CN104403003A - Gene encoding nicotinamide adenine dinucleotide fluorescent probe and preparation method and application thereof - Google Patents

Gene encoding nicotinamide adenine dinucleotide fluorescent probe and preparation method and application thereof Download PDF

Info

Publication number
CN104403003A
CN104403003A CN201410499305.1A CN201410499305A CN104403003A CN 104403003 A CN104403003 A CN 104403003A CN 201410499305 A CN201410499305 A CN 201410499305A CN 104403003 A CN104403003 A CN 104403003A
Authority
CN
China
Prior art keywords
sequence
fluorescent probe
albumen
nadh
ydih
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410499305.1A
Other languages
Chinese (zh)
Other versions
CN104403003B (en
Inventor
杨弋
赵玉政
呼庆勋
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Original Assignee
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology filed Critical East China University of Science and Technology
Priority to CN201410499305.1A priority Critical patent/CN104403003B/en
Priority claimed from CN201110288807.6A external-priority patent/CN102344494B/en
Publication of CN104403003A publication Critical patent/CN104403003A/en
Application granted granted Critical
Publication of CN104403003B publication Critical patent/CN104403003B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The invention relates to a gene encoding nicotinamide adenine dinucleotide fluorescent probe and a preparation method and application thereof. On the one hand, the invention relates to a detection probe for nicotinamide adenine dinucleotide, and a recombinant fluorescent fusion protein detection probe for nicotinamide adenine dinucleotide. One the other hand, the invention relates to a recombinant fluorescent fusion protein detection probe for reduced nicotinamide adenine dinucleotide (NADH); furthermore, the invention relates to the oxidized nicotinamide adenine dinucleotide (NAD<+>) recombinant fluorescent fusion protein detection probe; in addition, the invention also relates to meristic reduced and oxidized nicotinamide adenine dinucleotide recombinant fluorescent fusion protein detection probe. The invention also relates to the preparation method and application of the detection probe to detection of NADH, NAD<+> and ratio of NADH / NAD respectively.

