution; Wherein, the pH of each substratum of fixed nitrogen Vibrio (Azoarcus sp.) is 8.0;
The component of the solid medium of arch bar Pseudomonas (Arcobacter sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 1.5g/L
2s9H
2solution, concentration are the acetate solution of 1.0g/L, concentration is the MgSO of 0.1g/L
47H
2o solution, concentration are the NaHCO of 0.5g/L
3solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 0.75g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
4solution; Wherein, the pH of each substratum of arch bar Pseudomonas (Arcobacter sp.) is 8.0;
The component of the solid medium of Ochrobactrum (Ochrobactrum sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the C of 10mg/L
3h
5naO
3solution, concentration are the MgSO of 0.1g/L
47H
2o solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 1.0g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
43H
2o solution; Wherein, the pH of each substratum of Ochrobactrum (Ochrobactrum sp.) is 8.0;
The component of the solid medium of Thiobacillus (Thiobacillus sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 5.0g/L
2s
2o
35H
2o solution, concentration are the K of 2g/L
2hPO
4solution, concentration are the KNO of 2g/L
3solution, concentration are the MgSO of 0.6g/L
47H
2o solution, concentration are the NH of 0.5g/L
4cl solution and concentration are the FeSO of 0.01g/L
47H
2o solution; Wherein, the pH of each substratum of Thiobacillus (Thiobacillus sp.) is 7.6.Other is identical with embodiment one.
Embodiment six: present embodiment and embodiment one unlike: after the bacterium liquid of each Pseudomonas of step 2 being diluted in step 3, coat on the solid medium corresponding with each Pseudomonas and refer to: get 1mL and 10 are diluted to each bacterium liquid after step 3 analysis
-4after, draw 0.1mL and coat on the solid medium of each Pseudomonas.Other is identical with embodiment one.
Below by embodiment, the present invention is described in more detail.
Embodiment one
The present embodiment carries out screening heterotrophic denitrification desulfurization bacterial strain according to following program:
1. sample
This sieves bacterium mud sample used all from the CGSB of carrying out biological desulphurization denitrogenation, when sampling, collecting the mud of the different heights such as reactor upper, middle and lower, and mixed with 50mL centrifuge tube.
2. according to the characteristic determination specificity screening condition of objective function bacterium
The present invention is the screening method of denitrification desulfurization Pseudomonas, and the high-flux sequence result according to denitrification desulphurization reactor contaminated samples is learnt, the distribution of the microflora of reactor is mainly divided into two classes: autotrophic microorganism and heterotrophic microorganism.The Pseudomonas that wherein abundance is higher is respectively: fixed nitrogen vibrios (Azoarcus), Soxhlet bacterium (Thauera), arc bacillus (Arcobacter), thiobacillus (Thiobacillus) and anthropi (Ochrobactrum) etc. (as shown in Figure 1).Therefore for above feature Pseudomonas, the present invention devises two class screening methods:
(1) autotrophic denitrification desulfurizing functional microorganism:
The component of the solid medium of Thiobacillus (Thiobacillus sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 5.0g/L
2s
2o
35H
2o solution, concentration are the K of 2g/L
2hPO
4solution, concentration are the KNO of 2g/L
3solution, concentration are the MgSO of 0.6g/L
47H
2o solution, concentration are the NH of 0.5g/L
4cl solution and concentration are the FeSO of 0.01g/L
47H
2o solution; Wherein, culture temperature 30 DEG C, the pH of each substratum of Thiobacillus (Thiobacillus sp.) is 7.6.
(2) heterotrophic denitrification desulfurizing function microorganism:
Based on community structure information, it is more to carry out heterotrophic microorganism in the CGSB of biological desulphurization denitrogenation, thus devises different screening methods for different Pseudomonas:
1. the liquid nutrient medium for Soxhlet Pseudomonas (Thauera sp.) consists of: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the acetate solution of 1.0g/L, concentration is the MgSO of 0.1g/L
47H
2o solution, concentration are the NaHCO of 0.5g/L
3solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 0.75g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
4solution; Culture temperature 30 DEG C, pH=8.0.
