CN104403003A - Gene encoding nicotinamide adenine dinucleotide fluorescent probe and preparation method and application thereof - Google Patents

Abstract

The invention relates to a fluorescent probe encoded by nicotinamide adenine dinucleotide gene and its preparation method and application. On the one hand, the present invention relates to a detection probe for nicotinamide adenine dinucleotide, in particular to a detection probe for a recombinant fluorescent fusion protein of nicotinamide adenine dinucleotide. In one specific aspect, the present invention relates to a recombinant fluorescent fusion protein detection probe of reduced nicotinamide adenine dinucleotide (NADH); in another specific aspect, the present invention relates to oxidized nicotinamide adenine dinucleotide (NADH) NAD+) recombinant fluorescent fusion protein detection probe; In yet another aspect, the present invention relates to a recombinant fluorescent fusion protein detection probe for the ratio of reduced and oxidized nicotinamide adenine dinucleotide. The present invention also relates to the preparation method of the above detection probe and its application in detecting NADH, NAD+ and NADH/NAD+ ratio respectively.

Description

Gene-encoded nicotinamide adenine dinucleotide fluorescent probe and its preparation method and application

This application is the application number 201110288807.6, the application date is September 26, 2011, and it is a divisional application of the invention patent application named "nicotinamide adenine dinucleotide gene-encoded fluorescent probe and its preparation method and application". The entire content of the parent case is hereby incorporated by reference in its entirety for all purposes.

technical field

The invention relates to a detection probe for nicotinamide adenine dinucleotide, in particular to a detection probe for a recombinant fluorescent fusion protein of nicotinamide adenine dinucleotide. In one specific aspect, the present invention relates to a recombinant fluorescent fusion protein detection probe of reduced nicotinamide adenine dinucleotide (NADH); in another specific aspect, the present invention relates to oxidized nicotinamide adenine dinucleotide (NADH) NAD+) recombinant fluorescent fusion protein detection probe; In yet another aspect, the present invention relates to a recombinant fluorescent fusion protein detection probe for the ratio of reduced and oxidized nicotinamide adenine dinucleotide. The present invention also relates to the preparation method of the above detection probe and its application in detecting NADH, NAD+ and NADH/NAD+ ratio respectively.

Background technique

As coenzymes, NAD ⁺ and NADH are an important part of the respiratory chain, and they participate in the electron transfer process in the respiratory chain (Rich, PR, etc., Biochem Soc Trans.2003, V.31(6), pp.1095-1105) . In the redox reaction of the respiratory chain, NAD ⁺ is the carrier of the proton. When it accepts an electron from other molecules, it changes from the initial oxidation state to the reduction state. The final product of this reaction is NADH, and NADH can Donates electrons to other molecules as a reducing agent (Belenky, P. et al., Trends in Biochemical Sciences. 2007, V.32(1), pp.12-19). Recent studies have shown that NAD(H) is not only involved in energy metabolism, material synthesis and anti-oxidation, but also involved in calcium homeostasis, gene expression, immune function, cell aging and death, etc., and NAD(H) is involved in Both play a vital role, so NAD(H) itself and the many enzymes involved in its metabolism have also become targets for drug design (Sauve, AA, etc., J Pharmacol Exp Ther.2008, V.324(3), pp. 883-893).

However, the total amount of NAD(H) in most living cells is about 10 ^-6 M ~ 10 ^-3 M, and the ratio of NAD ⁺ /NADH varies with different intracellular states (Lin, SJ et al. , Current Opinion in Cell Biology.2003, V.15(2), pp.241-246), so this brings great inconvenience to the determination of NAD(H). The earlier detection method is mainly based on the characteristic absorption of NADH in the 340nm ultraviolet region, thus establishing the ultraviolet spectrophotometric method. There are two main defects in this method: 1. The effective sensitivity is limited by the precision of the instrument, which is about 10 ^-7 M; 2. In a complex system, NADH and NADPH cannot be effectively distinguished. Subsequently, according to the characteristics of NAD ⁺ as a coenzyme, which accepts electrons and transforms into NADH in the process of electron transfer, a series of enzymatic detection methods were developed. Other methods such as HPLC analysis, electrochemical method, capillary electrophoresis, and fluorescence imaging are also commonly found in various literature reports. However, most methods either have insufficient sensitivity for target molecules in single cells or cannot perform subcellular organelle localization. In particular, it should be pointed out that there is a major defect in these existing methods, that is, the sample needs to be cracked, separated, purified, etc., and NADH itself is extremely easy to oxidize, and errors are easily introduced in a series of tedious operations. , resulting in discrepancies between the final displayed results and the actual existence. In addition, these existing methods cannot be applied to living animals or cells, and cannot be detected in real time, which limits the application of these methods in the fields of clinical disease diagnosis and drug precursor research. At present, only NADH autofluorescence can be used to detect in vivo or cells (Zhang, QH et al., Science.2002, V.295(5561), pp.1895-1897), and this traditional method has the following serious defects: It is known that cells regulate NAD ⁺ /NADH and NADP ⁺ /NADPH relatively independently. Under normal conditions, the ratio of NAD ⁺ /NADH is about 700:1, while the ratio of NADP+/NADPH is 1:200; secondly, their There is a huge difference in redox potential, which reflects that NADH and NADPH play distinct roles in energy metabolism and anabolism, respectively; third, NADH and NADPH autofluorescence are completely indistinguishable, and the results obtained by imaging measurements using autofluorescence is the sum of NADH and NADPH. Since the content of NADH is very low and most of it exists in protein-bound form, the NADH autofluorescence data essentially reflects the concentration of protein-bound NADPH (Zhang, QH, etc., Science.2002, V.295( 5561), pp.1895-1897); Fourth, because the NADH excitation wavelength is in the ultraviolet region (340nm) and the autofluorescence is weak, complex and expensive instruments such as the CritiView for clinical monitoring are required, and the ultraviolet light is used for tissue These optical properties severely limit the application of autofluorescence monitoring.

Therefore, there is an urgent need in this field to develop a specific NADH detection technology, especially a specific NADH detection technology suitable for physiological and subcellular levels.

Compared with the traditional small molecule dye detection technology and the rapidly developing quantum dot detection technology, the fluorescent protein detection technology has a unique overwhelming advantage in most live cell imaging. It can be genetically introduced into cells, tissues and even whole organs. Therefore, fluorescent proteins can be used as whole-cell markers or indicators of gene activation.

Green fluorescent protein was originally extracted from Aequorea victoria. The wild-type AvGFP consists of 238 amino acids and has a molecular weight of about 26kD. Current research has confirmed that the three amino acids Ser-Tyr-Gly at positions 65-67 in the natural GFP protein can spontaneously form a fluorescent chromophore: p-hydroxybenzylideneimidazolinone, which is Its main luminous position. The spectral characteristics of wild-type AvGFP are very complex, the main peak of its fluorescence excitation is at 395nm, and there is another auxiliary peak at 475nm, the amplitude of the latter is about 1/3 of the former. Under standard solution conditions, excitation at 395nm produces emission at 508nm, while excitation at 475nm produces a maximum emission wavelength at 503nm (Heim, R. et al., Proc Natl Acad Sci U S A.1994, V.91 (26), pp. 12501-12504).