Description

Reduced nicotinamide-adenine dinucleotide fluorescent probe of genes encoding and its preparation method and application
The application is application number 201110288807.6, and the applying date is on September 26th, 2011, the divisional application of the application for a patent for invention of " Reduced nicotinamide-adenine dinucleotide genes encoding fluorescent probe and its preparation method and application " by name.The full content of female case is included in herein for all objects by reference of text at this.
Technical field
The present invention relates to the detection probes of Reduced nicotinamide-adenine dinucleotide, be specifically related to the restructuring fluorescent fusion protein detection probes of Reduced nicotinamide-adenine dinucleotide.In concrete at one, the present invention relates to the restructuring fluorescent fusion protein detection probes of nicotinamide adenine dinucleotide reduced (NADH); In another is concrete, the present invention relates to the restructuring fluorescent fusion protein detection probes of NAD (NAD+); In another, the present invention relates to the restructuring fluorescent fusion protein detection probes of reduced form and NAD ratio.The present invention also relates to the preparation method of above-mentioned detection probes and detecting the application in NADH, NAD+ and NADH/NAD+ ratio respectively.
Background technology
NAD +and NADH is as coenzyme, be the important component part of respiratory chain, it take part in the electron transfer process (Rich, P.R. etc., Biochem Soc Trans.2003, V.31 (6), pp.1095-1105) in respiratory chain.In the redox reaction of respiratory chain, NAD +as the carrier of proton, after it receives the electronics that other molecules pass over, be reduction-state by initial oxidation state, the final product of this reaction is NADH, and NADH can provide electronics (Belenky, P. etc., Trends inBiochemical Sciences.2007 as reductive agent to other molecules, V.32 (1), pp.12-19).Recent research shows, NAD (H) not only participates in energy metabolism, material synthesis and antioxygenation, also relate to the calcium homeostasis in body, genetic expression, immunization and cell aging and death etc., and NAD (H) all has vital effect wherein, therefore NAD (H) itself and the numerous enzymes involved by metabolism thereof also become the target (Sauve of medicinal design, A.A. etc., J Pharmacol Exp Ther.2008, V.324 (3), pp.883-893).
But the total amount of the NAD (H) in most of viable cell is approximately 10 -6m ~ 10 -3m, and NAD +ratio also (the Lin that is not quite similar along with intracellular status is different of/NADH, S.J. etc., CurrentOpinion in Cell Biology.2003, V.15 (2), pp.241-246), therefore this brings great inconvenience to the mensuration of NAD (H).Detection method comparatively early mainly utilizes NADH to have characteristic absorbance at 340nm ultraviolet region, and thereby establish ultraviolet spectrophotometry, the method exists two main defects: 1, effective sensitivity limit by instrument precision, is about 10 -7m; 2, in complex system, effectively NADH and NADPH can not be distinguished.Subsequently, according to NAD +as coenzyme, in electron transfer process, accept the characteristic that electronics changes NADH into, develop a series of Enzyme Assay Method.Other are also often seen in various bibliographical information as methods such as HPLC analysis, electrochemical process, capillary electrophoresis, fluorescence imagings.But, most method or the sensitivity deficiency to target molecules in individual cells, or can not subcellular organelle location be carried out.Special needs to be pointed out is, all there is a main defect in these existing methods, namely need to carry out the operations such as cracking, separation, purifying to sample, and NADH itself is very easily oxidized, very easily error is introduced in a series of loaded down with trivial details operation, cause the result of final display and physical presence to be come in and gone out.In addition, these existing methods can not be applied to living animal or cell, can not detect in real time, which has limited the application of these methods at neighborhoods such as clinical disease diagnosis and prodrug researchs.NADH autofluorescence can only be adopted detect (Zhang, Q.H. etc., Science.2002 at present on live body or cell, V.295 (5561), pp.1895-1897), and this traditional method exists following major defect: first, known cell is to NAD +/ NADH and NADP +the regulation and control of/NADPH are relatively independent, NAD under standard state +the ratio of/NADH is greatly about 700:1, and the ratio of NADP+/NADPH is at 1:200; Secondly, their oxidation-reduction potential also exists huge difference, and this reflects that NADH and NADPH plays the part of distinct role respectively in energy metabolism and anabolism; 3rd, the complete undistinguishable of NADH and NADPH autofluorescence, the result utilizing autofluorescence to carry out imaging measurement acquisition is NADH and NADPH sum, in view of the very low and major part of NADH content exists with protein bound form, so that the reflection of NADH autofluorescence data essence is concentration (Zhang, Q.H. etc., the Science.2002 of the NADPH of protein bound, V.295 (5561), pp.1895-1897); 4th, because NADH excitation wavelength is positioned at ultraviolet region (340nm) and autofluorescence is more weak, need the instrument of complex and expensive as the instrument CritiView for clinical monitoring, add the penetration power of UV-light to tissue very weak and can cause cell injury, these optical characteristics seriously constrain the application of autofluorescence monitoring.
Therefore, this area needs development one species specificity NADH detection technique, particularly the specificity NADH detection technique of a kind of applicable physiological level and subcellsular level badly.
And relative to traditional small molecule dyes detection technique and the quantum dots characterization technology that develops rapidly, fluorescin detection technique has unique overwhelming dominance at most active somatic cell imaging side mask, it can be directed in cell, tissue and even whole organ by heredity, therefore the fluorescin telltale that can activate as a full cell marker or gene promoter.
Green fluorescent protein is extract from Victoria's multitube luminescent jellyfish (Aequorea victoria) at first, and the AvGFP of wild-type is by 238 Amino acid profiles, and molecular weight is about 26kD.Current research confirms, in natural GFP albumen, three amino acid Ser-Tyr-Gly of 65th ~ 67 can spontaneous formation fluorescence chromophore: p-phenol methylene imidazolone (p-hydroxybenzylideneimidazolinone) is its main luminous position.The spectral signature of wild-type AvGFP is very complicated, and the main peak of its fluorescence excitation at 395nm place, and separately has an attached peak at 475nm place, the latter's oscillator intensity is about the former 1/3.Under the solution condition of standard, 395nm place excites the transmitting that can produce 508nm place, and the maximum emission wavelength of generation that excites at 475nm place is positioned at 503nm (Heim, R. etc., Proc Natl Acad Sci U S A.1994, V.91 (26), pp.12501-12504).
Day by day go deep into along with to the research of GFP protein mutation, utilize Protocols in Molecular Biology, develop multiple GFP derivative of having outstanding performance at present, by carrying out different simple point mutations or combination on wild-type GFP basis, such as enhancement type GFP (S65T, F64L), YFP (T203Y), CFP (Y66W) etc. can be obtained.And by rearranging GFP protein sequence, the N of former 145-238 amino acids part as new albumen is held, former 1-144 amino acids is held as the C of new albumen, two panels is intersegmental has flexible short peptide chain connection by a bit of, form a circular permutation fluorescin to spatial variations sensitivity (circularpermutation fluorescent protein), the point mutation carried out former albumen T203Y on this basis just defines the yellow fluorescence protein cpYFP (Nagai of circular permutation, T. etc., Proc Natl Acad Sci U S A.2001, V.98 (6), pp.3197-3202).
Due to day by day deep to fluorescin research, some relevant analysis and detection technologies based on fluorescence also obtain further development.Such as current conventional FRET (fluorescence resonance energy transfer) (FRET) technology, this technology cardinal principle be when two fluorescence chromophoric groups enough near time, higher electron energy state is excited to after donor molecule absorbs the photon of certain frequency, before this electronics gets back to ground state, by dipole-dipole interaction, achieve energy to contiguous acceptor molecule transfer (namely resonance energy transfer occurring).FRET is a kind of non-radiative energy transition, interacted by intermolecular eelctric dipole, donor excited energy is transferred to the process of acceptor excited state, donor fluorescence intensity is reduced, and acceptor can launch the characteristic fluorescence (sensitized fluorescence) being more better than itself, also can not fluoresce (quenching of fluorescence).The current further research to green fluorescent protein finds, is the donor/acceptor pair done well for a pair derived from the cyan fluorescent protein (CFP) of modified enhanced green fluorescent protein and yellow fluorescence protein (YFP).The emmission spectrum of CFP and the absorption spectrum of YFP have suitable overlapping, when they enough close to time, excite by the absorbing wavelength of CFP, the chromophoric group of CFP will energy efficient rate ground resonance transfer on the chromophoric group of YFP, so the emitting fluorescence of CFP will weaken or disappear, dominant emission will be the fluorescence of YFP.6 powers of the effciency of energy transfer between two chromophoric groups and the space length between them are inversely proportional to, very sensitive to the change of locus.Therefore now studies have reported that and utilize genetically engineered recombinant means to expect that the protein gene two ends of research go out a brand-new fusion rotein respectively with CFP and YFP amalgamation and expression, namely the spatial variations that the combination of this albumen target molecules narrow spectrum with it produces is manifested intuitively by the change of fluorescence.
Therefore, fluorescent protein sequence used herein can come from fluorescin and the derivative thereof of Victoria's multitube luminescent jellyfish (Aequoreavictoria), including, but not limited to these mutant: the sequence of yellow fluorescence protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP) etc., the wherein sequence of preferred yellow fluorescence protein YFP, the sequence of the yellow fluorescence protein cpYFP of more preferably circular permutation.
Another albumen involved in this technology, YdiH albumen (being also called Rex albumen) is a kind of Bacterial transcript arrestin known in the art, and molecular weight is 23kDa, and it can regulate and control fermentation and anaerobic respiration.Common YdiH albumen is from thermus aquaticus (Thermus aquaticus) (SEQ ID NO:1NCBI GenBank:AF061257.1), streptomyces coelicolor (Streptomyces coelicolor) (SEQ ID NO:2NCBIGenBank:AL939116.1) or subtilis (Bacillus subtilis) (SEQ ID NO:3NCBIGenBank:AL009126.3), it is that the people such as Brekasis and Paget found in streptomyces coelicolor (Streptomyces coelicolor) in 2003 that YdiH albumen obtains qualification first, this is a kind of a kind of modulin to isotope of redox-sensitive be extensively present in gram-positive microorganism.Research for streptomyces coelicolor (S.coelicolor) YdiH (Rex) albumen shows, and this is a kind of typical NAD (H) associated proteins containing Rossmann structural domain.Wherein crucial Rossmann structural domain is a kind of protein supersecondary structure be mainly present in nucleotide binding protein, is typical cofactor NAD (H) binding domains, with all kinds of cofactor NAD associated proteins for representative.This structure consists of with orderly β-alpha-beta-alpha-beta form 2 pairs of α spirals primarily of 6 β-pleated sheet structures.Because each Rossmann structural domain can only in conjunction with a nucleic acid molecule, the Rossmann part that in the protein-bonded structural domain of dinucleotides that therefore similar NAD is this kind of, existence two is paired.Current research display streptomyces coelicolor YdiH (Rex) albumen can directly respond to kytoplasm NADH/NAD +the change of ratio, and under aerobic environment, as NADH/NAD in cell +when ratio is in low-level, YdiH (Rex) albumen can suppress transcribing of its target gene (cydABC, nuoA-D and rexhemACD), and NADH/NAD +the rising of ratio can make Rex dissociate from its operon site, in this dynamic process, the space conformation of YdiH (Rex) albumen can change along with the change of environment (Brekasis, D. etc., EMBO J.2003, V.22 (18), pp.4856-4865).Therefore Rex albumen is the candidate of NADH detection probes in a good cell.Simultaneously, the people such as nearest Wang carry out crystallization to subtilis YdiH (Rex) albumen and have carried out part research to its mechanism of action and function, YdiH (Rex) albumen that result display is derived from subtilis is a heterodimeric protein, be made up of two functional domains, wherein N terminal domains (1-85 position residue) is a DNA binding domain, and C terminal domains (86-215 position residue) be a typical Rossmann fold, it can in conjunction with NADH (Wang, E. etc., Mol Microbiol.2008, V.69 (2), pp.466-478).