2. the liquid nutrient medium being directed to fixed nitrogen Vibrio (Azoarcus sp.) consists of: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the acetate solution of 0.68g/L, concentration is the KNO of 0.143g/L
3solution, concentration are the K of 50mg/L
2hPO
4solution and concentration are the NH of 50mg/L
4cl solution; Culture temperature 30 DEG C, pH=7.5.
3. the liquid nutrient medium being directed to arch bar Pseudomonas (Arcobacter sp.) consists of: concentration is the Na of 1.5g/L
2s9H
2solution, concentration are the acetate solution of 1.0g/L, concentration is the MgSO of 0.1g/L
47H
2o solution, concentration are the NaHCO of 0.5g/L
3solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 0.75g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
4solution; Culture temperature 30 DEG C, pH=8.0.
4. the liquid nutrient medium for Ochrobactrum (Ochrobactrum sp.) consists of: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the C of 10mg/L
3h
5naO
3solution, concentration are the MgSO of 0.1g/L
47H
2o solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 1.0g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
43H
2o solution; Culture temperature 30 DEG C, pH=7.5.
3. bacteria distribution screening process
(1) mud is gathered from the different heights carrying out the CGSB of biological desulphurization denitrogenation of steady running.The mud sample 50mL gathered by each height puts into the Erlenmeyer flask of 500mL sterilizing, adds sterilized water and is diluted to 250mL, puts into granulated glass sphere 20 to 25, with 220 revs/min of vibrations 24 hours in shaking table.By zoogloea or soil particle shatter, make bacteria suspension.
(2), after Homogeneous phase mixing, the mud sample sterilized water drawing 1mL is diluted to 10
-4doubly, draw the rear bacteria suspension 0.1mL of dilution, after solid separation culture medium (nutrient media components refers to part 2) is coated with, water lid solid separation culture medium (nutrient media components refers to part 2) and make anaerobism sandwich culfure base, keep the anaerobic state of bacterial classification, cultivate 14 days constant incubator 30 DEG C, in substratum interlayer, occur bubble.
(3) peel off the cover part of anaerobism sandwich culfure base, the single bacterium colony in picking bubble, proceeds to Liquid segregation substratum, carries out enlarged culturing, and constant incubator 30 DEG C, culture cycle is about 14 days, and substratum becomes turbid and is advisable.
(4) glue with getting acicula the bacterial classification getting liquid culture medium, solid medium carries out plate loop method.Cultivate at constant incubator 30 DEG C, then picking list bacterium colony proceeds in liquid culture medium.
(5) repeated isolation step (3), (4), (5) five cycles, to isolating single bacterium colony.
1 strain autotrophic denitrification function yeast is obtained, called after AS1 by being separated in autotrophic denitrification desulfurizing functional microorganism screening method.Screened altogether by heterotrophic denitrification functional microorganism screening method and obtain 4 strain heterotrophic denitrification function yeast, respectively called after HS1-HS4 (strain morphology is shown in shown in Fig. 2 to 6).
4.16S rRNA identifies:
First, adopt the bacterial genomes DNA extraction kit of TIANGEN Biotech (Beijing) Co., Ltd. to extract DNA of bacteria, concrete operation step refers to product description.Afterwards, carried DNA is carried out polymerase chain reaction (PCR).
16S rRNA amplimer is as follows:
Forward primer F8:5 ' AGAGTTTGATCCTGGCTCAG 3 '
Reverse primer R1492:5 ' GGTTACCTTGTTACGACTT 3 ';
PCR reaction system (50 μ l) is as follows:
After setting up PCR reaction system, increase by following reaction conditions:
35 circulations;
After PCR, the product of pcr amplification is delivered to doctor biotech firm and checks order, obtain following result through order-checking:
Through qualification, strains A S1 is that Thiobacillus (Thiobacillus sp.) bacterial strain HS1-HS4 is accredited as Soxhlet Pseudomonas (Thauera sp.), fixed nitrogen Vibrio (Azoarcus sp.), arch bar Pseudomonas (Arcobacter sp.), consistent with the community structure information that Ochrobactrum (Ochrobactrum sp.) and high-flux sequence result obtain respectively.