With the deepening of research on GFP protein mutations, using molecular biology techniques, a variety of outstanding GFP derivatives have been developed. By performing different single-point mutations or combinations on the basis of wild-type GFP, such as enhanced Type GFP (S65T, F64L), YFP (T203Y), CFP (Y66W), etc. With the help of the rearrangement of the GFP protein sequence, the original 145-238 amino acid part is used as the N-terminal of the new protein, and the original 1-144 amino acid is used as the C-terminal of the new protein. Peptide chains are connected to form a circular permutation fluorescent protein (circular permutation fluorescent protein) that is sensitive to spatial changes. On this basis, the point mutation of the original protein T203Y forms a circular permutation of yellow fluorescent protein cpYFP (Nagai, T. etc., Proc Natl Acad Sci U S A.2001, V.98(6), pp.3197-3202).

Due to the increasingly in-depth research on fluorescent proteins, some related fluorescence-based analysis and detection technologies have also been further developed. For example, the currently commonly used fluorescence resonance energy transfer (FRET) technology, the main principle of this technology is that when two fluorescent chromophores are close enough, when the donor molecule absorbs photons of a certain frequency, it is excited to a higher electronic energy state. , before the electron returns to the ground state, the energy is transferred to the adjacent acceptor molecule through the dipole interaction (that is, energy resonance transfer occurs). FRET is a non-radiative energy transition. Through the electric dipole interaction between molecules, the energy of the excited state of the donor is transferred to the excited state of the acceptor, so that the fluorescence intensity of the donor is reduced, and the acceptor can emit stronger than itself The characteristic fluorescence (sensitized fluorescence) can also not fluoresce (fluorescence quenching). Further research on the current GFP found that cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP), derived from GFP mutants, are a well-performing donor/acceptor pair. The emission spectrum of CFP overlaps considerably with the absorption spectrum of YFP. When they are close enough, the chromophore of CFP will resonantly transfer energy to the chromophore of YFP when excited by the absorption wavelength of CFP. , so the emission fluorescence of CFP will weaken or disappear, and the main emission will be the fluorescence of YFP. The energy conversion efficiency between two chromophores is inversely proportional to the sixth power of the spatial distance between them, and is very sensitive to changes in spatial position. Therefore, existing research reports use genetic engineering recombination methods to fuse the two ends of the desired protein gene with CFP and YFP to express a brand new fusion protein. Fluorescence changes are visualized visually.

Therefore, the fluorescent protein sequence used herein can be derived from the fluorescent protein of Aequoreavictoria and its derivatives, including but not limited to these mutants: yellow fluorescent protein (YFP), green fluorescent protein (GFP), The sequence of cyan fluorescent protein (CFP), etc., wherein the sequence of yellow fluorescent protein YFP is preferred, and the sequence of yellow fluorescent protein cpYFP arranged in a circle is more preferred.

Another protein involved in this technology, YdiH protein (also known as Rex protein) is a bacterial transcriptional repressor protein known in the art, with a molecular weight of 23kDa, which can regulate fermentation and anaerobic respiration. Common YdiH proteins are from Thermus aquaticus (SEQ ID NO: 1 NCBI GenBank: AF061257.1), Streptomyces coelicolor (SEQ ID NO: 2 NCBI GenBank: AL939116.1) or Bacillus subtilis (Bacillus subtilis) (SEQ ID NO: 3NCBIGenBank: AL009126.3), the YdiH protein was first identified in Streptomyces coelicolor by Brekasis and Paget et al. in 2003. It is a widely present in A redox-sensitive regulatory protein in Gram-positive bacteria. The study on YdiH(Rex) protein of Streptomyces coelicolor (S.coelicolor) showed that it is a typical NAD(H) binding protein containing Rossmann domain. Among them, the key Rossmann domain is a protein super secondary structure mainly present in nucleotide binding proteins, which is a typical cofactor NAD(H) binding domain, represented by various cofactor NAD binding proteins. The structure mainly consists of six β-sheets in an ordered β-α-β-α-β form through 2 pairs of α-helices. Because each Rossmann domain can only bind one nucleotide molecule, there are two paired Rossmann moieties in the domain of dinucleotide binding proteins like NAD. The current study shows that the YdiH(Rex) protein of Streptomyces coelicolor can directly sense the change of cytoplasmic NADH/NAD ⁺ ratio, and under aerobic environment, when the intracellular NADH/NAD ⁺ ratio is at a low level, the YdiH(Rex) protein It can inhibit the transcription of its target genes (cydABC, nuoA-D and rexhemACD), and the increase of NADH/NAD ⁺ ratio can make Rex dissociate from its operator site. During this dynamic process, the YdiH(Rex) protein The spatial conformation will change with the environment (Brekasis, D. et al., EMBO J.2003, V.22(18), pp.4856-4865). So Rex protein is a good candidate for intracellular NADH detection probe. At the same time, Wang et al. recently crystallized the Bacillus subtilis YdiH (Rex) protein and conducted some studies on its mechanism of action and function. The results showed that the YdiH (Rex) protein derived from Bacillus subtilis is a homodimeric protein , consists of two functional domains, in which the N-terminal domain (residues 1-85) is a DNA binding domain, while the C-terminal domain (residues 86-215) is a typical Rossmann fold, which can Binds NADH (Wang, E. et al., Mol Microbiol. 2008, V.69(2), pp.466-478).

Although the YdiH (Rex) protein itself is sensitive to the redox state in the environment, its own changes cannot be displayed intuitively and captured by the outside world. With the help of the fluorescent protein tool, we can use the The two are fused and expressed to obtain a brand-new gene-encoded fluorescent probe, which uses the YdiH (Rex) protein to sense changes in the redox state in the environment and transmits this change to the fluorescent protein, which produces fluorescence and fluorescence The intensity of the redox state in the environment is described in real time and intuitively.

In summary, we believe that the use of recombinant fluorescent fusion proteins containing YdiH proteins can meet the urgent needs of detecting NADH at the physiological and subcellular levels.

Citation or discussion of references described herein should not be construed as an admission that such references are prior art to the present invention.

Contents of the invention

When specific sequence information is mentioned below and in the claims of this application, the numbers listed after each "SEQ ID No" are the parent case: the sequence number in Chinese patent application 201110288807.6. Due to content deletion, the numbers of related sequences in the sequence listing submitted by this application have been adjusted, and the specific corresponding relationship is shown in the following table.

In one aspect, the present invention provides a genetically encoded NADH fluorescent probe, which contains a polypeptide sensitive to NADH in the environment and a part that expresses NADH in the environment through changes in spectral properties. In one embodiment, the part that expresses NADH in the environment through changes in spectral properties is a fluorescent protein sequence or a derivative thereof. In another embodiment, the polypeptide sensitive to NADH is a polypeptide having the following characteristics, or a functional fragment thereof or an NADH binding domain:

(1) a Rossman domain with NADH binding properties; and/or

(2) Derived from NADH-sensitive transcriptional regulator Rex family proteins.