Although YdiH (Rex) albumen itself is responsive to the redox state in environment, but himself occur change can not demonstrate intuitively and catch by the external world, and by means of this instrument of fluorescin, we can well by carrying out amalgamation and expression by both, obtain the fluorescent probe of a brand-new genes encoding, YdiH (Rex) albumen is utilized to experience the change of environment internal oxidition reduced state and this change is passed to fluorescin, fluorescence is produced whether and the power of fluorescence by fluorescin, redox state in environment is changed and carries out in real time and describe intuitively.
In sum, we think, utilize the restructuring fluorescent fusion protein comprising YdiH albumen to meet to detect on physiological level and subcellsular level NADH in the urgent need to.
Should not think quoting or discussing and mean and admit that these reference are prior aries of the present invention reference described herein.
Summary of the invention
Hereafter and when mentioning concrete sequence information in the application's claim, each " SEQ ID No " afterwards institute's column number is female case: the sequence numbering in Chinese patent application 201110288807.6.Because content is deleted, the numbering in the sequence table that correlated series is submitted in the application adjusts to some extent, and concrete corresponding relation is as following table.
On the one hand, the invention provides a kind of NADH fluorescent probe of genetic coding, containing the polypeptide to NADH sensitivity in environment in it, with by part that the change of spectral quality shows NADH in environment.In one embodiment, the described change by spectral quality is fluorescent protein sequence or derivatives thereof to the part that NADH in environment shows.In another embodiment, the described polypeptide to NADH sensitivity is the polypeptide with following feature, or its function fragment or NADH binding domains:
(1) there is the Rossman structural domain of NADH binding characteristic; And/or
(2) the transcriptional regulator Rex family protein to NADH sensitivity is derived from.
In a preferred embodiment, the described polypeptide to NADH sensitivity can have following characteristics:
(1) containing the polypeptide of transcriptional regulator Rex protein gene ydiH coming from bacterium, the encoding sequence of this polypeptide can be SEQ ID No:1,2 or 3;
(2) any homology or nonhomologous sequence with (1) described sequence with 95% homogeny at least 85 amino-acid residues;
(3) any homology or nonhomologous sequence with (1) described sequence with 90% homogeny at least 85 amino-acid residues;
(4) any homology or nonhomologous sequence with (1) described sequence with 70% homogeny at least 85 amino-acid residues;
(5) any homology or nonhomologous sequence with (1) described sequence with 50% homogeny at least 85 amino-acid residues;
(6) any homology or nonhomologous sequence with (1) described sequence with 40% similarity at least 85 amino-acid residues; Or
(7) any homology or nonhomologous sequence with (1) described sequence with 35% similarity at least 85 amino-acid residues.
In another embodiment, fluorescent probe of the present invention can comprise the Rossman structural domain B and fluorescent protein sequence A, A1 and/or A2 with NADH binding characteristic, and its array configuration can be:
(1)B-A-B；
(2)B-A-B-B；
(3) A1-B-A2, wherein A1 and A2 can be identical or different; A1 can be the aminoacid sequence of the fluorescin or derivatives thereof coming from Victoria's multitube luminescent jellyfish, and A2 can be the aminoacid sequence of another fluorescin or derivatives thereof coming from Victoria's multitube luminescent jellyfish;
(4) second section of the first part-A-B of B; Wherein A is inserted in the flexible region of B, thus B is divided into the first part of B and the second section of B, and the first part of B and the second section of B form complete B structural domain; Or
(5) second section-B of the first part-A-B of B; Wherein A is inserted in the flexible region of B, thus B is divided into the first part of B and the second section of B, and the first part of B and the second section of B form complete B structural domain.
In yet, fluorescent probe of the present invention also can have following structure:
A 1-B 1-joint 1-FM-joint 2-B 2,
Wherein, A 1be the first structural domain of YdiH albumen, preferably comprise amino acid/11-79 (SEQ ID NO:15) or its varient that the amino acid/11-84 (SEQ ID NO:14) of the aminoacid sequence of bacillus subtilis Pseudomonas YdiH albumen or thermus aquaticus belong to the aminoacid sequence of YdiH albumen; B 1be the second structural domain of YdiH albumen, preferably comprise amino acid 80-189 (SEQ ID NO:17) or its varient that the amino acid 85-194 (SEQ ID NO:16) of the aminoacid sequence of bacillus subtilis Pseudomonas YdiH albumen or thermus aquaticus belong to the aminoacid sequence of YdiH albumen; B 2be the 3rd structural domain of YdiH albumen, preferably comprise amino acid/11 14-211 (SEQ ID NO:19) or its varient that the amino acid/11 20-215 (SEQ ID NO:18) of the aminoacid sequence of bacillus subtilis Pseudomonas YdiH albumen or thermus aquaticus belong to the aminoacid sequence of YdiH albumen;
FM is fluorophore, can be YFP, GFP, CFP etc. and the varient based on these albumen, preferred YFP, more preferably cpYFP;
Joint 1can presence or absence; When existing, joint 1can be any aminoacid sequence, preferred length be no more than 4 amino acid, such as, comprise amino acid T, S, A, G or by 1 to 4 arbitrary combination formed any in these four amino acid, such as aminoacid sequence SAG or TS etc., but is not limited thereto kind of a combination;
Joint 2can presence or absence; When existing, joint 2can be any aminoacid sequence, preferred length be no more than 3 amino acid, such as, comprise amino acid G, T, G or by 1 to 4 arbitrary combination formed any in these four amino acid, such as, comprise aminoacid sequence GTG, but is not limited thereto kind of a combination.
In one embodiment, the present invention also provides a kind of fluorescent probe, and it comprises any fragment of fluorophore and YdiH albumen or YdiH albumen, derivative or analogue.In another embodiment, the present invention also provides a kind of fluorescent probe, and it comprises the varient of fluorophore and YdiH albumen.The present invention also provides a kind of fluorescent probe, and it comprises the soluble fragments of fluorophore and YdiH albumen.
In another embodiment, present invention also offers a kind of NAD+ fluorescent probe of genetic coding, containing the polypeptide to NAD+ sensitivity in environment in it, with by part that the change of spectral quality shows NAD+ in environment.In an embodiment, described NAD+ fluorescent probe comprises SEQ ID NO:129.
In yet, present invention also offers a kind of NADH/NAD+ ratio fluorescent probe of genetic coding, containing the polypeptide to NADH/NAD+ rate sensitive in environment in it, with by part that the change of spectral quality shows NADH/NAD+ ratio in environment.In an embodiment, described NADH/NAD+ ratio fluorescent probe comprises SEQ ID NO:148.
On the other hand, the invention provides a kind of fusion rotein, it comprises fluorescent probe of the present invention.In one embodiment, described fusion rotein comprises fluorescent probe of the present invention and each species specificity subcellular localization signal, and target protein can be positioned in the subcellular organelle of specifying by described signal for locating.
On the other hand, the invention provides a kind of nucleotide sequence, it comprises the nucleotide sequence of code book invention fluorescent probe or fusion rotein.In an embodiment, the invention provides a kind of nucleotide sequence, it comprises nucleotide sequence and the nucleotide sequence of coding to the protein of NADH sensitivity of encoding fluorescent protein.
In a preferred embodiment, the nucleotide sequence of described coding to the protein of NADH sensitivity is that coding has the polypeptide of following feature or the nucleotide sequence of its function fragment or NADH binding domains:
(1) there is the Rossman structural domain of NADH binding characteristic; And/or
(2) the transcriptional regulator Rex family protein to NADH sensitivity is derived from.
In another preferred embodiment, nucleotide sequence of the present invention can comprise the encoding sequence b of the Rossman structural domain with NADH binding characteristic and encoding sequence a, a1 and/or a2 of fluorescin, and its array configuration can be:
(1)b-a-b；
(2)b-a-b-b；
(3) a1-b-a2, wherein a1 and a2 can be identical or different; A1 can be the encoding sequence of the fluorescin or derivatives thereof coming from Victoria's multitube luminescent jellyfish, and a2 can be the encoding sequence of another fluorescin or derivatives thereof coming from Victoria's multitube luminescent jellyfish;
(4) second section of the first part-a-b of b; Wherein a is inserted in the flexible region of b, thus b is divided into the part 1 of b and the second section of b, and the first part of b and the second section of b form complete b structural domain;
(5) second section-b of the first part-a-b of b; Wherein a is inserted in the flexible region of b, thus b is divided into the part 1 of b and the second section of b, and the first part of b and the second section of b form complete b structural domain.
The invention still further relates to complementary sequence and the varient of above-mentioned nucleotide sequence, it can comprise nucleotide sequence or its complementary sequence of the fragment of code book invention fluorescent probe or fusion rotein, analogue, derivative, soluble fragments and varient.
In another, the present invention also provides a kind of expression vector, and it comprises the nucleotide sequence of the present invention be connected with expression control sequenc operability.Described expression control sequenc can be replication orgin, promotor, enhanser, operon, terminator, ribosome bind site etc.
In another, the present invention also provides a kind of host cell, and it comprises expression vector of the present invention.
In another, the present invention also provides a kind of method preparing fluorescent probe of the present invention or fusion rotein, comprises the following steps:
A. expression vector of the present invention is transferred in host cell,
B. under the condition being applicable to described host cell expression, described host cell is cultivated, and
C. described fluorescent probe or fusion rotein is separated by described host cell.
The present invention also provides fluorescent probe of the present invention or fusion rotein detecting the application in NADH.In one embodiment, the invention provides fluorescent probe of the present invention or the application of fusion rotein in vitro or in body in detection NADH.In one embodiment, the invention provides fluorescent probe of the present invention or the application of fusion rotein in subcellsular level detection NADH.In one embodiment, the invention provides fluorescent probe of the present invention or fusion rotein and detect application in NADH in position.In another embodiment, the invention provides fluorescent probe of the present invention or the application of fusion rotein in screening of medicaments, described medicine can be used for the NADH level of controlled plant.In another embodiment, the invention provides fluorescent probe of the present invention or the application of fusion rotein in diagnosing the illness, described disease is relevant with NADH level.