5. the morphological specificity of synchronous desulfurizing denitrification heterotrophic bacterium, 16S rRNA identify and physio-biochemical characteristics
(1) morphological specificity
The method of transmission electron microscope is adopted to observe the morphological specificity of bacterial strain: the liquid culture 1 getting purifying is placed on copper mesh, copper mesh negative staining 40 seconds in the Tungstophosphoric acid, sodium salt solution of 2% is got after 15-20 minute, take out copper mesh and be placed in diced into sections on dry filter paper, dry.Finally this copper mesh is placed in the sample chamber of transmission electron microscope, observes bacterium pattern.At electric Microscopic observation, the form of bacterial strain as shown in Figures 2 to 6.Fig. 2 is Soxhlet bacterium HS1 (Thauera sp.), and cell is that shuttle is shaft-like, single polar flagella, without gemma, have polymkeric substance outside born of the same parents, gramstaining is negative, and thalline size is long (0.7 μm ~ 1 μm) × wide (0.2 μm ~ 0.5 μm).Fig. 3 is fixed nitrogen vibrios HS2 (Azoarcus sp.), and cell is shaft-like, one pole or peritrichous, without gemma, have polymkeric substance outside born of the same parents, gramstaining is negative, and thalline size is long (0.8 μm ~ 1.5 μm) × wide (0.5 μm ~ 0.6 μm).Fig. 4 is arc bacillus HS3 (Arcobacter sp.), and individual cells is shaft-like, single polar flagella, and without gemma, thalline size is long (3 μm ~ 5 μm) × wide (0.3 μm ~ 0.5 μm), and gramstaining is negative.Fig. 5 is Ochrobactrum HS4 (Ochrobactrum sp.), and cell is shaft-like, atrichia, without gemma, have polymkeric substance outside born of the same parents, gramstaining is negative, and thalline size is long (0.8 μm ~ 1.2 μm) × wide (0.5 μm ~ 0.6 μm).Fig. 6 is Thiobacillus AS1 (Thiobacillussp.) little staff cell, and with single polar flagella, without gemma, gramstaining is negative, and thalline size is long (1.5 μm ~ 1.2 μm) × wide (0.5 μm ~ 0.8 μm).
(2) Qualitative Identification of elemental sulfur is generated
Sulfothiorine (Na in substratum
2s
2o
35H
2o) be colourless transparent crystal, soluble in water, its aqueous solution is weakly alkaline, and it is very stable in neutrality, basic solution, and thiosulfate anion can regard sulfate radical (SO as
4 2-) in a Sauerstoffatom replace by sulphur atom, so at thiosulfate anion (S
2o
3 2-) in two sulphur atoms in, one is positive sexavalence, and one is negative divalence.
Each pure growth of 25mL bacterial strain HS1-HS4 is transferred in the 500mL Erlenmeyer flask of the liquid culture medium (nutrient media components refers to part 2) filling each bacterial strain of 250mL, passes into N
2, put into shaking table after keeping anaerobic state, cultivate under 220 revs/min and 30 DEG C of conditions.After one week, occur fine white particle bottom Erlenmeyer flask, put into test tube with after transfer pipet sucking-off, first backward test tube drips strong acid, highly basic, and particle does not dissolve, and after dripping hexahydropyridine to test tube, grain dissolution becomes reddish brown from colourless, proves elemental sulfur.(Qualitative Identification of elemental sulfur is shown in shown in Fig. 8 to Fig. 9)
(3) denitrifying Qualitative Identification
The each pure bacterium liquid of 25mL bacterial strain HS1-HS4 is transferred in the 500mL Erlenmeyer flask of the liquid culture medium (nutrient media components refers to part 2) filling each bacterial strain of 400mL, passes into N
2, put into shaking table after keeping anaerobic state, cultivate under 220 revs/min and 30 DEG C of conditions, arrange airway at Erlenmeyer flask top, using graduated cylinder as resorber, strong caustic, as absorption liquid, is observed the aerogenesis situation of bacterial classification.In cultivation after five days, the liquid level of the high alkali liquid in graduated cylinder starts to decline, insufflation gas in graduated cylinder.