In a preferred embodiment, the polypeptide sensitive to NADH may have the following characteristics:

(1) A polypeptide containing the transcription regulator Rex protein gene ydiH from bacteria, the coding sequence of the polypeptide can be SEQ ID No: 1, 2 or 3;

(2) any homologous or non-homologous sequence having 95% identity with the sequence described in (1) within at least 85 amino acid residues;

(3) any homologous or non-homologous sequence having 90% identity with the sequence described in (1) within at least 85 amino acid residues;

(4) any homologous or non-homologous sequence having 70% identity with the sequence described in (1) within at least 85 amino acid residues;

(5) any homologous or non-homologous sequence having 50% identity with the sequence described in (1) within at least 85 amino acid residues;

(6) any homologous or non-homologous sequence having 40% similarity to the sequence described in (1) within at least 85 amino acid residues; or

(7) Any homologous or non-homologous sequence having 35% similarity to the sequence described in (1) within at least 85 amino acid residues.

In another embodiment, the fluorescent probe of the present invention may comprise a Rossman domain B with NADH binding properties and fluorescent protein sequences A, A1 and/or A2, and the combination thereof may be:

(1) B-A-B;

(2) B-A-B-B;

(3) A1-B-A2, wherein A1 and A2 can be the same or different; A1 can be the amino acid sequence of a fluorescent protein or a derivative thereof from Aequorea victoria, and A2 can be the amino acid sequence of a fluorescent protein from Aequorea victoria The amino acid sequence of another fluorescent protein or derivative thereof;

(4) First part of B-A-Second part of B; where A is inserted within the flexible region of B, thus dividing B into first part of B and second part of B, first part of B and second part of B constitute the complete B domain; or

(5) First part of B-A-Second part of B-B; where A is inserted in the flexible region of B, thus dividing B into first part of B and second part of B, first part of B and second part of B The two parts constitute the complete B domain.

In yet another embodiment, the fluorescent probe of the present invention may also have the following structure:

A ₁ -B ₁ -connector ₁ -FM-connector ₂ -B ₂ ,

Wherein, _A1 is the first structural domain of YdiH protein, preferably comprises the amino acid 1-84 (SEQ ID NO: 14) of the aminoacid sequence of the amino acid sequence of Bacillus subtilis YdiH protein or the amino acid of the aminoacid sequence of the thermophilic bacteria YdiH protein 1-79 (SEQ ID NO: 15) or variant thereof; B ₁ is the second domain of the YdiH protein, preferably comprising amino acid 85-194 (SEQ ID NO: 16) of the amino acid sequence of the Bacillus subtilis YdiH protein or Amino acids 80-189 (SEQ ID NO: 17) or variants thereof of the amino acid sequence of the Thermophylla YdiH protein; _B2 is the third domain of the YdiH protein, preferably comprising the amino acid sequence of the Bacillus subtilis YdiH protein Amino acids 120-215 (SEQ ID NO: 18) or amino acids 114-211 (SEQ ID NO: 19) of the amino acid sequence of the Thermophilic genus YdiH protein or variants thereof;

FM is a fluorophore, which can be YFP, GFP, CFP, etc. and variants based on these proteins, preferably YFP, more preferably cpYFP;

Linker ₁ may or may not be present; when present, Linker ₁ may be any amino acid sequence, preferably not more than 4 amino acids in length, for example comprising amino acids T, S, A, G or consisting of any 1 to 4 of these four amino acids Any combination of , such as amino acid sequence SAG or TS, etc., but not limited to such a combination;

Linker ₂ may or may not be present; when present, linker ₂ may be any amino acid sequence, preferably no more than 3 amino acids in length, for example comprising amino acids G, T, G or any sequence consisting of any 1 to 4 of these four amino acids. Combinations, for example, include the amino acid sequence GTG, but are not limited to such combinations.

In one embodiment, the present invention also provides a fluorescent probe comprising a fluorophore and YdiH protein or any fragment, derivative or analog of YdiH protein. In another embodiment, the present invention also provides a fluorescent probe comprising a fluorophore and a variant of YdiH protein. The present invention also provides a fluorescent probe comprising a fluorophore and a soluble fragment of YdiH protein.

In another embodiment, the present invention also provides a genetically encoded NAD+ fluorescent probe, which contains a polypeptide sensitive to NAD+ in the environment and a part that expresses NAD+ in the environment through changes in spectral properties. In a specific embodiment, the NAD+ fluorescent probe comprises SEQ ID NO: 129.

In yet another embodiment, the present invention also provides a genetically encoded NADH/NAD+ ratio fluorescent probe, which contains a polypeptide sensitive to the NADH/NAD+ ratio in the environment, and changes the NADH/NAD+ ratio in the environment by changing the spectral properties. The NAD+ ratio performs the performance part. In a specific embodiment, the NADH/NAD+ ratio fluorescent probe comprises SEQ ID NO: 148.

In another aspect, the present invention provides a fusion protein comprising the fluorescent probe of the present invention. In one embodiment, the fusion protein comprises the fluorescent probe of the present invention and various specific subcellular localization signals, and the localization signals can localize the target protein in specified subcellular organelles.

In another aspect, the present invention provides a nucleic acid sequence comprising a nucleotide sequence encoding the fluorescent probe or fusion protein of the present invention. In a specific embodiment, the present invention provides a nucleic acid sequence comprising a nucleotide sequence encoding a fluorescent protein and a nucleotide sequence encoding a protein sensitive to NADH.

In a preferred embodiment, the nucleotide sequence encoding a protein sensitive to NADH is a nucleotide sequence encoding a polypeptide having the following characteristics or a functional fragment thereof or an NADH binding domain:

(1) a Rossman domain with NADH binding properties; and/or

(2) Derived from NADH-sensitive transcriptional regulator Rex family proteins.

In another preferred embodiment, the nucleic acid sequence of the present invention may comprise the coding sequence b of the Rossman domain with NADH binding properties and the coding sequence a, a1 and/or a2 of the fluorescent protein, and the combination thereof may be:

(1) b-a-b;

(2) b-a-b-b;

(3) a1-b-a2, wherein a1 and a2 can be the same or different; a1 can be the coding sequence of a fluorescent protein or a derivative thereof from Aequorea victoria, and a2 can be from Aequorea victoria the coding sequence of another fluorescent protein or derivative thereof;

(4) The first part of b-a-the second part of b; where a is inserted in the flexible region of b, thus dividing b into the first part of b and the second part of b, the first part of b and the second part of b Partially constitutes the complete b domain;

(5) The first part of b-a-the second part of b-b; where a is inserted in the flexible region of b, thus dividing b into the first part of b and the second part of b, the first part of b and the The second part constitutes the complete b-domain.

The present invention also relates to complementary sequences and variants of the aforementioned nucleic acid sequences, which may include nucleic acid sequences or complementary sequences encoding fragments, analogs, derivatives, soluble fragments and variants of the fluorescent probe or fusion protein of the present invention.

In yet another aspect, the present invention also provides an expression vector comprising the nucleic acid sequence of the present invention operably linked to an expression control sequence. The expression control sequence may be an origin of replication, a promoter, an enhancer, an operator, a terminator, a ribosome binding site, and the like.

In yet another aspect, the present invention also provides a host cell comprising the expression vector of the present invention.

In yet another aspect, the present invention also provides a method for preparing the fluorescent probe or fusion protein of the present invention, comprising the following steps:

a. transferring the expression vector of the present invention into a host cell,

b. culturing said host cell under conditions suitable for expression by said host cell, and

c. Isolating said fluorescent probe or fusion protein from said host cell.

The present invention also provides the application of the fluorescent probe or fusion protein of the present invention in detecting NADH. In one embodiment, the present invention provides the application of the fluorescent probe or fusion protein of the present invention in detecting NADH in vitro or in vivo. In one embodiment, the present invention provides the application of the fluorescent probe or fusion protein of the present invention in the detection of NADH at the subcellular level. In one embodiment, the present invention provides the application of the fluorescent probe or fusion protein of the present invention in in situ detection of NADH. In another embodiment, the present invention provides the application of the fluorescent probe or fusion protein of the present invention in screening drugs that can be used to regulate the NADH level of a subject. In another embodiment, the present invention provides the use of the fluorescent probe or fusion protein of the present invention in the diagnosis of diseases that are related to NADH levels.

The present invention also provides a kit for detecting NADH, which contains the fluorescent probe or fusion protein of the present invention. The detection can be performed at the in vivo, in vitro, subcellular or in situ level. The present invention also provides a kit for screening drugs that can be used to regulate the NADH level of a subject, and the kit includes an effective amount of the fluorescent probe or fusion protein of the present invention. The present invention also provides a kit for detecting diseases related to NADH level, said kit comprising an effective amount of the fusion protein of the present invention. In use, those skilled in the art can conveniently determine the effective amount according to the activity of the fusion protein.

The proteins and nucleic acid sequences of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

Description of drawings

The present invention will be further described below in conjunction with drawings and embodiments.

Figure 1 SDS-PAGE identification of F-rex2 isolated and purified from Escherichia coli (E.coli).

Figure 2 shows the basic spectral characteristics of the fluorescent probe F-rex2 of nicotinamide adenine dinucleotide.

Figure 3-1 shows the response characteristics of the reducing and oxidizing nicotinamide adenine dinucleotide ratio probes to the binding of NADH and NAD ⁺ .

Figure 3-2 is the measurement results of different ratios of NADH and NAD ⁺ by reducing and oxidizing nicotinamide adenine dinucleotide ratio probes.

Figure 3-3 is the detection of the influence of various pyridine nucleotide analogues on the NADH/NAD+ ratio probe under simulated physiological conditions in vitro.

Detailed ways

I. Definition:

As used herein, the term "about" when a value or range is given means that the value or range is within 20%, within 10%, and within 5% of the given value or range.

As used herein, the terms "comprising", "comprising" and their equivalents include the meanings of "containing" and "consisting of", for example a composition "comprising" X may consist solely of X or may contain other substances, such as X+ Y.

In the present invention, the term "YdiH protein" means that YdiH protein (also known as Rex protein) is a bacterial transcriptional repressor protein known in the art, with a molecular weight of 23 kDa, which can regulate fermentation and anaerobic respiration. This is a redox-sensitive regulatory protein widely present in Gram-positive bacteria, and is a typical NAD(H)-binding protein containing a Rossmann domain. Among them, the key Rossmann domain is a protein super secondary structure mainly present in nucleotide-binding proteins, and is a typical active region that binds the cofactor NAD(H), represented by various cofactor NAD-binding proteins. The structure mainly consists of six β-sheets in an ordered β-α-β-α-β form through 2 pairs of α-helices. Because each Rossmann domain can only bind one nucleotide molecule, there are two paired Rossmann moieties in the domain of dinucleotide binding proteins like NAD. YdiH(Rex) protein can directly sense the change of cytoplasmic NADH/NAD ⁺ ratio, and under aerobic environment, when the intracellular NADH/NAD ⁺ ratio is at low level, YdiH(Rex) protein can repress its target gene (cydABC , nuoA-D and rexhemACD), and the increase of NADH/NAD ⁺ ratio can make Rex dissociate from its operator site. In this dynamic process, the spatial conformation of YdiH (Rex) protein will change with the environment change to change. The "YdiH protein" involved in the present invention may comprise the amino acid sequence encoded by the nucleotide sequence SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3. The "flexible region" involved in the present invention refers to some specific structures such as Loop domains in the high-level structure of proteins. Compared with other high-level protein structures, these domains have higher mobility and flexibility, and can This leads to dynamic changes in the structural domains, and the protein also has a tendency to greatly change the spatial conformation in these regions. The flexible region involved in the present invention mainly refers to the V113-G119 region and the D188-G192 region of T-rex (ie, the protein Rex derived from Thermus aquaticus).

The term "fluorescent probe" as used herein refers to a polypeptide sensitive to NADH in the environment fused with a fluorescent protein. The polypeptide sensitive to NADH in the environment can specifically be a YdiH protein, which utilizes the specific NADH binding structure Rossman in YdiH The conformational change of the fluorescent protein caused by the conformational change after the binding of the structural domain to NADH leads to the generation or disappearance of the fluorescence or the change of the generated fluorescence, and a standard curve is drawn with the fluorescence of the fluorescent protein measured at different NADH concentrations to detect And analyze the presence and/or level of NADH.

The term "fusion protein" as used herein is synonymous with "fluorescent fusion protein" and "recombinant fluorescent fusion protein", and refers to an amino acid sequence comprising a first polypeptide or protein or a fragment, analog or derivative thereof, and a heterologous polypeptide or protein (ie, a polypeptide or protein having an amino acid sequence different from that of a first polypeptide or protein or a fragment, analog or derivative thereof). In one embodiment, the fusion protein comprises a fluorescent protein fused to a heterologous protein, polypeptide or peptide. According to this embodiment, the heterologous protein, polypeptide or peptide may or may not be a different type of fluorescent protein. In one embodiment, the fusion protein maintains or increases the activity compared to the activity of the original polypeptide or protein prior to fusion to the heterologous protein, polypeptide or peptide. In a specific embodiment, the fusion protein comprises a fluorescent probe fused to a heterologous protein, polypeptide or peptide, which may be a specific subcellular localization signal.

The term "fluorophore" as used herein is synonymous with "fluorescent protein" and refers to a protein that fluoresces by itself or under illumination. Fluorescent proteins are often used as detection methods, such as the green fluorescent protein GFP commonly used in the field of biotechnology and BFP, CFP, YFP, cpYFP, etc. derived from mutations of this protein.

The term "GFP" used herein refers to green fluorescent protein, which was originally extracted from Aequorea victoria. The wild-type AvGFP consists of 238 amino acids and has a molecular weight of about 26kD. Its amino acid sequence is SEQ ID No: 20 . Current research has confirmed that the three amino acids Ser-Tyr-Gly at positions 65-67 in the natural GFP protein can spontaneously form a fluorescent chromophore: p-hydroxybenzylideneimidazolinone, which is Its main luminous position. The spectral characteristics of wild-type AvGFP are very complex, the main peak of its fluorescence excitation is at 395nm, and there is another auxiliary peak at 475nm, the amplitude of the latter is about 1/3 of the former. Under standard solution conditions, excitation at 395nm produces emission at 508nm, while excitation at 475nm produces a maximum emission at 503nm.

The term "YFP" used herein refers to yellow fluorescent protein, which is derived from the green fluorescent protein GFP, and its amino acid sequence is more than 90% homologous to GFP. Compared with GFP, the key change of YFP is that the 203rd amino acid is mutated by threonine It is tyrosine (T203Y). Compared with the original AvGFP, the wavelength of the main excitation peak of YFP was red-shifted to 514nm and the emission wavelength was changed to 527nm. On this basis, site-directed mutation (S65T) of the 65th amino acid of YFP can obtain the fluorescence-enhanced yellow fluorescent protein EYFP, and the typical amino acid sequence of EYFP is SEQ ID No: 21. For the rearrangement of the EYFP protein sequence, the original 145-238 amino acid part is used as the N-terminal of the new protein, and the original 1-144 amino acid is used as the C-terminal of the new protein, and a small flexible short peptide is passed between the two fragments The chain VDGGSGGTG is connected to form a circular permutation yellow fluorescent protein cpYFP (circular permutation yellow fluorescent protein) that is sensitive to spatial changes. The typical amino acid sequence of cpYFP is SEQ ID No: 22.

In the present invention, the YdiH protein fused with a fluorophore can be the full length or fragment thereof of a natural YdiH protein isolated from Bacillus subtilis or thermophilic bacteria or Streptomyces coelicolor, preferably a natural Bacillus subtilis YdiH protein Amino acid 1-215 of or the amino acid 1-211 of the thermophilic genus YdiH protein or the amino acid 1-259 of the Streptomyces coelicolor genus YdiH protein, more preferably the amino acid 1-215 of the subtilis genus YdiH protein or the thermophilic Amino acids 1-211 of the Phytophthora YdiH protein.

"Linker" refers to an amino acid or nucleic acid sequence that joins two parts in a polypeptide, protein or nucleic acid of the invention. When connecting in the polypeptide or protein of the present invention, the length of the linker is not more than 6 amino acids, preferably not more than 4 amino acids, more preferably 3 amino acids. When linking is performed in the nucleic acid of the present invention, the length of the linker is not more than 18 nucleotides, preferably not more than 12 nucleotides, more preferably 9 nucleotides.

When referring to a certain polypeptide or protein, the term "variant" used in the present invention includes variants that have the same function of the polypeptide or protein but have different sequences. These variants include (but are not limited to): one or more deletions, insertions and/or substitutions (usually 1-30, preferably 1-20, more preferably 1-10, preferably 1-5) amino acids, and one or several (usually within 20, preferably within 10, more preferably 5) added at its C-terminal and/or N-terminal within 1) amino acid sequence obtained. For example, in this field, substitutions with amino acids with similar or similar properties generally do not change the function of the polypeptide or protein. In this field, amino acids with similar properties often refer to amino acid families with similar side chains, which have been clearly defined in this field. These families include amino acids with basic side chains (e.g. lysine, arginine, histidine), amino acids with acidic side chains (e.g. aspartic acid, glutamic acid), Amino acids with side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with beta-branched side chains (e.g. threonine, valine, isoleucine) and amino acids with aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). For another example, adding one or several amino acids at the C-terminus and/or N-terminus usually does not change the function of the polypeptide or protein. Those skilled in the art know that in gene cloning operations, it is often necessary to design suitable restriction sites, which inevitably introduces one or more irrelevant residues at the end of the expressed polypeptide or protein, which does not affect the purpose Activity of polypeptide or protein. Another example is to construct a fusion protein, promote the expression of a recombinant protein, obtain a recombinant protein that is automatically secreted outside the host cell, or facilitate the purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminal, C-terminal or the recombinant protein. Within other suitable regions within the protein, for example, including but not limited to, suitable linker peptides, signal peptides, leader peptides, terminal extensions, glutathione S-transferase (GST), maltose E binding protein, protein A, such as 6His or Flag tag, or proteolytic enzyme site for factor Xa or thrombin or enterokinase. Variants of polypeptides or proteins may include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, those capable of hybridizing to the DNA of the polypeptide or protein under high or low stringency conditions Polypeptide or protein encoded by DNA, and polypeptide or protein obtained by using antiserum against said polypeptide or protein. These variants may also comprise at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98% sequence identity to the polypeptide or protein. %, at least about 99%, or 100% of the polypeptide or protein.

In two or more polypeptide or nucleic acid molecule sequences, the term "identity" or "identity percentage" refers to the comparison window or specified region, using methods known in the art such as sequence comparison algorithms, by manual alignment and visual inspection Two or more sequences or subsequences that are identical or in which a specified percentage of amino acid residues or nucleotides are identical (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% the same). For example, preferred algorithms suitable for determining percent sequence identity and percent sequence similarity are the BLAST and BLAST 2.0 algorithms, see Altschul et al. (1977) Nucleic Acids Res. 25:3389 and Altschul et al. (1990) J. Mol. Biol. 215:403.

The term "soluble fragment" as used herein generally refers to at least about 10 contiguous amino acids, usually at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, of the full-length sequence of the protein. Amino acids, optimally stretches of at least about 100 contiguous amino acids.

The terms "functional fragment", "derivative" and "analogue" used herein refer to a protein that substantially maintains the same biological function or activity as the native YdiH of the present invention. The functional fragments, derivatives or analogs of YdiH of the present invention may be (i) proteins having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acids The residue may or may not be encoded by the genetic code, or (ii) the protein has a substitution group in one or more amino acid residues, or (iii) the mature protein is combined with another compound (such as a compound that extends the half-life of the protein , such as polyethylene glycol), or (iv) an additional amino acid sequence fused to the protein sequence (such as a leader or secretory sequence or a sequence or proprotein sequence used to purify the protein, Or the fusion protein formed with the antigen IgG fragment). Based on the teaching herein, these functional fragments, derivatives and analogs are within the scope of those skilled in the art.

The difference between the analogue and the natural YdiH protein may be the difference in the amino acid sequence, or the difference in the modified form that does not affect the sequence, or both. These proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by radiation or exposure to mutagens, but also by site-directed mutagenesis or other techniques known in molecular biology.

The analogs also include analogs with residues other than natural L-amino acids (eg, D-amino acids), and analogs with non-naturally occurring or synthetic amino acids (eg, β, γ-amino acids). It should be understood that the YdiH protein of the present invention is not limited to the representative proteins, fragments, derivatives and analogs listed above. Modified (usually without altering primary structure) forms include: chemically derivatized forms of proteins such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those produced by glycosylation modifications during protein synthesis and processing or during further processing steps. This modification can be accomplished by exposing the protein to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylation enzyme. Modified forms also include sequences with phosphorylated amino acid residues (eg, phosphotyrosine, phosphoserine, phosphothreonine). Also included are proteins that have been modified to increase their resistance to proteolysis or to optimize solubility.

The term "nucleic acid" as used in the present invention may be in the form of DNA or RNA. Forms of DNA include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be either the coding strand or the non-coding strand.

As used herein, the term "variant" when referring to a nucleic acid may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include degenerate variants, substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a nucleic acid, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of its encoded protein. Nucleic acids of the invention may comprise at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, At least about 99% or 100% nucleotide sequence.

As used herein, the term "hybridizes under stringent conditions" is used to describe hybridization and wash conditions typically under which nucleotide sequences that are at least 60% homologous to each other can still hybridize to each other. Preferably, stringent conditions are those under which sequences having at least 65%, more preferably at least 70%, and even more preferably at least 80% or more homology to each other generally still hybridize to each other. Such stringent conditions are well known to those of ordinary skill in the art. A preferred, non-limiting example of stringent conditions is: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2×SSC, 0.1% SDS, 0° C.; or (2) hybridization with With denaturant, 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42°C, etc.; or (3) only the identity between the two sequences is at least 90%, better Hybridization occurs when it is more than 95%.

The present invention also relates to nucleic acid fragments that hybridize to the above-mentioned sequences. As used herein, a "nucleic acid fragment" is at least 15 nucleotides in length, preferably at least 30 nucleotides in length, more preferably at least 50 nucleotides in length, most preferably at least 100 nucleotides in length. Nucleic acid fragments can be used in nucleic acid amplification techniques (eg, PCR).

The full-length sequence or fragments of the fluorescent probe or fusion protein of the present invention can usually be obtained by PCR amplification, recombination or artificial synthesis. For the PCR amplification method, primers can be designed according to the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequence, and the cDNA prepared by a commercially available cDNA library or a conventional method known to those skilled in the art can be used. The library is used as a template to amplify related sequences. When the sequence is long, it is often necessary to carry out two or more PCR amplifications, and then splice together the amplified fragments in the correct order.

Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. Usually, it is cloned into a vector, then transformed into a cell, and then the relevant polypeptide or protein is obtained by isolating and purifying from the proliferated host cell by conventional methods.

In addition, related sequences can also be synthesized by artificial synthesis, especially when the fragment length is relatively short. Often, fragments with very long sequences are obtained by synthesizing multiple small fragments and then ligating them.

At present, the DNA sequence encoding the protein of the present invention (or its fragments, derivatives, analogs or variants) can be obtained completely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (such as vectors) and cells known in the art. Mutations can be introduced into the protein sequence of the present invention by methods such as mutation PCR or chemical synthesis.

As used herein, the terms "expression vector" and "recombinant vector" are used interchangeably and refer to prokaryotic or eukaryotic vectors well known in the art, such as bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenovirus, Retroviral or other vectors, which are capable of replicating and stabilizing in the host, an important feature of these recombinant vectors is that they usually contain expression control sequences. The term "expression control sequence" as used herein refers to elements that regulate the transcription, translation and expression of the gene of interest that can be operably linked to the gene of interest, and can be an origin of replication, a promoter, a marker gene or a translation control element, including enhancers, operators , terminator, ribosome binding site, etc., the choice of expression control sequence depends on the host cell used. Recombinant vectors suitable for use in the present invention include, but are not limited to, bacterial plasmids. In a recombinant expression vector, "operably linked" means that a nucleotide sequence of interest is linked to a regulatory sequence in a manner that allows expression of the nucleotide sequence. Those skilled in the art are familiar with methods that can be used to construct expression vectors containing the fusion protein coding sequences of the present invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology and the like. Said DNA sequence can be operably linked to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters are: E. coli lac or trp promoter; lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, reverse LTRs of transcription viruses and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Those of ordinary skill in the art will appreciate that the design of the recombinant expression vector may depend on factors such as the choice of host cell to be transformed, the desired level of protein expression, and the like. In addition, the recombinant expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cells, neomycin resistance, Or tetracycline or ampicillin resistance for E. coli.

In one embodiment, the coding sequence of the fluorescent probe or fusion protein of the present invention is double-digested with BamHI and HindIII and then ligated with the pRSET _b vector cut with BamHI and HindIII to obtain a recombinant expression vector for Escherichia coli. Expression vectors of the present invention can be transferred into host cells to produce proteins or peptides, including fusion proteins. This transfer process can be carried out by conventional techniques such as transformation or transfection, which are well known to those skilled in the art.

The term "host cell" used herein is also called recipient cell, which refers to a cell capable of receiving and accommodating recombinant DNA molecules, and is a place for recombinant gene amplification. Ideal recipient cells should meet the two conditions of easy acquisition and proliferation. The "host cell" of the present invention may include prokaryotic cells and eukaryotic cells, specifically bacterial cells, yeast cells, insect cells and mammalian cells.

The expression vector of the present invention can be used to express the fluorescent probe or fusion protein of the present invention in prokaryotic or eukaryotic cells. Thus, the present invention relates to a host cell, preferably Escherichia coli, into which the expression vector of the present invention has been introduced. The host cell can be any prokaryotic or eukaryotic cell, representative examples are: bacterial cells of Escherichia coli, Streptomyces, Salmonella typhimurium, fungal cells such as yeast, plant cells, insect cells of Drosophila S2 or Sf9, CHO, COS , 293 cells, or animal cells of Bowes melanoma cells, etc., including but not limited to those host cells mentioned above. The host cells are preferably various cells that are conducive to gene product expression or fermentative production, and such cells are well known and commonly used in the art, such as various Escherichia coli cells and yeast cells. In one embodiment of the present invention, Escherichia coli BL21 is selected to construct a host cell expressing the fusion protein of the present invention. Those of ordinary skill in the art will know how to select appropriate vectors, promoters, enhancers and host cells.

As used herein, the terms "transformation" and "transfection", "conjugation" and "transduction" mean various transformations of exogenous nucleic acid (e.g., linear DNA or RNA (e.g., linearized vector or vector-free vector) known in the art. Techniques for introducing a single gene construct)) or a nucleic acid in the form of a vector (for example, a plasmid, cosmid, phage, phagemid, phagemid, transposon, or other DNA) into a host cell, including calcium phosphate or calcium chloride co- Precipitation, DEAE-mannan-mediated transfection, lipofection, native competence, chemical-mediated transfer, or electroporation. When the host is a prokaryotic organism such as E. coli, competent cells capable of taking up DNA can be harvested after the exponential growth phase and treated with the _CaCl2 method using procedures well known in the art. Another method is to use _MgCl2 . Transformation can also be performed by electroporation, if desired. When the host cells are eukaryotic cells, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

The obtained transformed cells can be cultured to express the fusion protein of the present invention by conventional methods suitable for the expression of said host cells. The medium used in the culture may be various conventional ones depending on the host cells used. The culture is carried out under conditions suitable for the growth of the host cells. After the host cells have grown to an appropriate cell density, the selected promoter is induced by an appropriate method (such as temperature shift or chemical induction), and the cells are cultured for an additional period of time.

The recombinant protein in the above method can be expressed inside the cell, or on the cell membrane, or secreted outside the cell. The recombinant protein can be isolated or purified by various separation methods by taking advantage of its physical, chemical and other properties, if necessary. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitating agents (salting out method), centrifugation, osmotic disruption, supertreatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

In one embodiment, the fluorescent probe or fusion protein of the present invention is produced by fermentation of Escherichia coli comprising the coding sequence of the fusion protein of the present invention, and purified by ammonium sulfate precipitation, ion exchange chromatography and gel chromatography to obtain the present invention in pure form. Invent fluorescent probes or fusion proteins.

The application of the fluorescent probe or fusion protein of the present invention includes but not limited to: detection of NADH, detection of NADH in physiological state, detection of NADH at subcellular level, detection of NADH in situ, screening of drugs, diagnosis of diseases related to NADH level, etc.

Concentrations, amounts, percentages, and other numerical values may be expressed herein in the form of ranges. It should also be understood that the use of this range format is for convenience and brevity only and should be read flexibly to include the values expressly recited by the upper and lower limits of the range, and also to include all individual values or subranges subsumed within that range, as if expressly Individual values and subranges are referred to as such.

Example

Below in conjunction with specific embodiment, further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

The experimental method that does not indicate specific conditions in the following examples, usually according to conventional conditions such as Sambrook etc., "Molecular Cloning: Laboratory Guide" (New York State, USA: Cold Spring Harbor Laboratory Press (Cold Spring Harbor Laboratory Press), 1989); Or follow the conditions recommended by the manufacturer. Herein, percentages and parts are by weight unless otherwise indicated.

I. Experimental Materials and Reagents

Reagents: Unless otherwise noted, all others were from Shanghai Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).

Taq enzyme, buffer, dNTP used in PCR amplification; protease, buffer, T4DNA ligase, T4DNA ligase buffer, T4 polynucleotide kinase (PNK), T4PNK buffer used in molecular biology experiments , both from Fermentas, Vilnius, Lithuania.

Construction and expression of embodiment 1 pRSET _b -ydiH(189)-YFP-ydiH(190)

1. Amplify the nucleic acid sequence of cpYFP:

Using pMD19-cpYFP as a template, using primers cpYFP F and cpYFP R to amplify the coding sequence of yellow fluorescent protein (cpYFP), the primer sequence (primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. (Shanghai, China)) is as follows:

P1: PstI GAAT CTGCAG GCTACAACAGCCACAACGTCTATATC (SEQ ID NO: 29)

P2: KpnICCAAGCTTCGGGGTACCGTTGTACTCCAGCTTGTG (SEQ ID NO: 30)

The PCR reaction system is

The PCR reaction conditions are:

The PCR amplification product was electrophoresed in 1% agarose gel for 20 minutes to obtain a cpYFP fragment of about 750 bp. The cpYFP fragment was recovered and purified from the gel using the Shanghai Sangon DNA Fragment Recovery and Purification Kit (Shanghai Bioengineering Co., Ltd., Shanghai, China) according to the manufacturer's instructions.

2. Amplify the target gene sequence of YdiH protein from Thermus aquaticus:

The YdiH protein gene T-ydiH of the genus Thermophysis was entrusted to Shanghai Jierui Bioengineering Co., Ltd. (Shanghai, China) to synthesize (synthesized according to the full sequence of the gene recorded in the NCBI Genbank data, NCBI GenbankAF061257.1).

Using the above gene as a template, use primers ydiH 1F and ydiH 2R to amplify the full length of the YdiH protein gene (T-ydiH) of thermophilic bacteria, wherein the primers ydiH 1F and ydiH 2R amplify the N-terminal containing the BamHI restriction site The C-terminus contains the full-length fragment T-yidH of the T-YdiH protein gene (T-ydiH) with a HindIII restriction site, and the sequences of primers ydiH 1F and ydiH 2R are as follows:

P3: BamHI CC GGATCC GATGAATAAGGATCAATCAAAAATTC (SEQ ID NO: 31)

P4: HindIII CCC AAGCTT CTATTCGATTTCCTCTAAAAC (SEQ ID NO: 32)

The PCR reaction system is

The PCR reaction conditions are:

The PCR amplified product was electrophoresed in 1% agarose gel for 30 minutes to obtain a ydiH1 fragment with a size of about 700 bp, which was purified using the Shanghai Sangon DNA Fragment Recovery Kit (Shanghai Bioengineering Co., Ltd., Shanghai, China) according to the manufacturer's instructions Recovery and purification of T-ydiH fragments.

3. Ligation of target gene and vector

The recovered and purified PCR fragment T-ydiH and the vector plasmid pRSET _b were subjected to double enzyme digestion respectively, and the system was as follows:

Reaction conditions: 37°C, 5 hours.

After the reaction, 10 μl of 6× loading buffer was added to the 50 μl reaction system to terminate the reaction. Then, the target fragment was separated by agarose gel electrophoresis, and the fragment was recovered and purified using the Shanghai Sangon DNA Fragment Recovery and Purification Kit (Shanghai Bioengineering Co., Ltd., Shanghai, China) according to the manufacturer's instructions.

Ligate the recovered T-ydiH double digestion product with the carrier plasmid pRSET _b double digestion product, the system is as follows

Reaction conditions: overnight at 16°C. Thus forming the ligation product pRSET _b -ydiH.

Using the above verified pRSET _b -ydiH as a template, use primers T-ydiH(L190)F and T-ydiH(F189)R to amplify the full length of the pRSET _b -ydiH sequence, where primers T-ydiH(L190)F and T -ydiH(F189)R amplified to obtain pRSET _b containing a PstI restriction site at the N _- terminus and a KpnI restriction site at the C-terminus. The sequence of ydiH(F189)R is as follows:

P5: KpnI ATA GGTACC GGCCTGGCCGGCCTGACCCGGCTG (SEQ ID NO: 33)

P6: PstI ATA CTGCAG AGAAGTCCACGTTCTCCACGGCCACCTC (SEQ ID NO: 34)

Finally, the above yidH-pRSET _b fragment and the verified cpYFP fragment were double digested using the following conditions:

Reaction conditions: 37°C, 5 hours.

After the reaction, 10 μl of 6× loading buffer was added to the 50 μl reaction system to terminate the reaction. Then, the target fragment was separated by agarose gel electrophoresis, and the fragment was recovered and purified using the Shanghai Sangon DNA Fragment Recovery and Purification Kit (Shanghai Bioengineering Co., Ltd., Shanghai, China) according to the manufacturer's instructions.

As described above, the recovered yidH-pRSET _b and cpYFP double digestion products were ligated to form the final ligation product pRSET _b -ydiH(189)-YFP-ydiH(190).

The clones identified as positive by colony PCR were sequenced with universal primers and sequenced by Beijing Liuhe Huada Gene Technology Co., Ltd. Shanghai Branch. The determined sequences were compared and analyzed using Vector NTI 8.0.

4. Conversion

Transform the recombinant plasmid pRSET _b -ydiH(189)-YFP-ydiH(190) into competent Escherichia coli (E.coli) BL21(DE3)pLysS (purchased from Tiangen Biochemical, Beijing, China) to obtain the recombinant strain BL -Frex, the specific method is as follows:

(i) Under clean conditions, take 1 μl of plasmid or 10 μl of ligation product and add it to 100 μl of competent cells, and place in ice bath for 45 minutes;

(ii) After ice bathing, quickly heat shock in a water bath at 42°C for 90-120 seconds;

(iii) ice bath for 5 minutes;

(iv) Add 800ul LB liquid medium, recover on a shaker at 37°C and 220rpm for 1 hour;

(v) After centrifuging at 4000rpm and normal temperature for 5 minutes, discard the supernatant;

(vi) Resuspend the pellet with a small amount of fresh LB, then evenly spread all the bacterial solution on the desired LB plate, and culture it upside down at 37°C overnight.