Present invention also offers a kind of test kit detecting NADH, wherein comprise fluorescent probe of the present invention or fusion rotein.Described detection can in vivo, external, ubcellular or original position level carry out.The present invention also provides a kind of test kit of screening of medicaments, and described medicine can be used for the NADH level of controlled plant, and described test kit includes fluorescent probe of the present invention or the fusion rotein of effective amount.Present invention also offers a kind of test kit for detecting the disease relevant with NADH level, described test kit includes the fusion rotein of the present invention of effective amount.In use, those skilled in the art can determine described significant quantity easily according to the activity of described fusion rotein.
Protein in the present invention and nucleotide sequence preferably provide with unpack format, are more preferably purified to homogeneous.
Accompanying drawing explanation
Below in conjunction with drawings and Examples, the invention will be further described.
Fig. 1 SDS-PAGE identifies the F-rex2 of separation and purification from intestinal bacteria (E.coli).
Fig. 2 is the basic spectral response curve of Reduced nicotinamide-adenine dinucleotide fluorescent probe F-rex2.
Fig. 3-1 is that reductibility and oxidisability Reduced nicotinamide-adenine dinucleotide ratio probes are to NADH, NAD +in conjunction with response characteristic.
Fig. 3-2 is that reductibility and oxidisability Reduced nicotinamide-adenine dinucleotide ratio probes are to different N ADH and NAD +the measurement result of ratio.
Fig. 3-3 is that under NADH/NAD+ ratio probes simulates physiological condition in vitro, each pyridine nucleotide analogue detects the impact of this probe.
Embodiment
I. define:
When providing numerical value or scope, term " about " used herein refers to that this numerical value or scope are within 20% of given numerical value or scope, within 10% and within 5%.
The implication that term used herein " comprises ", " comprising " and its equivalents comprise " containing " and " by ... composition ", the composition such as " comprising " X can only be made up of X maybe can contain other material, such as X+Y.
In the present invention, term " YdiH albumen " refers to that YdiH albumen (being also called Rex albumen) is a kind of Bacterial transcript arrestin known in the art, and molecular weight is 23kDa, and it can regulate and control fermentation and anaerobic respiration.This is a kind of a kind of modulin to isotope of redox-sensitive be extensively present in gram-positive microorganism, and is a kind of typical NAD (H) associated proteins containing Rossmann structural domain.Wherein crucial Rossmann structural domain is a kind of protein supersecondary structure be mainly present in nucleotide binding protein, is typically in conjunction with the active region of cofactor NAD (H), with all kinds of cofactor NAD associated proteins for representative.This structure consists of with orderly β-alpha-beta-alpha-beta form 2 pairs of α spirals primarily of 6 β-pleated sheet structures.Because each Rossmann structural domain can only in conjunction with a nucleic acid molecule, the Rossmann part that in the protein-bonded structural domain of dinucleotides that therefore similar NAD is this kind of, existence two is paired.YdiH (Rex) albumen can directly respond to kytoplasm NADH/NAD +the change of ratio, and under aerobic environment, as NADH/NAD in cell +when ratio is in low-level, YdiH (Rex) albumen can suppress transcribing of its target gene (cydABC, nuoA-D and rexhemACD), and NADH/NAD +the rising of ratio can make Rex dissociate from its operon site, and in this dynamic process, the space conformation of YdiH (Rex) albumen can change along with the change of environment." YdiH albumen " involved in the present invention can comprise the aminoacid sequence that nucleotide sequence SEQ ID NO:1 or SEQID NO:2 or SEQ ID NO:3 encodes." flexible region " involved in the present invention refers to that some that exist in protein higher structure are specific as structures such as Loop structural domains, these structural domains have higher movability and flexibility compared to other protein higher structure, and structural domain occurrence dynamics can be caused to change, and protein also also exist trend space conformation greatly occurring and changes in these regions.Flexible region involved in the present invention mainly refers to the V113-G119 region in T-rex (i.e. thermus aquaticus (Thermus aquaticus) originate protein Rex), and D188-G192 this section of region.
Term used herein " fluorescent probe " refers to the polypeptide to NADH sensitivity in environment merged with fluorescin, the described polypeptide to NADH sensitivity in environment can be specifically YdiH albumen, the conformational change of the fluorescin that its conformational change produced after utilizing narrow spectrum NADH integrated structure Rossman structural domain in YdiH to be combined with NADH causes, and then cause the fluorescence of fluorescence or the generation producing or disappear to change, and by the fluorescence drawing standard curve of the fluorescin measured under different N ADH concentration, and then detect and analyze existence and/or the level of NADH.
Term used herein " fusion rotein " and " fluorescent fusion protein " and " restructuring fluorescent fusion protein " synonym, refer to the aminoacid sequence comprising the first polypeptide or protein or its fragment, analogue or derivative, and the polypeptide of the aminoacid sequence of heterologous polypeptide or protein (that is, being different from the second polypeptide of the first polypeptide or protein or its fragment, analogue or derivative or protein or its fragment, analogue or derivative) or protein.In one embodiment, fusion rotein comprises the fluorescin merged with heterologous protein, polypeptide or peptide.According to this embodiment, heterologous protein, polypeptide or peptide may the dissimilar fluorescins of yes or no.In one embodiment, compared with the activity of the original polypeptide be blended in before heterologous protein, polypeptide or peptide or protein, fusion rotein maintain or improves activity.In an embodiment, fusion rotein comprises the fluorescent probe merged with heterologous protein, polypeptide or peptide, and described heterologous protein, polypeptide or peptide can be specificity subcellular localization signal.
Term used herein " fluorophore " and " fluorescin " synonym, refer to the protein self sending fluorescence or send fluorescence under irradiation.Fluorescin is usually used as detection means, the green fluorescent protein GFP that biological example technical field is commonly used and BFP, CFP, YFP, cpYFP etc. of being derived by this protein mutation.
Term used herein " GFP " refers to green fluorescent protein, extract from Victoria's multitube luminescent jellyfish (Aequorea victoria) at first, the AvGFP of wild-type is by 238 Amino acid profiles, and molecular weight is about 26kD, and its aminoacid sequence is SEQ ID No:20.Current research confirms, in natural GFP albumen, three amino acid Ser-Tyr-Gly of 65th ~ 67 can spontaneous formation fluorescence chromophore: p-phenol methylene imidazolone (p-hydroxybenzylideneimidazolinone) is its main luminous position.The spectral signature of wild-type AvGFP is very complicated, and the main peak of its fluorescence excitation at 395nm place, and separately has an attached peak at 475nm place, the latter's oscillator intensity is about the former 1/3.Under the solution condition of standard, 395nm place excites the transmitting that can produce 508nm place, and the maximum emission wavelength of generation that excites at 475nm place is positioned at 503nm.
Term used herein " YFP " refers to yellow fluorescence protein, this is protein derived from green fluorescent protein GFP, up to change crucial compared to GFP of more than 90%, YFP, its aminoacid sequence and GFP homology are that the 203rd amino acids sports tyrosine (T203Y) by Threonine.Then 527nm is changed into 514nm emission wavelength compared to the red shift of wavelength of the main excitation peak of original AvGFP, YFP.Carry out rite-directed mutagenesis (S65T) to YFP the 65th amino acids on this basis and can obtain Fluorescence Increasing type yellow fluorescence protein EYFP, typical EYFP aminoacid sequence is SEQ ID No:21.And rearranging EYFP protein sequence, the N of former 145-238 amino acids part as new albumen is held, former 1-144 amino acids is held as the C of new albumen, two panels is intersegmental to be connected by a bit of short peptide chain VDGGSGGTG with flexibility, form a circular permutation yellow fluorescence protein cpYFP to spatial variations sensitivity (circular permutation yellow fluorescent protein), typical cpYFP aminoacid sequence is SEQ ID No:22.
In the present invention, the YdiH albumen merged with fluorophore can be separated total length from the natural YdiH albumen of subtilis or thermus aquaticus or streptomyces coelicolor or its fragment, preferably natural Bacillus subtillis belongs to the amino acid/11-215 of YdiH albumen or thermus aquaticus and belongs to the amino acid/11-259 that the amino acid/11-211 of YdiH albumen or streptomyces coelicolor belong to YdiH albumen, and more preferably Bacillus subtillis belongs to the amino acid/11-211 that the amino acid/11-215 of YdiH albumen or thermus aquaticus belong to YdiH albumen.
" joint " refers in polypeptide of the present invention, protein or nucleic acid, connect two parts amino acid or nucleotide sequence.When connecting in polypeptide of the present invention or protein, the length of joint is not more than 6 amino acid, is preferably not more than 4 amino acid, is more preferably 3 amino acid.When connecting in nucleic acid of the present invention, the length of joint is not more than 18 Nucleotide, is preferably not more than 12 Nucleotide, is more preferably 9 Nucleotide.
When mentioning certain polypeptide or albumen, term used herein " varient " comprises and has described polypeptide or albumen identical function but the different varient of sequence.These varients comprise (but being not limited to): in the sequence of described polypeptide or albumen disappearance, insert and/or replace and one or morely (be generally 1-30, preferably 1-20, more preferably 1-10,1-5 best) amino acid, and add one or several at its C-terminal and/or N-terminal and (be generally within 20, within being preferably 10, within being more preferably 5) amino acid obtain sequence.Such as, in the art, when replacing with similar nature or similar amino acid, the function of polypeptide or albumen can not usually be changed.In the art, the similar amino acid of performance often refers to the amino acid residues with similar side chain, existingly in this area clearly defines.These families comprise amino acid (the such as Methionin with basic side chain, arginine, Histidine), there is amino acid (the such as aspartic acid of acid side-chain, L-glutamic acid), there is amino acid (the such as glycine of uncharged polar side chain, l-asparagine, glutamine, Serine, Threonine, tyrosine, halfcystine), there is amino acid (the such as L-Ala of non-polar sidechain, α-amino-isovaleric acid, leucine, Isoleucine proline(Pro), phenylalanine, methionine(Met), tryptophane), there is amino acid (the such as Threonine of β-branched building block, α-amino-isovaleric acid, Isoleucine) and there is amino acid (the such as tyrosine of aromatic side chain, phenylalanine, tryptophane, Histidine).Again such as, add at C-terminal and/or N-terminal the function that or several amino acid also can not change polypeptide or albumen usually.As well known to those skilled in the art, in gene clone operation, usually need to design suitable restriction enzyme site, this certainly will introduce one or more incoherent residue at expressed polypeptide or albumen end, and this does not affect the activity of desired polypeptides or albumen.And for example in order to construction of fusion protein, promote the expression of recombinant protein, obtain the recombinant protein be automatically secreted into outside host cell, or be beneficial to the purifying of recombinant protein, usually need some aminoacid addition to the N-end of recombinant protein, in other appropriate area in C-end or this albumen, such as, include but not limited to, the joint peptide be applicable to, signal peptide, leading peptide, end extends, glutathione S-transferase (GST), maltose E binding protein, albumin A, as the label of 6His or Flag, or the proteolytic ferment site of Xa factor or zymoplasm or enteropeptidase.The varient of polypeptide or albumen can comprise: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutants, under high or low high stringency conditions can with the polypeptide coded by the DNA of the DNA hybridization of described polypeptide or albumen or albumen and the polypeptide utilizing the antiserum(antisera) of anti-described polypeptide or albumen to obtain or albumen.These varients also can comprise to be at least about 70% with the sequence thereto of described polypeptide or albumen, polypeptide at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or 100% or albumen.