Gas composition analysis adopts gas-chromatography (Agilent 7890N), using hydrogen as carrier gas, using thermal conductance as detector.By analysis, N in gas
2content is more than 90%.
(4) carbon, nitrogen, amounts of sulphur contaminants remove ability altogether
Table 1-3 screens the time delay of heterotrophic denitrification desulfurization bacterial strain to the removal ability of sulphur, nitrogen, Prevent Carbon Contamination thing and pollutent obtained to change.From table, each bacterial strain of obtaining of screening all can the pollutent such as synchronously metabolism carbon, nitrogen, sulphur, and namely heterotrophic denitrifier can realize the removal to sulfide.From table 1, Soxhlet Pseudomonas HS1 (Thauera) to the removal ability of sulfide and efficiency all the highest, in 10 ~ 15 hours, all about 95% is reached to the clearance of sulfide.Screen the transformation efficiency of each bacterial strain to the removal ability of sulfide and sulphur simple substance obtained to be followed successively by: Soxhlet bacterium HS1 (Thauera) > arc bacillus HS3 (Arcobacter) > fixed nitrogen vibrios HS2 (Azoarcus) > anthropi HS4 (Ochrobactrum).Wherein anthropi HS4 (Ochrobactrum) is to the removal of sulfide and to be converted into the efficiency of sulphur simple substance minimum, after 25 hours, only reaches about 85% to the removal ability of sulfide.Each bacterial strain is to the removal ability of nitrogenous compound and N
2the analysis of growing amount shows, fixed nitrogen vibrios HS2 (Azoarcus) is to the removal ability of nitrate radical and N
2transformation efficiency the highest, the ability of its degraded nitrate radical reaches 8.2mg/L/h, and the degradation capability of other bacterial strain to nitrate radical is followed successively by Soxhlet bacterium HS1 (Thauera) 7.0mg/L/h> arc bacillus HS3 (Arcobacter) 6.2mg/L/h> anthropi HS4 (Ochrobactrum) 5.2mg/L/h.Similar with table 1 result, anthropi HS4 (Ochrobactrum) removal ability to nitrate radical is minimum.Each bacterial strain is being found the relatively middle of organic removal ability, Soxhlet bacterium HS1 (Thauera) and arc bacillus HS3 (Arcobacter) are 26.0mg/L/h to organic removal efficiency the best, anthropi HS4 (Ochrobactrum) is minimum to organic removal efficiency, is only 6.2mg/L/h.
The each bacterial strain of table 1 is to sulfide S
2-removal ability and the transformation efficiency of sulphur simple substance S
Note: 1. the unit of concentration and removal amount is mg/L, simple substance S transformation efficiency is: be converted into sulfide removal amount/premature cure substrate concentration × 100%.
The each bacterial strain of table 2 is to the removal ability of nitrogenous compound and N
2growing amount
Note: 1. the unit of concentration and removal amount is mg/L, N
2transformation efficiency: NO
3 -removal amount/initial NO
3 -amount.
The each bacterial strain of table 3 is to organic removal ability
Note: 1. the unit of concentration and removal amount is mg/L, carbon source transformation efficiency: carbon source removal amount/starting carbon source content.