Positive clones were screened by conventional colony PCR method, and transferred to 5 ml of LB liquid medium containing the corresponding resistance, and cultured overnight at 37°C and 220rpm. Recombinant strain BL-Perex was cultured in LB medium at 37°C until the bacterial cell concentration OD was 0.8, added 0.1mM IPTG, induced expression at 18°C for 20 hours, and used Ni ²⁺ affinity chromatography column (General Electric, Uppsa, Sweden) Pull) Separation and purification of F-rex2 protein from thalline lysate, through SDS-PAGE identification, only a protein band is arranged at about 50kD place, is F-rex2 protein (Fig. 1), 1 is Ni ²⁺ in Fig. 1 The purified F-rex2 protein was separated by an affinity chromatography column, and 2 was a marker.

Example 2. ydiH(189)-YFP-ydiH(190) derived series probes

Probe construction principle

Using the intermediate transition plasmids for constructing probes such as pRSET _b -ydiH(189)-YFP-ydiH(190) as templates, a series of derivative probes were constructed according to the principle of site-directed mutagenesis.

Construction of mutant library

1. Primer design (Shanghai Sangong)

2. PCR amplification

Truncation and site-directed mutagenesis were performed using site-directed mutagenesis PCR.

Mutant PCR amplification system (primers, enzymes, dNTPs, etc. are from Fuzyces Co.):

3. Separation and purification of DNA fragments

DpnI digestion

Firstly, the above PCR amplified fragment was treated at 37°C for 3 hours with DpnI enzyme (from Fuzyces Co., Ltd.) in order to remove potential template plasmid contamination. Then, the reaction system was denatured and inactivated at 80° C. for 20 minutes. The denatured and inactivated reaction mixture can be directly used in subsequent molecular biology experiments.

Phosphorylation of DNA fragments

In the presence of ATP, use T4 polynucleotide kinase (T4polynucleotide kinase, T4PNK) (from Fuzitaisi company) to treat for 1 hour at 37°C to phosphorylate the 5'-OH of the DNA ribose ring to facilitate fragmentation Circular self-connection. Then, the reaction system was denatured and inactivated at 75° C. for 10 minutes. The denatured and inactivated reaction mixture can be directly used in subsequent molecular biology experiments.

connect

Circular self-ligation of phosphorylated DNA fragments (mutated DNA fragments pRSET _b -ydiH-YFP or pRSET _b -YFP-ydiH) with T4 DNA ligase (from Fuzydase) (16°C, overnight) .

Mutant plasmid identification

Colony PCR screened positive clones were taken and sequenced with universal primers, which was completed by Shanghai Branch of Beijing Liuhe Huada Gene Technology Co., Ltd. The determined sequences were compared and analyzed using Vector NTI 8.0.

Build a Probe Series

According to the above method, the following probe series can be further obtained and numbered respectively.

Example 3 Fluorescent Probes for the Ratio of Reduced and Oxidized Nicotinamide Adenine Dinucleotide Determination of Changes in NADH/NAD+ Ratio

The structure of the reduced and oxidized nicotinamide adenine dinucleotide ratio fluorescent probe is that cpYFP is inserted between the amino acids F189 and L190 of Trex. The sequence of this probe is SEQ ID NO: 148, and the preparation method is the same as Example 2. The probe only responds to NADH and NAD ⁺ , and has no response to NADH analogues. When using 485nm excitation, it can be found that the combination of NAD and NADH can lead to the enhancement of the 528nm emission fluorescence of the probe, but using 420nm excitation, only NADH Binding can render the probe responsive. Since the probes are excited at 420nm and 485nm, both can emit fluorescence at 528nm, so using different wavelengths of fluorescence excitation, measuring the intensity ratio (420nm/485nm) of the two emission fluorescence at 528nm can find that only the binding of NADH The response of probe fluorescence ratio is increased, while the binding of NAD ⁺ causes its response to decrease (Fig. 3-1). When the total concentration of NADH and NAD is kept constant and the mutual ratio of the two is adjusted, the trend change is more obvious and does not change with the change of the total concentration (Figure 3-2).

When containing 20uM NADP, NADPH, ADP and ATP, [NADH]/[NAD] was titrated according to a certain ratio, and we found that the response times and changing trends were not affected by it, indicating that NADP, NADPH, ADP and ATP four The analogs have no effect on the probe (as shown in Figure 3-3).

Therefore, the probe can be used as a ratio probe of reduced form and oxidized form of nicotinamide adenine dinucleotide, and can also be used as a reduced form of nicotinamide adenine dinucleotide probe alone.

other implementations

This specification describes a number of implementations. However, it should be understood that various modifications without departing from the spirit and scope of the present invention will come to those skilled in the art from reading this specification. Accordingly, such other implementations should also be included within the scope of the appended claims.

Claims (9)

1. a fluorescent probe for genetic coding, contains in it

(1) to the polypeptide of Reduced nicotinamide-adenine dinucleotide sensitivity in environment, and

(2) by the part that the change of spectral quality shows Reduced nicotinamide-adenine dinucleotide in environment, this part is fluorescent protein sequence or derivatives thereof,

Wherein, described fluorescent probe can detect the Reduced nicotinamide-adenine dinucleotide of oxidized form or reduced form or the ratio of detection oxidized form and nicotinamide adenine dinucleotide reduced.

2. the fluorescent probe of genetic coding as claimed in claim 1, the aminoacid sequence of described fluorescent probe is selected from the sequence 31-42 in sequence table, the one namely in Chinese patent application 201110288807.6 in SEQ ID NO:128-133 or 144-149.

3. a nucleotide sequence, its fluorescent probe described in nucleotide sequence coded claim 1 or 2.

4. a nucleotide sequence, described nucleotide sequence and nucleic acid array complementation according to claim 3.

5. an expression vector, it comprises the nucleotide sequence as claimed in claim 3 be connected with expression control sequenc operability.

6. a host cell, it comprises nucleotide sequence according to claim 3 or expression vector according to claim 5.

7. prepare a method for fluorescent probe described in claim 1 or 2, comprise the following steps:

(1) expression vector according to claim 5 is transferred in host cell,

(2) under the condition being applicable to described host cell expression, described host cell is cultivated, and

(3) described fluorescent probe or fusion rotein is separated by described host cell.

8. the fluorescent probe that described in the fluorescent probe described in claim 1 or 2 or claim 7 prepared by method is in detection oxidized form, nicotinamide adenine dinucleotide reduced, or the application in the ratio of detection oxidized form and nicotinamide adenine dinucleotide reduced.

9. a detection kit, it comprises the fluorescent probe that described in fluorescent probe described in claims requirement 1 or 2 or claim 7 prepared by method.