In two or more polypeptide or sequence of nucleic acid molecules, term " homogeny " or " homogeny percentage ratio " refer in comparison window or designated area, adopt means known in the art as sequence comparison algorithm, when comparing correspondence maximum with comparison by manual alignment and visual inspection, two or more sequence or subsequence is identical or wherein have in designated area the amino-acid residue of certain percentage ratio or Nucleotide identical (such as, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% is identical).Such as, the optimization algorithm being applicable to measuring percent sequence identity and sequence similarity percentage ratio is BLAST and BLAST 2.0 algorithm, respectively can see (1990) J.Mol.Biol.215:403 such as (1977) Nucleic Acids Res.25:3389 and Altschul such as Altschul.
Term used herein " soluble fragments " be often referred to have described full length protein sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about the fragment of 100 continuous amino acids.
Term used herein " function fragment ", " derivative " refer to " analogue " albumen substantially keeping the biological function identical with the natural YdiH of the present invention or activity.The function fragment of YdiH of the present invention, derivative or analogue can be the albumen that (i) has one or more conservative or non-conservative amino acid residue (preferred conservative amino acid) and be substituted, and the amino-acid residue of such replacement can may not be and encoded by genetic code, or (ii) has the albumen of substituted radical in one or more amino-acid residue, or (iii) maturation protein and another compound (such as extend the compound of protein half-life, such as polyoxyethylene glycol) merge the albumen formed, or (iv) additional aminoacid sequence is fused to this protein sequence and the albumen formed (as leader sequence or secretion sequence or be used for the sequence of this albumen of purifying or proprotein sequence, or with the fusion rotein of the formation of antigen I gG fragment).According to instruction herein, these function fragments, derivative and analogue belong to the known scope of those skilled in the art.
The difference of described analogue and natural YdiH albumen can be the difference on aminoacid sequence, can be also the difference do not affected on the modified forms of sequence, or have both at the same time.These albumen comprise genetic variant that is natural or induction.Induce variation body can be obtained by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also obtains by site-directed mutagenesis or the biological technology of other known moleculars.
Described analogue also comprises the analogue with the residue (as D-amino acid) being different from natural L-amino acids, and has the analogue of amino acid (as β, gamma-amino acid) that is that non-natural exists or synthesis.Should be understood that YdiH albumen of the present invention is not limited to above-mentioned representative albumen, fragment, derivative and the analogue enumerated.(usually the not changing primary structure) form of modification comprises: the chemically derived form of the albumen that body is interior or external is as acetylize or carboxylated.Modify and also comprise glycosylation, as carried out glycosylation modified and albumen that is that produce in those in the synthesis of albumen and processing or further procedure of processing.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) by being exposed to by albumen and completing.Modified forms also comprises the sequence with phosphorylated amino acid residue (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Also comprise and modified thus improve its anti-proteolysis performance or optimize the albumen of solubility property.
Term used herein " nucleic acid " can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.
When mentioning nucleic acid, term used herein " varient " can be the allelic variant of natural generation or the varient of non-natural generation.These nucleotide variants comprise degeneracy varient, replace varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of a nucleic acid, and it may be the replacement of one or more Nucleotide, disappearance or insertion, but can not from the function of albumen changing in fact its coding.Nucleic acid of the present invention can comprise to be at least about 70% with the sequence thereto of described nucleotide sequence, nucleotide sequence at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or 100%.
As used herein, term under high stringency conditions, " hybridize " nucleotide sequence that is used to describe typical at least 60% homology each other still can the hybridization of phase mutual cross and cleaning condition.Preferably, high stringency conditions is such condition, has at least 65%, more excellent at least 70% each other with this understanding and even the sequence of preferred at least 80% or higher homology generally still can phase mutual cross.This high stringency conditions is that those of ordinary skill in the art are known.One of high stringency conditions is preferably, and limiting examples is: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 0 DEG C; Or be added with denaturing agent, 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc. during (2) hybridization; Or (3) homogeny only between two sequences, at least more than 90%, is just hybridized when being more preferably more than 95%.
The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment ", at least containing 15 Nucleotide, is better at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid.
The full length sequence of fluorescent probe of the present invention or fusion rotein or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.
Once obtain relevant sequence, just relevant sequence can be obtained in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, then obtains related polypeptide or albumen by ordinary method abstraction and purification from the host cell after propagation.
In addition, also relevant sequence can be synthesized, when especially fragment length is shorter by the method for synthetic.Usually, by first synthesizing multiple small segment, and then carry out connect can obtain the very long fragment of sequence.
At present, the DNA sequence dna of code book invention albumen (or its fragment, derivative, analogue or varient) can be obtained completely by chemosynthesis.Then this DNA sequence dna can be introduced in various existing DNA molecular (as carrier) as known in the art and cell.By method such as sudden change PCR or chemosynthesis etc., sudden change is introduced in protein sequence of the present invention.
Term used herein " expression vector " and " recombinant vectors " are used interchangeably, refer to protokaryon well known in the art or eukaryotic vector, such as bacterial plasmid, phage, yeast plasmid, vegetable cell virus, mammalian cell is viral as adenovirus, retrovirus or other carriers, these carriers can copy and stablize in host, and a key character of these recombinant vectorss is usually containing expression control sequenc.Term used herein " expression control sequenc " refers to regulate and control the element that can be connected with goal gene operability of transcribing, translate and expressing of goal gene, can be replication orgin, promotor, marker gene or translation controlling elements, comprise enhanser, operon, terminator, ribosome bind site etc., host cell used is depended in the selection of expression control sequenc.The recombinant vectors be suitable in the present invention includes but not limited to bacterial plasmid.In recombinant expression vector, " operability connection " refers to that the nucleotide sequence of object is connected in the mode allowing nucleotide sequence and express with regulating sequence.Those skilled in the art knows and can be used for building containing fusion rotein encoding sequence of the present invention and the suitable method of transcribing/translating the expression vector of control signal.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, synthesizes to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprise CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus LTR and some other known can the promotor expressed in protokaryon or eukaryotic cell or its virus of controlling gene.Expression vector also comprises ribosome bind site and the transcription terminator of translation initiation.
Those skilled in the art will appreciate that the design of recombinant expression vector can be depending on the factor such as selection, required protein expression level as the host cell for transforming.In addition, recombinant expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character of host cell selecting to transform, as eukaryotic Tetrahydrofolate dehydrogenase, neomycin resistance, or for colibacillary tsiklomitsin or amicillin resistance.
In one embodiment, by the encoding sequence of fluorescent probe of the present invention or fusion rotein after BamHI and HindIII double digestion with the pRSET of BamHI and HindIII double digestion bcarrier connects, and obtains Recombinant protein expression carrier.Can expression vector of the present invention be transferred in host cell, to produce the albumen or peptide that comprise fusion rotein.This kind of transfer process can be carried out with routine techniquess well known to those skilled in the art such as conversion or transfections.
Herein being also called recipient cell at term used " host cell ", referring to the cell that can receive and hold recombinant DNA molecules, is the place of recombination amplification, and desirable recipient cell should meet and is easy to obtain and propagation two conditions." host cell " of the present invention can comprise prokaryotic cell prokaryocyte and eukaryotic cell, specifically comprises bacterial cell, yeast cell, insect cell and mammalian cell.
Expression vector of the present invention is used in protokaryon or eukaryotic expression fluorescent probe of the present invention or fusion rotein.Thus, the present invention relates to the host cell, the preferably intestinal bacteria that import expression vector of the present invention.Host cell can be any protokaryon or eukaryotic cell, representative example has: intestinal bacteria, streptomyces, the bacterial cell of Salmonella typhimurium, fungal cell as yeast, vegetable cell, the insect cell of fruit bat S2 or Sf9, the zooblast etc. of CHO, COS, 293 cells or Bowes melanoma cells, comprising but be not limited to those above-mentioned host cells.Described host cell is the various cell being beneficial to gene product expression or fermentative production preferably, and this type of cell has been well known and conventional, such as various Bacillus coli cells and yeast cell.In an embodiment of the invention, the host cell of e. coli bl21 construction expression fusion rotein of the present invention is selected.Persons skilled in the art all know how to select suitable carrier, promotor, enhanser and host cell.
Term used herein " conversion " and " transfection ", " joint " and " transduction " mean well known in the art various by exogenous nucleic acid (such as, linear DNA or RNA are (such as, linearized vector or DNAcarrier free independent gene construct)) or carrier format nucleic acid (such as, plasmid, clay, phage, phasmid, phagemid, transposon or other DNA) import the technology of host cell, comprise calcium phosphate or calcium chloride co-percipitation, the transfection of DEAE-mannosans-mediation, fat transfection, natural competence, the transfer of chemistry mediation or electroporation.When host be prokaryotic organism as intestinal bacteria time, the competent cell that can absorb DNA can be gathered in the crops at exponential growth after date, uses CaCl 2method process, step used is well-known in this area.Another kind method uses MgCl 2.If needed, transform and also can be undertaken by the method for electroporation.When host cell is eukaryotic cell, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods is as microinjection, electroporation, liposome packaging etc.
Can cultivate by the ordinary method being applicable to described host cell expression the transformant obtained, express fusion rotein of the present invention.According to host cell used, substratum used in cultivation can be various conventional medium.Cultivate under the condition being suitable for host cell growth.When after host cell growth to suitable cell density, the promotor selected with the induction of suitable method (as temperature transition or chemical induction), cultivates for some time again by cell.