Table 4 and table 5 screen the autotrophic denitrification desulfurizing bacterial strain that obtains to the time dependent data of place to go ability of nitrogenous sulfurous pollutants according to present method.From table, the autotrophy bacterial strain that obtains of screening can the pollutent of the nitrogenous sulfur-bearing of metabolism, and namely autotrophic denitrification microorganism can realize the removal to sulfide.From table 4, autotrophic bacteria Thiobacillus AS1 (Thiobacillus) transforms the ability of elemental sulfur and efficiency lower than above four strain heterotrophism bacterial strains, in 10 ~ 50 hours, Thiobacillus AS1 (Thiobacillus) clearance to thiosulphate reaches about 88%, at 30 hours, Thiobacillus AS1 (Thiobacillus) clearance to thiosulphate reaches 76.7%, removal speed is 16.43mg/L/h, after 50 hours, Thiobacillus AS1 (Thiobacillus) clearance to thiosulphate reaches 88.0%, remove speed and reach 11.36mg/L/h.By this autotrophy bacterial strain to the removal ability of nitrogenous compound and N
2the analysis of growing amount shows, Thiobacillus AS1 (Thiobacillus) to the removal ability of nitrogenous compound and efficiency lower than above four strain heterotrophism bacterial strains.In 10 ~ 50 hours, the removal speed of Thiobacillus AS1 (Thiobacillus) to nitrate radical is 4.38mg/L/h, and final clearance is 82.4%.
Table 4 autotrophy bacterial strain is to the transformation efficiency of the removal ability of Sulfothiorine and sulphur simple substance S
Note: 1. the unit of concentration and removal amount is mg/L, simple substance S transformation efficiency is: S
2o
3 2-amount/initial the S of S
2o
3 2--S concentration × 100%.
Table 5 autotrophy bacterial strain is to the removal ability of nitrogenous compound and N
2growing amount
Note: 1. the unit of concentration and removal amount is mg/L, N
2transformation efficiency: NO
3 -removal amount/initial NO
3 -amount.
Claims (6)
1., based on a method for species diversity information separated denitrification desulfurizing bacteria, it is characterized in that it carries out according to following steps:
One, mud sample is gathered from the CGSB of carrying out biological desulphurization denitrogenation of steady running;
Two, the high throughput sequencing technologies adopted carries out group's space structure and enrichment analysis to mud sample, obtains Bio-diversity information; Wherein, described Bio-diversity information refers to: the fluctuation of flora abundance and space ecologicaI distribution information; Simultaneously by the mud gathered in step one by volume for the ratio of 1:5 adds sterilized water, put into granulated glass sphere simultaneously, be shaking culture 24 hours under the condition of 220 revs/min at rotating speed, obtain the suspension of each Pseudomonas;
Three, to after the bacterium liquid dilution of each Pseudomonas of step 2, coat on the solid medium corresponding with each Pseudomonas, then the solid medium that lid is corresponding with this Pseudomonas is watered thereon, making the anaerobism sandwich culfure base of each Pseudomonas, is carry out Anaerobic culturel under the condition of 30 DEG C to produce bubble to substratum interlayer in constant incubator temperature;
Four, the cover part of the anaerobism sandwich culfure base of each Pseudomonas in strip step three, single bacterium colony of each Pseudomonas in picking bubble, proceeds in Liquid segregation substratum corresponding to each Pseudomonas, carries out enlarged culturing, and constant incubator 30 DEG C, culture cycle is 14 days;
Five, get the bacterium liquid that step 4 cultivates rear each Pseudomonas, the solid medium that each Pseudomonas is corresponding carries out plate loop method; Then be placed in constant incubator, carry out being cultured to the single bacterium colony of appearance under 30 DEG C of conditions, single bacterium colony of each Pseudomonas of picking proceeds in liquid culture medium corresponding to each Pseudomonas to be cultivated;
Six, the operation 3 times of repeating step three to step 5, after isolating the single bacterium colony of each Pseudomonas, namely completes the screening being separated denitrification desulfurizing function microorganism from organic waste water biological desulphurization denitrification system; Wherein, following Pseudomonas is comprised in suspension in step 2: Soxhlet Pseudomonas (Thauera sp.), fixed nitrogen Vibrio (Azoarcus sp.), arch bar Pseudomonas (Arcobactersp.), Ochrobactrum (Ochrobactrum sp.), Thiobacillus (Thiobacillus sp.), Thiospirillum (Sulfurimonas sp.), Alkaligenes (Alkaliflexus sp.), Desulfovibrio (Desulfofutls sp.) and ground Bacillaceae (Geoalkalibacter sp.).
2. a kind of method based on species diversity information separated denitrification desulfurizing bacteria according to claim 1, it is characterized in that the CGSB of carrying out biological desulphurization denitrogenation from steady running in step one gathers mud sample, refer to that the CGSB of carrying out biological desulphurization denitrogenation from all reaching the steady running of 99% to carbon organic waste water, nitrogen, amounts of sulphur contaminants clearance gathers mud sample.
3. a kind of method based on species diversity information separated denitrification desulfurizing bacteria according to claim 1, it is characterized in that gathering in step one mud is that the CGSB of carrying out biological desulphurization denitrogenation of never level steady running collects.
4. a kind of method based on species diversity information separated denitrification desulfurizing bacteria according to claim 1, is characterized in that the Bio-diversity information obtained in step 2 refers to the Bio-diversity information obtaining organic waste water biological desulphurization denitrification system.
5. a kind of method based on species diversity information separated denitrification desulfurizing bacteria according to claim 1, is characterized in that solid medium, Liquid segregation substratum and liquid culture medium component that described each Pseudomonas is corresponding are as follows:
The component of the solid medium of Soxhlet Pseudomonas (Thauera sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the acetate solution of 1.0g/L, concentration is the MgSO of 0.1g/L
47H
2o solution, concentration are the NaHCO of 0.5g/L
3solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 0.75g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
4solution; Wherein, the pH of each substratum of Soxhlet Pseudomonas (Thauera sp.) is 8.0;
The component of the solid medium of fixed nitrogen Vibrio (Azoarcus sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the acetate solution of 0.68g/L, concentration is the KNO of 0.63g/L
3solution, concentration are the K of 50mg/L
2hPO
4solution and concentration are the NH of 50mg/L
4cl solution; Wherein, the pH of each substratum of fixed nitrogen Vibrio (Azoarcus sp.) is 8.0;
The component of the solid medium of arch bar Pseudomonas (Arcobacter sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 1.5g/L
2s9H
2solution, concentration are the acetate solution of 1.0g/L, concentration is the MgSO of 0.1g/L
47H
2o solution, concentration are the NaHCO of 0.5g/L
3solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 0.75g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
4solution; Wherein, the pH of each substratum of arch bar Pseudomonas (Arcobacter sp.) is 8.0;
The component of the solid medium of Ochrobactrum (Ochrobactrum sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 1.5g/L
2s9H
2o solution, concentration are the C of 10mg/L
3h
5naO
3solution, concentration are the MgSO of 0.1g/L
47H
2o solution, concentration are the NH of 1.0g/L
4cl solution, concentration are the KNO of 1.0g/L
3solution, concentration are the KH of 1.8g/L
2pO
4solution and concentration are the K of 1.2g/L
2hPO
43H
2o solution; Wherein, the pH of each substratum of Ochrobactrum (Ochrobactrum sp.) is 8.0;
The component of the solid medium of Thiobacillus (Thiobacillus sp.), Liquid segregation substratum and liquid culture medium all comprises: concentration is the Na of 5.0g/L
2s
2o
35H
2o solution, concentration are the K of 2g/L
2hPO
4solution, concentration are the KNO of 2g/L
3solution, concentration are the MgSO of 0.6g/L
47H
2o solution, concentration are the NH of 0.5g/L
4cl solution and concentration are the FeSO of 0.01g/L
47H
2o solution; Wherein, the pH of each substratum of Thiobacillus (Thiobacillus sp.) is 7.6.