Recombinant protein in the above methods can be expressed or be secreted into extracellular in cell or on cytolemma.If needed, can utilize its physics, the albumen of being recombinated by various separation method isolated or purified with other characteristic of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation process, combination by protein precipitant process (salting-out method), centrifugal, the broken bacterium of infiltration, super process, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
In one embodiment, by comprising Escherichia coli fermentation production fluorescent probe of the present invention or the fusion rotein of fusion rotein encoding sequence of the present invention, and by ammonium sulfate precipitation, ion exchange chromatography and gel chromatography obtain fluorescent probe of the present invention or the fusion rotein of pure form.
The purposes of fluorescent probe of the present invention or fusion rotein includes but not limited to: detect NADH, detect NADH under physiological status, detect NADH, in situ detection NADH, screening of medicaments, the diagnosis disease etc. relevant with NADH level at subcellsular level.
In this article, the form of concentration, content, percentage ratio and the equal usable range of other numerical value represents.Also should understand, use this range format just for convenience and simplicity, flexibly should being studied at school on a temporary basis as comprising the specifically mentioned numerical value of scope bound, also should be comprised all single numerical value or subrange that comprise within the scope of this, just look like clearly mention each numerical value and subrange such.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.
The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as Sambrook etc., " molecular cloning: lab guide " (New York, United States: CSH Press (Cold SpringHarbor Laboratory Press), 1989); Or carry out according to the condition that manufacturer advises.In this article, unless otherwise indicated, per-cent and number are all calculated by weight.
I. experiment material and reagent
Reagent: except special mark, other are all from Shanghai Chemical Reagent Co., Ltd., Sinopharm Group (Chinese Shanghai).
The Taq enzyme that pcr amplification uses, damping fluid, dNTP; The proteolytic enzyme, damping fluid, T4DNA ligase enzyme, T4DNA ligase enzyme damping fluid, T4 polynueleotide kinase (PNK), the T4PNK damping fluid that use in molecular biosciences experiment, all from the Fu Meitaisi company (Fermentas) of Lithuania Vilnius.
Embodiment 1pRSET bthe structure of-ydiH (189)-YFP-ydiH (190) and expression
1. the nucleotide sequence of amplification cpYFP:
Take pMD19-cpYFP as template, utilize the encoding sequence of primer cpYFP F and cpYFP R amplification yellow fluorescence protein (cpYFP), primer sequence (primer is synthesized by Shanghai Sheng Gong biotechnology company limited (Chinese Shanghai)) is as follows:
P1：PstI GAAT CTGCAGGCTACAACAGCCACAACGTCTATATC(SEQ IDNO：29)
P2：KpnI CCAAGCTTCGG GGTACCGTTGTACTCCAGCTTGTG(SEQ IDNO：30)
PCR reaction system is
PCR reaction conditions is:
By pcr amplification product electrophoresis 20 minutes in the sepharose of 1%, obtain the cpYFP fragment of about 750bp.Utilize the raw work DNA fragmentation in Shanghai to reclaim purification kit (Shanghai biotechnology company limited, Chinese Shanghai) to reclaim from gel and purifying cpYFP fragment according to manufacturers instruction.
2. thermus aquaticus (Thermus aquaticus) of increasing belongs to YdiH albumen goal gene sequence:
Thermus aquaticus belongs to YdiH protein gene T-ydiH and entrusts Shanghai Jierui Biology Engineering Co., Ltd's (Chinese Shanghai) synthesis (synthesizing according to the gene complete sequence recorded in NCBI Genbank data, NCBI GenbankAF061257.1).
Take said gene as template, utilize YdiH protein gene (T-ydiH) total length of primer ydiH 1F and ydiH 2R amplification thermus aquaticus, wherein primer ydiH 1F and ydiH 2R increase and obtain N end and hold T-YdiH protein gene (T-ydiH) full length fragment T-yidH containing HindIII restriction enzyme site containing BamHI restriction enzyme site C, primer ydiH 1F and ydiH 2R sequence as follows:
P3:BamHI CC GGATCCGATGAATAAGGATCAATCAAAAATTC(SEQ IDNO：31)
P4:HindIII CCC AAGCTTCTATTCGATTTCCTCTAAAAC(SEQ ID NO：32)
PCR reaction system is
pCR reaction conditions is:
By pcr amplification product electrophoresis 30 minutes in the sepharose of 1%, obtain the ydiH1 fragment that size is about 700bp, utilize the raw work DNA fragmentation in Shanghai to reclaim purification kit (Shanghai biotechnology company limited, Chinese Shanghai) to reclaim and purifying T-ydiH fragment according to manufacturers instruction.
3. the connection of goal gene and carrier
PCR fragment T-ydiH and the vector plasmid pRSET of purifying will be reclaimed bcarry out double digestion respectively, system is as follows:
Reaction conditions: 37 DEG C, 5 hours.
After reaction terminates, in 50 μ l reaction systems, add 10 μ l 6 × sample-loading buffer termination reactions.Then be separated object fragment by agarose gel electrophoresis, utilize the raw work DNA fragmentation in Shanghai to reclaim purification kit (Shanghai biotechnology company limited, Chinese Shanghai) and reclaim and purified fragments according to manufacturers instruction.
By the T-ydiH double digestion product that is recovered to and vector plasmid pRSET bdouble digestion product connects, and system is as follows
Reaction conditions: 16 DEG C, spend the night.Thus form connection product pRSET b-ydiH.
With the above-mentioned pRSET through checking b-ydiH is template, utilizes primer T-ydiH (L190) F and T-ydiH (F189) R amplification pRSET b-ydiH sequence, wherein primer T-ydiH (L190) F and T-ydiH (F189) R increases and obtains N end containing the pRSET of PstI restriction enzyme site C end containing KpnI restriction enzyme site b-ydiH sequence fragment yidH-pRSET b, primer T-ydiH (L190) F and T-ydiH (F189) R sequence is as follows:
P5:KpnI ATA GGTACCGGCCTGGCCGGCCTGACCCGGCTG(SEQ IDNO：33)
P6:PstI ATA CTGCAGAGAAGTCCACGTTCTCCACGGCCACCTC(SEQ ID NO：34)
Finally, utilize following condition to above-mentioned yidH-pRSET bfragment and the cpYFP fragment double digestion through checking:
Reaction conditions: 37 DEG C, 5 hours.
After reaction terminates, in 50 μ l reaction systems, add 10 μ l 6 × sample-loading buffer termination reactions.Then be separated object fragment by agarose gel electrophoresis, utilize the raw work DNA fragmentation in Shanghai to reclaim purification kit (Shanghai biotechnology company limited, Chinese Shanghai) and reclaim and purified fragments according to manufacturers instruction.
As mentioned above, the yidH-pRSET will be recovered to bbe connected with the double digestion product of cpYFP, thus form final connection product pRSET b-ydiH (189)-YFP-ydiH (190).
Get bacterium colony PCR and be accredited as positive clone, adopt universal primer order-checking, by Shanghai, Beijing Liuhe Huada Genomics Technology Co., Ltd, branch office checks order.The sequence Vector NTI 8.0 measured carries out comparing analysis.
4. transform
By recombinant plasmid pRSET bit is (biochemical purchased from sky root that-ydiH (189)-YFP-ydiH (190) is transformed into competent intestinal bacteria (E.coli) BL21 (DE3) pLysS, BeiJing, China) in, obtain recombinant bacterium BL-Frex, concrete grammar is as follows:
I (), under cleaning condition, is got 1 μ l plasmid or 10 μ l and is connected product and add in 100 μ l competence, ice bath 45 minutes;
(ii) after ice bath, heat shock 90 ~ 120 seconds in 42 DEG C of water-baths rapidly;
(iii) ice bath 5 minutes again;
(iv) 800ul LB liquid nutrient medium is added, 37 DEG C, 220rpm shaking table recovers 1 hour;
V () 4000rpm, normal temperature is after centrifugal 5 minutes, supernatant discarded;
(vi) by a small amount of resuspended precipitation of fresh LB, subsequently whole bacterium liquid is spread evenly across on required LB flat board, is inverted overnight incubation for 37 DEG C.
Adopt conventional colony polymerase chain reaction (PCR) method screening positive clone, and proceed to 5ml and contain in the LB liquid nutrient medium of corresponding resistant, 37 DEG C, 220rpm incubated overnight.In LB substratum, 37 DEG C are cultured to cell concentration OD to recombinant bacterium BL-Perex is 0.8, add 0.1mM IPTG, and 18 DEG C of abduction deliverings 20 hours, use Ni 2+affinity column (General Electric, Uppsala, SWE) separation and purification F-rex2 albumen from cellular lysate liquid, through SDS-PAGE qualification, only having a protein band at about 50kD place, is F-rex2 albumen (Fig. 1) that in Fig. 1,1 is Ni 2+the F-rex2 albumen of affinity chromatography column separating purification, 2 is marker.
Embodiment 2.ydiH (189)-YFP-ydiH (190) derives plurality of probes
Probe builds principle
Utilize and build pRSET bthe middle transition plasmid of the probes such as-ydiH (189)-YFP-ydiH (190) is template, according to the principle of rite-directed mutagenesis, carries out the structure of derivative plurality of probes.
The foundation of mutated library
1. design of primers (the raw work in Shanghai)
2.PCR increases
Rite-directed mutagenesis PCR is utilized to carry out truncated mutant and rite-directed mutagenesis.
Sudden change PCR amplification system (primer, enzyme, dNTP etc. are from Fu Meitaisi company):
3.DNA fragment is separated, purifying
DpnI digests
First utilize DpnI enzyme (from Fu Meitaisi company) to process above-mentioned pcr amplified fragments 3 hours at 37 DEG C, pollute to remove potential template plasmid.Then, make reaction system 80 DEG C of deactivations 20 minutes.Reaction mixture through deactivation can be directly used in follow-up molecular biology experiment.
DNA fragmentation phosphorylation
Under ATP exists, utilize T4 polynueleotide kinase (T4polynucleotide kinase, T4PNK) (from Fu Meitaisi company) was 37 DEG C of process 1 hour, to make 5 '-OH phosphorylation of DNA ribose ring, so that fragment cyclisation is from connecting.Then, make reaction system 75 DEG C of deactivations 10 minutes.The reaction mixture of deactivation can be directly used in follow-up molecular biology experiment.
Connect
With T4DNA ligase enzyme (from Fu Meitaisi company) by DNA fragmentation (the DNA fragmentation pRSET of sudden change through phosphatizing treatment b-ydiH-YFP or pRSET b-YFP-ydiH) carry out cyclisation from connecting (16 DEG C, spend the night).
Mutant plasmid is identified
Get bacterium colony PCR to screen as positive clone, adopt universal primer order-checking, by Shanghai, Beijing Liuhe Huada Genomics Technology Co., Ltd, branch office completes.The sequence Vector NTI 8.0 measured carries out comparing analysis.
Build probe sets
Following probe sets can be obtained further according to aforesaid method, and number respectively.
The change of embodiment 3 reduced form and NAD ratio fluorescent probe assay NADH/NAD+ ratio
The structure of reduced form and NAD ratio fluorescent probe is, in the middle of this two places amino acid of F189 and L190 of Trex, insert cpYFP, the sequence of this probe is SEQ ID NO:148, and preparation method is with embodiment 2.This probe is only to NADH and NAD +have response, to NADH analogue without any response, can find that NAD and NADH combination all can cause probe 528nm emitting fluorescence all to have enhancing when employing 485nm excites, but adopt 420nm to excite, only the combination of NADH can cause probe to respond.Excite with 485nm because probe 420nm excites, equal can in 528nm place produce emitting fluorescence, therefore the fluorescence excitation of different wave length is utilized, measure the intensity rate (420nm/485nm) going out emitting fluorescence at 528nm both it and can find that the combination of only NADH causes the response of fluorescence probe ratio for rising, and NAD +combination cause its response for decline (Fig. 3-1).When NADH and NAD keeps total concn constant, during the mutual ratio of both adjustment, this Long-term change trend is more obvious, and does not change with the change of total concn (Fig. 3-2).
As the NADP containing 20uM, NADPH, during ADP and ATP, [NADH]/[NAD] goes titration according to a certain percentage, we find that the response multiple of change and variation tendency all do not affect by it, NADP is described, NADPH, ADP and ATP tetra-kinds of analogues do not affect (as Fig. 3-3) probe.
Therefore this probe both can do reduced form and NAD ratio probes, can also make separately nicotinamide adenine dinucleotide reduced probe.
Other embodiment
Present specification describes many embodiments.But should be understood that those skilled in the art pass through to read this specification sheets and know the various improvement not deviating from the spirit and scope of the present invention.Therefore, these other embodiments also should comprise within the scope of the appended claims.