6. a kind of method based on species diversity information separated denitrification desulfurizing bacteria according to claim 1, to it is characterized in that in step 3, to after the dilution of the bacterium liquid of step 2 each Pseudomonas, coating on the solid medium corresponding with each Pseudomonas and referring to: get 1mL and be diluted to 10 to each bacterium liquid after step 3 analysis
-4, draw 0.1mL and coat on the solid medium of each Pseudomonas.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410850374.2A CN104450592A (en) | 2014-12-31 | 2014-12-31 | Method for separating denitrification desulfurizing bacteria based on biodiversity information |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410850374.2A CN104450592A (en) | 2014-12-31 | 2014-12-31 | Method for separating denitrification desulfurizing bacteria based on biodiversity information |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104450592A true CN104450592A (en) | 2015-03-25 |
Family
ID=52897351
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410850374.2A Pending CN104450592A (en) | 2014-12-31 | 2014-12-31 | Method for separating denitrification desulfurizing bacteria based on biodiversity information |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450592A (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105219675A (en) * | 2015-10-13 | 2016-01-06 | 田发益 | The isolation cultivation method of a kind of anaerobic bacterium |
| CN107265656A (en) * | 2017-06-09 | 2017-10-20 | 同济大学 | A kind of utilization visible ray cuts down the method that Nano Silver is adversely affected to nitrate removal |
| CN112980417A (en) * | 2021-03-09 | 2021-06-18 | 中国石油大学(北京) | Viscosity protective agent for polyacrylamide solution prepared from oilfield sewage |
| CN113005062A (en) * | 2021-03-24 | 2021-06-22 | 中国科学院成都生物研究所 | Facultative ammonia oxidizing bacteria and application thereof |
| CN114732083A (en) * | 2022-03-07 | 2022-07-12 | 协赛(上海)生物科技有限公司 | Application of Soxhlet |
| CN115927125A (en) * | 2023-02-15 | 2023-04-07 | 知和环保科技有限公司 | Production process of high-load short-cut nitrifying bacteria agent and application method of bacteria agent |
| CN116064302A (en) * | 2022-09-27 | 2023-05-05 | 福建农林大学 | Vibrio bottom desulfurization SG127 and application thereof |
| CN116240135A (en) * | 2023-02-15 | 2023-06-09 | 知和环保科技有限公司 | Production process of high-load heterotrophic denitrifying microbial agent |
| CN116286493A (en) * | 2023-02-15 | 2023-06-23 | 知和环保科技有限公司 | Screening production process of high-load whole-process nitrifying microbial inoculum |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101307353A (en) * | 2008-05-09 | 2008-11-19 | 哈尔滨工业大学 | Screening method of desulfurizing denitrification autotrophic bacteria |
-
2014
- 2014-12-31 CN CN201410850374.2A patent/CN104450592A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101307353A (en) * | 2008-05-09 | 2008-11-19 | 哈尔滨工业大学 | Screening method of desulfurizing denitrification autotrophic bacteria |
Non-Patent Citations (2)
| Title |
|---|
| 于皓: "反硝化脱硫工艺中微生物群落结构及动态分析", 《环境科学》 * |
| 王爱杰: "一株同步脱氮脱硫菌的分离鉴定及其代谢特征", 《哈尔滨工业大学学报》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105219675A (en) * | 2015-10-13 | 2016-01-06 | 田发益 | The isolation cultivation method of a kind of anaerobic bacterium |
| CN107265656A (en) * | 2017-06-09 | 2017-10-20 | 同济大学 | A kind of utilization visible ray cuts down the method that Nano Silver is adversely affected to nitrate removal |
| CN112980417A (en) * | 2021-03-09 | 2021-06-18 | 中国石油大学(北京) | Viscosity protective agent for polyacrylamide solution prepared from oilfield sewage |
| CN113005062A (en) * | 2021-03-24 | 2021-06-22 | 中国科学院成都生物研究所 | Facultative ammonia oxidizing bacteria and application thereof |
| CN114732083A (en) * | 2022-03-07 | 2022-07-12 | 协赛(上海)生物科技有限公司 | Application of Soxhlet |
| CN116064302A (en) * | 2022-09-27 | 2023-05-05 | 福建农林大学 | Vibrio bottom desulfurization SG127 and application thereof |
| CN116064302B (en) * | 2022-09-27 | 2024-03-01 | 福建农林大学 | Vibrio bottom desulfurization SG127 and application thereof |
| CN115927125A (en) * | 2023-02-15 | 2023-04-07 | 知和环保科技有限公司 | Production process of high-load short-cut nitrifying bacteria agent and application method of bacteria agent |
| CN116240135A (en) * | 2023-02-15 | 2023-06-09 | 知和环保科技有限公司 | Production process of high-load heterotrophic denitrifying microbial agent |
| CN116286493A (en) * | 2023-02-15 | 2023-06-23 | 知和环保科技有限公司 | Screening production process of high-load whole-process nitrifying microbial inoculum |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104450592A (en) | Method for separating denitrification desulfurizing bacteria based on biodiversity information | |
| Tang et al. | Performance and mechanism of a novel algal-bacterial symbiosis system based on sequencing batch suspended biofilm reactor treating domestic wastewater | |
| Fito et al. | Microalgae–bacteria consortium treatment technology for municipal wastewater management | |
| CN106754570B (en) | One plant of Pseudomonas stutzeri and its application | |
| CN104673710B (en) | Rhodococcus strain and its application | |
| CN111518715B (en) | Sulfonamide antibiotic synergistic degradation bacteria and application thereof | |
| Wicker et al. | Application of Nordic microalgal-bacterial consortia for nutrient removal from wastewater | |
| CN106399176B (en) | One Bacillus species and its application in terms of purifying water body | |
| AU2019303431B1 (en) | LAS-degrading and/or N-removing bacterium and application thereof | |
| CN106635909B (en) | Crude oil degradation mixed bacteria, microbial inoculum and application thereof | |
| CN106635910B (en) | Brevundimonas defective, microbial inoculum and application thereof | |
| KR102564256B1 (en) | Microorganism producing sulfur and method for preparing sulfur using the same | |
| Peng et al. | Microbiology community changes during the start-up and operation of a photosynthetic bacteria-membrane bioreactor for wastewater treatment | |
| CN106927576B (en) | Method for improving removal effect of nitrogen pollutants in sewage | |
| Abe et al. | Removal of inorganic nitrogen sources from water by the algal biofilm of the aerial microalga Trentepohlia aurea | |
| Fahruddin et al. | Treatment of compost as a source of organic material for bacterial consortium in the removal of sulfate and heavy metal lead (Pb) from acid mine drainage | |
| Talib et al. | Comparative studies on phycoremediation efficiency of different water samples by microalgae | |
| CN105802894B (en) | One pyridine degradation bacterium strain and its application in wastewater treatment containing pyridine | |
| CN114933990B (en) | N-methylpyrrolidone degradation synchronous denitrifying bacterium and application thereof | |
| CN114606131B (en) | Chlorella strain and application thereof in treatment of rare earth ammonia nitrogen wastewater | |
| CN102827786A (en) | Lysinibacillus sp. for degrading S<2-> in petrochemical wastewater | |
| Najib et al. | Developed microbial granules containing photosynthetic pigments for carbon dioxide reduction in palm oil mill effluent | |
| Nga et al. | Enhancement of textile wastewater biodegradation by biofilm formed on carriers by two halo thermophilic photosynthetic purple bacteria | |
| Saidu et al. | Isolation of photosynthetic bacteria from coal mining site having potential for nitrate removal | |
| Zwain et al. | Morphology analysis and microbial diversity in novel anaerobic baffled reactor treating recycled paper mill wastewater |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150325 |