Claims (9)

1. a fluorescent probe for genetic coding, contains in it
(1) to the polypeptide of Reduced nicotinamide-adenine dinucleotide sensitivity in environment, and
(2) by the part that the change of spectral quality shows Reduced nicotinamide-adenine dinucleotide in environment, this part is fluorescent protein sequence or derivatives thereof,
Wherein, described fluorescent probe can detect the Reduced nicotinamide-adenine dinucleotide of oxidized form or reduced form or the ratio of detection oxidized form and nicotinamide adenine dinucleotide reduced.
2. the fluorescent probe of genetic coding as claimed in claim 1, the aminoacid sequence of described fluorescent probe is selected from the sequence 31-42 in sequence table, the one namely in Chinese patent application 201110288807.6 in SEQ ID NO:128-133 or 144-149.
3. a nucleotide sequence, its fluorescent probe described in nucleotide sequence coded claim 1 or 2.
4. a nucleotide sequence, described nucleotide sequence and nucleic acid array complementation according to claim 3.
5. an expression vector, it comprises the nucleotide sequence as claimed in claim 3 be connected with expression control sequenc operability.
6. a host cell, it comprises nucleotide sequence according to claim 3 or expression vector according to claim 5.
7. prepare a method for fluorescent probe described in claim 1 or 2, comprise the following steps:
(1) expression vector according to claim 5 is transferred in host cell,
(2) under the condition being applicable to described host cell expression, described host cell is cultivated, and
(3) described fluorescent probe or fusion rotein is separated by described host cell.
8. the fluorescent probe that described in the fluorescent probe described in claim 1 or 2 or claim 7 prepared by method is in detection oxidized form, nicotinamide adenine dinucleotide reduced, or the application in the ratio of detection oxidized form and nicotinamide adenine dinucleotide reduced.
9. a detection kit, it comprises the fluorescent probe that described in fluorescent probe described in claims requirement 1 or 2 or claim 7 prepared by method.
CN201410499305.1A 2011-09-26 2011-09-26 NADH fluorescence probe of gene code and its preparation method and application Active CN104403003B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410499305.1A CN104403003B (en) 2011-09-26 2011-09-26 NADH fluorescence probe of gene code and its preparation method and application

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201110288807.6A CN102344494B (en) 2011-09-26 2011-09-26 Nicotinamide adenine dinucleotide gene coding fluorescent probe as well as preparation method and application thereof
CN201410499305.1A CN104403003B (en) 2011-09-26 2011-09-26 NADH fluorescence probe of gene code and its preparation method and application

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201110288807.6A Division CN102344494B (en) 2011-09-26 2011-09-26 Nicotinamide adenine dinucleotide gene coding fluorescent probe as well as preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN104403003A true CN104403003A (en) 2015-03-11
CN104403003B CN104403003B (en) 2017-06-23

Family

ID=52640677

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410499305.1A Active CN104403003B (en) 2011-09-26 2011-09-26 NADH fluorescence probe of gene code and its preparation method and application

Country Status (1)

Country Link
CN (1) CN104403003B (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105646716A (en) * 2014-11-14 2016-06-08 华东理工大学 A gene-encoded cyclic adenylic acid fluorescence probe, and a preparing method and applications thereof
CN107449715A (en) * 2016-05-30 2017-12-08 康建胜 Living cells intracellular metabolic analysis instrument and its analysis method
CN109748970A (en) * 2019-01-24 2019-05-14 华东理工大学 α-ketoglutaric acid optical probe and its preparation method and application
WO2021121417A1 (en) * 2019-12-19 2021-06-24 华东理工大学 Lactic acid optical probe, preparation method therefor and application thereof
CN113018430A (en) * 2021-03-10 2021-06-25 华东理工大学 Cancer therapeutic target and application thereof
WO2023070878A1 (en) * 2021-10-29 2023-05-04 深圳先进技术研究院 Bioluminescence nampt enzyme activity detection composition, kit and detection method

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6469154B1 (en) * 1999-05-21 2002-10-22 The Regents Of The University Of California Fluorescent protein indicators

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6469154B1 (en) * 1999-05-21 2002-10-22 The Regents Of The University Of California Fluorescent protein indicators

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MCLAUGHLIN等: "Structural Basis for NADH/NAD+ Redox Sensing by a Rex Family Repressor", 《MOLECULAR CELL》 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105646716A (en) * 2014-11-14 2016-06-08 华东理工大学 A gene-encoded cyclic adenylic acid fluorescence probe, and a preparing method and applications thereof
CN107449715A (en) * 2016-05-30 2017-12-08 康建胜 Living cells intracellular metabolic analysis instrument and its analysis method
CN107449715B (en) * 2016-05-30 2021-01-22 康建胜 Intracellular metabolism analyzer for living cells and analysis method thereof
CN109748970A (en) * 2019-01-24 2019-05-14 华东理工大学 α-ketoglutaric acid optical probe and its preparation method and application
CN109748970B (en) * 2019-01-24 2022-07-05 华东理工大学 Alpha-ketoglutaric acid optical probe and preparation method and application thereof
WO2021121417A1 (en) * 2019-12-19 2021-06-24 华东理工大学 Lactic acid optical probe, preparation method therefor and application thereof
CN113018430A (en) * 2021-03-10 2021-06-25 华东理工大学 Cancer therapeutic target and application thereof
WO2023070878A1 (en) * 2021-10-29 2023-05-04 深圳先进技术研究院 Bioluminescence nampt enzyme activity detection composition, kit and detection method

Also Published As

Publication number Publication date
CN104403003B (en) 2017-06-23

Similar Documents

Publication Publication Date Title
CN102344494B (en) Nicotinamide adenine dinucleotide gene coding fluorescent probe as well as preparation method and application thereof
CN104403003A (en) Gene encoding nicotinamide adenine dinucleotide fluorescent probe and preparation method and application thereof
JP4459058B2 (en) Photoprotein with improved bioluminescence
US5958713A (en) Method of detecting biologically active substances by using green fluorescent protein
IL273989A (en) Activation of bioluminescence by structural complementation
US20240027344A1 (en) Fluorescent Probe for Branched Chain Amino Acids and Use Thereof
JPH10509881A (en) Modified green fluorescent protein
CN109666075A (en) Glutamine optical probe and its preparation method and application
CN104211811A (en) Copper silver ion fluorescin probe, and making method and application thereof
BR112019015682A2 (en) new luciferases and methods of using these
CN104910276A (en) Gene encoded nicotinamide adenine dinucleotide phosphate fluorescent probe, preparation method and application thereof
CN105646716A (en) A gene-encoded cyclic adenylic acid fluorescence probe, and a preparing method and applications thereof
CN105585625B (en) Enhanced green fluorescent protein
CN104277120A (en) Oxidized type nicotinamide adenine dinucleotide gene coding fluorescent probe as well as preparation method and applications thereof
CN109748970B (en) Alpha-ketoglutaric acid optical probe and preparation method and application thereof
CN105524175A (en) Gene encoding hydrogen peroxide fluorescent probe, preparation method and applications thereof
CN115161296B (en) Mutant of spiny shrimp luciferase Nluc and application thereof
EP1468284B1 (en) Method for measuring intracellular atp and/or gene expression
JP2007202555A (en) Vector and method for detecting change in transcriptional level
CN104789639A (en) Fusion protein for detecting NADH dependent type enzyme substrate and application of fusion protein
JP6535483B2 (en) Juvenile hormone sensor
US7544484B2 (en) Nucleic acids encoding membrane-binding proteins and methods of using same
JP2023515926A (en) Arginine fluorescent probe, production method and use thereof
Xia et al. Investigation of the structure and function of a Shewanella oneidensis arsenical-resistance family transporter
Yamamoto et al. Characterization of CitA-CitB signal transduction activating genes involved in anaerobic citrate catabolism in Escherichia coli

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant