CN109627344B

CN109627344B - cAMP fluorescent probe and application thereof

Info

Publication number: CN109627344B
Application number: CN201811620932.0A
Authority: CN
Inventors: 储军; 王亮
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2018-12-28
Filing date: 2018-12-28
Publication date: 2022-05-27
Anticipated expiration: 2038-12-28
Also published as: CN109627344A

Abstract

The invention relates to the field of biological detection, in particular to a cAMP fluorescent probe and application thereof. Compared to the currently available green fluorescent probes, the probes created by the present invention either have a larger dynamic range (compared to cADDis/cAMPr) or have good fluorescence intensity (compared to flamingo 2) and moderate cAMP affinity. Although it is not easy to directly compare with red cAMP probe, the probe of the present invention has better fluorescence brightness compared with the existing red fluorescence probes Pink-Fluamino 2 and R-FlincA. In conclusion, the #252 probe provided by the invention has the performances of fluorescence brightness, dynamic range, affinity and the like, so that the application range of the probe is wider.

Description

cAMP fluorescent probe and application thereof

Technical Field

The invention relates to the field of biological detection, in particular to a cAMP fluorescent probe and application thereof.

Background

Cyclic adenosine monophosphate (cAMP) is a downstream messenger molecule of the largest drug target G protein-coupled receptor (GPCR) family at present, and cAMP fluorescent probes and microscopic imaging studies are important research directions for fundamental research of GPCR signaling pathways and drug development. cAMP fluorescent probes are mainly classified into fluorescent protein-based fluorescence resonance energy transfer probes and single fluorescent protein-based probes, the latter having a larger dynamic range than the former and being simple to use.

cAMP fluorescence imaging in living cells refers to expressing a cAMP fluorescent probe in a cell and then detecting the change in intensity of probe fluorescence using a fluorescence microscope. Fluorescent probes are key to the cAMP fluorescence imaging assay. The available cAMP probes based on a single fluorescent protein and their important properties are shown in the following table, in which #252 is the probe to which the present invention relates. From this table, it can be seen that probes based on a single fluorescent protein are classified into subclasses 2, green and red. Wherein the dynamic ranges of green Flamido 2 and red Pink Flamido 2/R-FlincA and the like are large, but the fluorescence brightness of the cells cultured at 37 ℃ is extremely low; because it also responds to cyclic guanosine monophosphate (cGMP), it is not very selective for cAMP, especially at higher cGMP concentrations (>10 μ M). Other probes have a smaller dynamic range.

TABLE 1

cAMP probes based on a single fluorescent protein are currently classified into the green and Red subclasses 2, the former mainly including Flamido 2, cADDis and cAMPr, and the latter mainly including Pink Flamido, Red cADDis and R-FlincA. In practice, fluorescence brightness, dynamic range, affinity and specificity are 4 important parameters. The sensitivity (related to dynamic range, affinity and the like) and the signal-to-noise ratio (related to fluorescence brightness) of the probe are the key points for acquiring accurate cAMP concentration change and timely spatial distribution information in imaging. However, the dynamic ranges of cADDis, cAMPr and Red cADDis are small at present, and the signal change amplitude does not exceed 60 percent (namely the change quantity delta F/F of fluorescence brightness₀，F₀、F₁The fluorescence intensity of the probe containing no cAMP and the probe binding to a saturated concentration of cAMP, respectively,. DELTA.F = F₁-F₀)/F₀). The luminance of cells cultured at 37 ℃ in the presence of Flamido 2, Pink Flamido and R-FlincA is very low, and the cells also have great response to cGMP with the concentration of 10 mu M and higher, and the specificity is not enough. In summary, for the existing green and red single fluorescent protein-based cAMP probes, the performance of the above 4 aspects needs to be improved to meet the requirement of high sensitivity and high signal-to-noise ratio fluorescence imaging in cells cultured at 37 ℃.

Disclosure of Invention

In view of this, the present invention provides a cAMP fluorescent probe and its application. The invention optimizes the probe part of the cAMP imaging technology to obtain a green probe, so that the signal change amplitude, the fluorescence brightness, the affinity and other properties of the probe are improved.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a cAMP fluorescent probe, which comprises: polypeptides sensitive to cAMP and fluorescent proteins.

In some embodiments of the invention, the polypeptide sensitive to cAMP is MlotiK1 CNBD domain or a functional fragment, analog, derivative or mutant thereof having cAMP binding properties.

In some embodiments of the invention, the MlotiK1 CNBD domain has:

(I) 1, as shown in SEQ ID NO;

(II) an amino acid sequence which is obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence described in (I) and has the same or similar function with the amino acid sequence described in (I);

(III) and an amino acid sequence having at least 80% homology with the amino acid sequence of (I) or (II).

In some embodiments of the invention, the fluorescent protein is the circularly rearranged green fluorescent protein cpEGFP.

In some embodiments of the invention, the fluorescent protein has:

(IV) an amino acid sequence shown as SEQ ID NO: 2;

(V) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence described In (IV), and the amino acid sequence has the same or similar functions with the amino acid sequence described In (IV);

(VI) and an amino acid sequence having at least 80% homology with the amino acid sequence of (IV) or (V).

In some embodiments of the invention, the site of insertion of the fluorescent protein into the MlotiK1 CNBD domain is P/N (74/75), i.e. the site of insertion of the fluorescent protein into the MlotiK1 CNBD domain is between P74 and N75.

In some embodiments of the invention, the cAMP fluorescent probe has a structure as shown in formula I:

MlotiK1 CNBD-N-linker1-cpEGFP-linker2-MlotiK1 CNBD-C

formula I

Wherein Mlotik1 CNBD-N is the N-terminal of Mlotik1 CNBD, and has:

(VII) an amino acid sequence shown as SEQ ID NO: 3;

(VIII) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (VII), which is functionally identical or similar to the amino acid sequence described in (VII);

(IX) an amino acid sequence having at least 80% homology to the amino acid sequence of (VII) or (VIII);

the Mlotik1 CNBD-C is the C end of the Mlotik1 CNBD, and is provided with:

(X) an amino acid sequence shown as SEQ ID NO. 4;

(XI) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in (X), and the amino acid sequence has the same or similar functions with the amino acid sequence shown in (X);

(XII), an amino acid sequence having at least 80% homology to the sequence of (X) or (XI);

linker1 is a first linker peptide having:

(XIII) an amino acid sequence as shown in SEQ ID NO: 5;

(XIV) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (XIII), and an amino acid sequence functionally identical or similar to the amino acid sequence described in (XIII);

(XV), an amino acid sequence which is at least 80% homologous to the amino acid sequence of (XIII) or (XIV);

linker2 is a second linking peptide having:

(XVI) the amino acid sequence shown in SEQ ID NO: 6;

(XVII), an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (XVI), and an amino acid sequence functionally identical or similar to the amino acid sequence described in (XVI);

(XVIII) or an amino acid sequence which is at least 80% homologous to the amino acid sequence described in (XVI) or (XVII).

In some embodiments of the invention, the cAMP fluorescent probe has:

(XIX) the amino acid sequence shown as SEQ ID NO: 7;

(XX) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence shown in (XIX), and the amino acid sequence is functionally identical or similar to the amino acid sequence shown in (XIX);

(XXI), an amino acid sequence which is at least 80% homologous to the amino acid sequence of (XIX) or (XX).

On the basis, the invention also provides a nucleotide for coding the cAMP fluorescent probe.

In some embodiments of the invention, the nucleotides are:

(XXII) having the nucleotide sequence shown by SEQ ID NO. 8;

(XXIII) a nucleotide sequence obtained by modifying, substituting, deleting or adding one or more bases to the nucleotide sequence described in (XXII);

(XXIV), a sequence having at least 80% homology to the nucleotide sequence of (XXII) or (XXIII);

(XXV), and a sequence complementary to the nucleotide sequence described in (XXII), (XXIII) or (XXIV).

The invention also provides an expression vector comprising nucleotides encoding the cAMP fluorescent probe.

The invention also provides a host cell transformed or transfected with the expression vector.

In addition, the invention also provides a preparation method of the cAMP fluorescent probe, which comprises the following steps: culturing the host cell, and inducing the expression of the cAMP fluorescent probe.

On the basis of the research, the invention also provides the application of the cAMP fluorescent probe in detecting cAMP.

In addition, the invention also provides application of the cAMP fluorescent probe in detecting change of cAMP in living cells.

The invention also provides a cAMP detection method, which comprises the following steps:

step 1, constructing an expression vector, wherein the expression vector comprises nucleotides for encoding the cAMP fluorescent probe according to any one of claims 1 to 8;

step 2, obtaining a host cell transformed or transfected with the expression vector;

step 3, culturing the host cell of claim 11, inducing the expression of the cAMP fluorescent probe;

and 4, obtaining the concentration of the cAMP according to the correspondence of the cAMP fluorescent probe to the cAMP in a sample to be detected.

On the basis, the invention also provides a kit comprising the cAMP fluorescent probe.

In this document, the CNBD is MlotiK1 CNBD.

The core of the invention lies in that a novel cAMP probe based on single protein fluorescent protein is screened out through mutation

# 252. Currently, #252 is the best one of the green series of probes, taking into consideration the parameters such as dynamic range, fluorescence intensity, and cAMP affinity. In practical use, the cAMP is expressed in mammalian cells, and a common fluorescence microscope is used to detect whether the cAMP concentration changes after the cells are specifically stimulated.

Since practical application performance of probes is related to various parameter performances, it is difficult to identify which probe is best at present. In the green probe series, #252 of the present invention was better (315%) in signal variation amplitude (Δ F/F0), had a large increase in fluorescence intensity (about 60-fold increase in HEK293 cells), and could work in cells cultured at 37 ℃ as compared to the most informative, optimal Flamido 2. #252 showed a significant increase in brightness compared to the red probes Pink-Flamido and R-FlincA.

Compared to the currently available green fluorescent probes, the probes created by the present invention either have a larger dynamic range (compared to cADDis/cAMPr) or have good fluorescence intensity (compared to flamingo 2) and moderate cAMP affinity. Although it is not easy to directly compare with red cAMP probe, the probe of the present invention has better fluorescence brightness compared with the existing red fluorescence probes Pink-Fluamino 2 and R-FlincA. In conclusion, the #252 probe provided by the invention has the performances of fluorescence brightness, dynamic range, affinity and the like, so that the application range of the probe is wider.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows the design of #252 and its brightness compared to Flamido 2; FIG. 1(A) shows the insertion of the cpEGFP into the cAMP affinity domain, with the left and right connecting peptides WG and RV, respectively, resulting in a #252 probe; FIG. 1(B) shows Flmindo2 transformed with #252 bacteria, after incubation for 15 hours at 34 ℃ and fluorescence imaging of the plates;

FIG. 2 shows the amino acid sequence of # 252; underlined amino acids are components of the connecting peptide, front and back, respectively; a circularly rearranged green fluorescent protein sequence is arranged between the WG and the RV; before WG, CNBD-N sequence, after RV, CNBD-C sequence;

FIG. 3 shows dynamic range determination of #252 probe; FIG. 3(A) shows a #252 probe purified from bacteria diluted in HEPES solution at pH 7.3 to a final concentration of 2. mu.M; FIG. 3(B) shows fluorescence excitation spectra of probe concentration in HEPES solution and saturated concentration of cAMP; the ratio of the red curve to the black curve in FIG. 3 (A); it can be seen that the dynamic range is between 3.5 and 4.15 times within the excitation band of 440-500 nm;

FIG. 4 shows the response curves of Flamindo2 and #252 to cAMP or cGMP; where fluorescence is excited by a 500nm light source;

FIG. 5 shows the brightness and response of the #252 probe in HEK293T cells; FIG. 5(A) HEK cell blank plasmid, Flamido 2 plasmid, #252 plasmid and mEGFP (monomeric green fluorescent protein) plasmid were transfected with Lipofectamine, cultured overnight, starved for 6 hours in DMEM cell culture medium without phenol red and serum, and imaged with a fluorescence microscope; the mean fluorescence intensity of the probe in the cells was marked, and it can be seen that the intensity of #252 was much higher than that of Flamido 2; FIG. 5(B) fluorescence imaging is performed before and after the addition of drugs by adding 60. mu.M Forskolin and 100. mu.M IBMX to the culture medium, and the fluorescence intensity is shown before (0 seconds) and after (e.g., 1500 seconds) the stimulation by the addition of drugs; FIG. 5(C) is a graph showing the change in fluorescence intensity among 1/2/3/4 cells selected in (B);

FIG. 6 shows the excitation spectra of purified 285-ins and #252 after binding to cAMP; the dotted line is the excitation spectrum without addition of cAMP (FIG. 6A), and the solid line is the excitation spectrum after addition of 1mM cAMP at the final concentration (FIG. 6B); as can be seen, the #252 probe had a large positive change;

FIG. 7 shows luminance detection results; it was found that 252 showed a (87-40)/(40-26) brightness of 285-ins of 3.35 times.

Detailed Description

The invention discloses a cAMP fluorescent probe and application thereof, and a person skilled in the art can realize the cAMP fluorescent probe by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The term "fluorescent probe" used in the present invention refers to a polypeptide sensitive to cAMP in the environment, which is fused with a fluorescent protein, specifically Epac protein, wherein the conformational change of the fluorescent protein caused by the binding of a specific cAMP binding domain in Epac with cAMP causes the change of the generated fluorescence, and the fluorescence generated is used to draw a standard curve by the fluorescence of the fluorescent protein measured at different cAMP concentrations, thereby detecting and analyzing the existence level of cAMP in cells.

The term "fusion protein" as used herein is synonymous with "fluorescent fusion protein" and "recombinant fluorescent fusion protein" and refers to an amino acid sequence of a polypeptide or fragment, derivative or analog thereof that comprises a specific binding domain.

The terms "functional fragment", "analogue", "derivative" as used herein refer to a protein having substantially the same biological activity as the CNBD domain of the present invention. Functional fragments, analogues or derivatives of the CNBD domain of the present invention may be:

(1) proteins in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and the amino acid residues so substituted may or may not be genetically encoded, or

(2) A protein having a substituent group in one or more amino acid residues, or

(3) Proteins formed by fusion of an additional amino acid sequence to this protein sequence, or

(4) The mature protein is fused with another compound to form a protein.

Such functional fragments, analogs and derivatives are within the purview of those skilled in the art.

In the present invention, the term "fluorophore" is used synonymously with "fluorescent protein" and refers to a protein that fluoresces by itself or upon irradiation, and fluorescent proteins are often used as a detection means.

The "identity" or "percent identity" of two or more polypeptide or Nucleic acid molecule sequences of the present invention is determined by comparing the sequences of two or more sequences for maximum correspondence over a designated region or comparison window using sequence comparison algorithms known in the art, wherein a portion of the sequences have a percentage of amino acid residues or nucleotides within the designated region that are the same (e.g., 35%, 50%, 70%, 85%, 90%, 95% or 100% identical), and a preferred algorithm suitable for determining sequence similarity or percent identity is the BLAST algorithm, as described in ALtschul et al (1977) Nucleic Acids Res.25: 3389.

In the present invention, "a sequence having 80% homology" is a preferred scheme, and a person skilled in the art can obtain a sequence having 70% homology, a sequence having 50% homology, a sequence having 40% homology, a sequence having 35% homology or a sequence having 30% homology with the sequence provided by the present invention according to actual needs, and further obtain fluorescent probes having similar functions.

The term "variant" as used herein in reference to a polypeptide or protein includes variants having the same function but different sequences as the polypeptide or protein. Such variants include, but are not limited to: a sequence obtained by deletion, insertion and/or substitution of one or more (usually 1 to 30, preferably 1 to 5) amino acids in the polypeptide or protein sequence, and further addition of one or more (usually within 20) amino acids from the N-terminal and/or C-terminal. In the art, substitutions with amino acids having similar or similar properties will not generally alter the function of the polypeptide or protein. In the art, amino acids with similar properties are often referred to as families of amino acids with similar side chains. It is well known to those skilled in the art that in the practice of gene cloning experiments, it is often necessary to design appropriate cleavage sites, which may introduce one or more irrelevant residues at the end of the expressed polypeptide or protein, but which do not affect the activity of the polypeptide or protein of interest.

The term "nucleic acid" as used herein may be in the form of DNA or RNA, and DNA includes cDNA, genomic DNA or synthetic DNA. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature protein may also be a degenerate variant.

As used herein, the term "variant" in reference to a nucleic acid may be a naturally or non-naturally occurring allelic variant. These nucleotide variants include substitution variants, insertion variants and deletion variants. An allelic variant is an alternative form, which may be a substitution, insertion or deletion of one or more nucleotides without substantially altering the functional properties of the encoded protein.

The full-length sequence or a fragment thereof of the fluorescent probe or fusion protein of the present invention can be obtained by PCR amplification or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by methods known to those skilled in the art as templates. Once the sequence of interest is obtained, it can be obtained in bulk by recombinant methods, usually by cloning it into a vector, transferring it into cells and isolating and purifying the fusion protein of interest from the host cells by conventional methods.

At present, DNA sequences encoding the protein of the present invention or fragments or analogs, derivatives, and variants thereof can be obtained completely by chemical synthesis and introduced into various existing vectors or cells known in the art. Alternatively, mutations may be introduced into the protein sequence of the present invention by chemical synthesis or mutation PCR.

The expression vector of the present invention can be used to express the fluorescent probe or fusion protein of the present invention in prokaryotic or eukaryotic cells, and thus the present invention relates to a host cell into which the expression vector of the present invention has been introduced, which can be any prokaryotic or eukaryotic cell, preferably various cells that facilitate the expression or fermentative production of gene products, and are well known and commonly used in the research field, for example, various E.coli nuclear yeast cells. In one embodiment, E.coli is selected for the construction of host cells expressing the fusion proteins of the invention. The transformed cells can be cultured by a conventional method suitable for expression of the host cells to express the fluorescent probe protein of the present invention. The medium used in the culture is various conventional media depending on the host cell used, and then the culture is carried out under conditions suitable for the growth of the host cell. However, after the host cells have been grown to an appropriate cell density, the promoter of choice can be induced by suitable means, such as chemical induction, and the cells then continued to be cultured for a period of time.

The recombinant fusion protein in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. The recombinant protein of interest can be isolated or purified by various isolation methods using its physical, chemical and other properties, as required. These methods include, but are not limited to: conventional centrifugation, sonication or osmotic pressure treatment, renaturation treatment, protein precipitant treatment, affinity chromatography, ion exchange chromatography, molecular sieve chromatography, high performance liquid chromatography, and combinations thereof.

In one embodiment, the fluorescent probe or fusion protein of the invention is produced by fermentation of E.coli comprising the coding sequence of the fusion protein of the invention and purified by affinity chromatography and gel chromatography to give the fluorescent probe or fusion protein of the invention in pure form. Uses of the fluorescent probes of the present invention include, but are not limited to: detecting cAMP levels in physiological states, screening drugs, diagnosing diseases associated with cAMP levels, and the like.

The cAMP fluorescent probe provided by the invention and raw materials and reagents used in the application of the cAMP fluorescent probe can be purchased from the market.

The invention is further illustrated by the following examples:

example 1

Firstly, a CNBD-N-linker1-cpeGFP-linker 2-CNBD-C (Cyclic nucleotide-binding domain, CNBD, Cyclic nucleotide binding domain; N-terminal of CNBD-N, CNBD; C-terminal of CNBD-C, C-terminal of CNBD; cpeGFP, Cyclic rearranged green fluorescent protein; linker, connecting peptide) is constructed. Screening was performed on linker1 and linker2 to obtain #252 probe, which was WG and RV for linker1 and linker2, respectively (FIG. 1A). Flamido 2 and #252 were expressed in bacteria, respectively, and after incubation for 15 hours at 34 ℃, the fluorescence intensity of the #252 probe was seen to be significantly 29-fold higher than that of Flamido 2 (FIG. 1B). The amino acid sequence of #252 is also given (FIG. 2).

Mesorhizobium loti MAFF303099DNA, complete genome RC (ORF sequence) (shown in SEQ ID No. 11)

ATGTCGGTACTGCCTTTCTTAAGAATTTACGCGCCGCTCAACGCGGTGCTGGCTGCGCCTGGGTTGCTGGCGGTGGCTGCGCTCACGATACCGGACATGTCCGGACGAAGCAGACTGGCTCTGGCTGCCCTGCTCGCTGTCATCTGGGGCGCCTATCTCCTGCAACTGGCCGCGACGCTGCTCAAGCGCCGGGCGGGAGTCGTACGGGACAGGACGCCCAAAATCGCCATCGATGTGCTCGCAGTCTTGGTTCCACTCGCCGCATTTCTGCTCGACGGCTCGCCTGACTGGAGCCTCTACTGTGCTGTCTGGCTGCTGAAACCGCTGCGCGACTCGACTTTCTTCCCGGTCCTGGGCAGGGTCCTGGCCAACGAAGCACGCAATCTGATCGGCGTCACCACGCTCTTCGGCGTCGTTCTGTTCGCAGTGGCGCTCGCAGCCTATGTCATCGAGCGCGATATCCAACCGGAAAAGTTCGGCAGCATTCCCCAGGCAATGTGGTGGGCGGTGGTCACGCTGTCCACCACCGGCTATGGGGACACTATCCCGCAAAGCTTCGCCGGCCGCGTCCTTGCCGGGGCGGTCATGATGAGTGGCATCGGCATCTTCGGACTCTGGGCCGGCATTCTTGCCACAGGCTTCTATCAAGAAGTCCGTCGCGGGGATTTCGTCCGCAATTGGCAATTGGTCGCCGCCGTGCCGTTGTTTCAGAAGCTCGGCCCGGCCGTGCTGGTCGAGATCGTGCGCGCCTTAAGAGCCCGCACGGTGCCGGCGGGCGCCGTGATCTGCCGCATTGGCGAGCCCGGCGATCGGATGTTCTTCGTCGTGGAGGGGAGCGTCAGCGTCGCGACGCCGAATCCGGTGGAGCTTGGCCCTGGCGCCTTCTTCGGCGAGATGGCGCTGATCAGCGGCGAACCGCGTTCGGCGACCGTCAGCGCCGCAACGACGGTCTCACTCCTGTCGCTGCATTCGGCGGATTTCCAGATGTTGTGCAGCAGCAGCCCGGAGATCGCGGAAATCTTCCGCAAGACCGCGCTCGAGCGTCGCGGCGCTGCGGCGAGCGCT

mICNBD protein (shown as SEQ ID No. 12)

MSVLPFLRIYAPLNAVLAAPGLLAVAALTIPDMSGRSRLALAALLAVIWGAYLLQLAATLLKRRAGVVRDRTPKIAIDVLAVLVPLAAFLLDGSPDWSLYCAVWLLKPLRDSTFFPVLGRVLANEARNLIGVTTLFGVVLFAVALAAYVIERDIQPEKFGSIPQAMWWAVVTLSTTGYGDTIPQSFAGRVLAGAVMMSGIGIFGLWAGILATGFYQEVRRGDFVRNWQLVAAVPLFQKLGPAVLVEIVRALRARTVPAGAVICRIGEPGDRMFFVVEGSVSVATPNPVELGPGAFFGEMALISGEPRSATVSAATTVSLLSLHSADFQMLCSSSPEIAEIFRKTALERRGAAASA

Example 2

The #252 probe was expressed in bacteria, cultured at room temperature for 2 days to collect cells, sonicated in HEPES buffer (containing 150mM KCl and 50mM HEPES) at pH 7.3, purified using hispu Cobalt Resin (available from pierce corporation), and dissolved in HEPES buffer at pH 7.3 by Econo-Pac 10DG desalting column (available from Bio-Rad, usa), and the probe concentration was determined using BCA kit (available from Thermo scientific, usa). 2mM probe solution was taken and the response of the probe to different concentrations of cAMP and cGMP was detected using a multifunctional microplate reader Infine M1000 PRO, Flamindo2 as a control. It can be seen that the fluorescence intensity of #252 excited in the 440-fold 500nm band increases to 3.5-4.15 times after the addition of the saturated concentration cAMP (. about.500. mu.M) (FIG. 3). Change in fluorescence intensity excited at 500nm at 50. mu.M cAMP concentration (. DELTA.F/F)₀) 2.5 times (fig. 4, curve of the rectangular example); change in fluorescence intensity excited at 500nm at a 50. mu.M cGMP concentration (. DELTA.F/F)₀) At-16% (fig. 4, x exemplary curve). At cGMP > 5. mu.M, #252 the amplitude of the change in signal due to cGMP is significantly less than flaminido 2. At less than 5 μ M cGMP, flaminido 2 showed less amplitude of signal change than #252 due to cGMP, but at this time the signal change was smaller (fig. 4, plot by x example versus plot by triangle example, data shown in table 2).

TABLE 2

Example 3

The cells were starved for 6 hours with serum-free, phenol red-free medium (purchased from GIBCO) after overnight culture by constructing #252, flamido 2, and mmefp (monomeric green fluorescent protein) on eukaryotic expression vectors (CAG promoter), transfecting HEK293T cells (purchased from GE Healthcare Dharmacon) cultured in glass-bottomed dishes with Lipofectamine 2000 kit, respectively. The luminance of the probe was detected by using an IX83 fluorescence microscope self-constructed in this laboratory, and it can be seen that the luminance of #252 in the resting state of the cells is much higher than that of Flamiddo 2, which is improved by about 60 times [ (3000-. The cAMP concentration increased after cells were stimulated with 60. mu.M Forskolin and 100. mu.M IBMX (from Biyunnan Biotech) and the signal of #252 probe varied from 100% to 250% (FIGS. 5B-C). This completes the fluorescence imaging step of changes in cAMP concentration in mammalian cells.

EXAMPLE 4 mutation of fluorescent Probe

285-ins was the pre-optimized probe and 252 was the post-optimized probe. For both comparisons, the different amino acids are marked in bold type: the left Linker is LE for the former and WG for the latter. The right linker is LP for the former and RV for the latter.

The changes made on the fluorescent protein from left to right are: K153T, I171V, S30R, Y39N, S72A, F99V, N105T. These numbers are derived from the fluorescent protein, not the amino acid number on the probe.

The mutation method comprises the following steps: firstly, selecting a site to be mutated, then, designing primers containing mutated amino acids, amplifying fragments containing the mutations by segmented PCR, finally, performing overlap PCR for 1 time to integrate the mutations, and then, performing library selection.

252-ORF (as shown in SEQ ID No. 8):

ATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGATCCGATGGGCTTCTATCAAGAAGTCCGTCGCGGGGATTTCGTCCGCAATTGGCAATTGGTCGCCGCCGTGCCGTTGTTTCAGAAGCTCGGCCCGGCCGTGCTGGTCGAGATCGTGCGCGCCTTAAGAGCCCGCACGGTGCCGGCGGGCGCCGTGATCTGCCGCATTGGCGAGCCCGGCGATCGGATGTTCTTCGTCGTGGAGGGGAGCGTCAGCGTCGCGACGCCGTGGGGGAACGTCTATATCACAGCCGACAAGCAGAAGAACGGCATCAAGGCGAACTTCAAGATCCGCCACAACGTTGAGGACGGCGGCGTGCAGCTCGCCTACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCGTGCAGTCCAAACTTTCGAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGCGGTACCGGAGGGAGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGCGTGGCGAGGGTGAGGGCGATGCCACCAATGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCGCACGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACATCCAGGAGCGCACCATCGTTTTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACCGCGTGAATCCGGTGGAGCTTGGCCCTGGCGCCTTCTTCGGCGAGATGGCGCTGATCAGCGGCGAACCGCGTTCGGCGACCGTCAGCGCCGCAACGACGGTCTCACTCCTGTCGCTGCATTCGGCGGATTTCCAGATGTTGTGCAGCAGCAGCCCGGAGATCGCGGAAATCTTCCGCAAGACCGCGCTCGAGCGTCGCGGCGCTGCGGCGAGCGCT

252 protein (shown as SEQ ID No. 7):

285-ins-ORF (shown as SEQ ID No. 9):

ATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGATCCGATGGGCTTCTATCAAGAAGTCCGTCGCGGGGATTTCGTCCGCAATTGGCAATTGGTCGCCGCCGTGCCGTTGTTTCAGAAGCTCGGCCCGGCCGTGCTGGTCGAGATCGTGCGCGCCTTAAGAGCCCGCACGGTGCCGGCGGGCGCCGTGATCTGCCGCATTGGCGAGCCCGGCGATCGGATGTTCTTCGTCGTGGAGGGGAGCGTCAGCGTCGCGACGCCGCTCGAGAACGTCTATATCAAGGCCGACAAGCAGAAGAACGGCATCAAGGCGAACTTCAAGATCCGCCACAACATCGAGGACGGCGGCGTGCAGCTCGCCTACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCGTGCAGTCCAAACTTTCGAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGGCGGTACCGGAGGGAGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGTGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACATCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACCTGCCGAATCCGGTGGAGCTTGGCCCTGGCGCCTTCTTCGGCGAGATGGCGCTGATCAGCGGCGAACCGCGTTCGGCGACCGTCAGCGCCGCAACGACGGTCTCACTCCTGTCGCTGCATTCGGCGGATTTCCAGATGTTGTGCAGCAGCAGCCCGGAGATCGCGGAAATCTTCCGCAAGACCGCGCTCGAGCGTCGCGGCGCTGCGGCGAGCGCT

285-ins protein (shown in SEQ ID No. 10):

effect of mutation probes:

1, the dynamic range becomes larger.

FIG. 6 shows the excitation spectra of purified 285-ins and #252 after binding to cAMP. The dotted line shows the excitation spectrum (A) without cAMP addition and the solid line shows the excitation spectrum (B) after addition of 1mM cAMP at the final concentration. As can be seen, the #252 probe had a large positive change.

2. The brightness is increased.

FIG. 7 shows 252 the (87-40)/(40-26) ratio of 3.35 times the brightness 285-ins.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Shenzhen advanced technology institute

<120> cAMP fluorescent probe and application thereof

<130> MP1829175

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 355

<212> PRT

<213> CNBD

<400> 1

Met Ser Val Leu Pro Phe Leu Arg Ile Tyr Ala Pro Leu Asn Ala Val

1 5 10 15

Leu Ala Ala Pro Gly Leu Leu Ala Val Ala Ala Leu Thr Ile Pro Asp

20 25 30

Met Ser Gly Arg Ser Arg Leu Ala Leu Ala Ala Leu Leu Ala Val Ile

35 40 45

Trp Gly Ala Tyr Leu Leu Gln Leu Ala Ala Thr Leu Leu Lys Arg Arg

50 55 60

Ala Gly Val Val Arg Asp Arg Thr Pro Lys Ile Ala Ile Asp Val Leu

65 70 75 80

Ala Val Leu Val Pro Leu Ala Ala Phe Leu Leu Asp Gly Ser Pro Asp

85 90 95

Trp Ser Leu Tyr Cys Ala Val Trp Leu Leu Lys Pro Leu Arg Asp Ser

100 105 110

Thr Phe Phe Pro Val Leu Gly Arg Val Leu Ala Asn Glu Ala Arg Asn

115 120 125

Leu Ile Gly Val Thr Thr Leu Phe Gly Val Val Leu Phe Ala Val Ala

130 135 140

Leu Ala Ala Tyr Val Ile Glu Arg Asp Ile Gln Pro Glu Lys Phe Gly

145 150 155 160

Ser Ile Pro Gln Ala Met Trp Trp Ala Val Val Thr Leu Ser Thr Thr

165 170 175

Gly Tyr Gly Asp Thr Ile Pro Gln Ser Phe Ala Gly Arg Val Leu Ala

180 185 190

Gly Ala Val Met Met Ser Gly Ile Gly Ile Phe Gly Leu Trp Ala Gly

195 200 205

Ile Leu Ala Thr Gly Phe Tyr Gln Glu Val Arg Arg Gly Asp Phe Val

210 215 220

Arg Asn Trp Gln Leu Val Ala Ala Val Pro Leu Phe Gln Lys Leu Gly

225 230 235 240

Pro Ala Val Leu Val Glu Ile Val Arg Ala Leu Arg Ala Arg Thr Val

245 250 255

Pro Ala Gly Ala Val Ile Cys Arg Ile Gly Glu Pro Gly Asp Arg Met

260 265 270

Phe Phe Val Val Glu Gly Ser Val Ser Val Ala Thr Pro Asn Pro Val

275 280 285

Glu Leu Gly Pro Gly Ala Phe Phe Gly Glu Met Ala Leu Ile Ser Gly

290 295 300

Glu Pro Arg Ser Ala Thr Val Ser Ala Ala Thr Thr Val Ser Leu Leu

305 310 315 320

Ser Leu His Ser Ala Asp Phe Gln Met Leu Cys Ser Ser Ser Pro Glu

325 330 335

Ile Ala Glu Ile Phe Arg Lys Thr Ala Leu Glu Arg Arg Gly Ala Ala

340 345 350

Ala Ser Ala

355

<210> 2

<211> 241

<212> PRT

<213> cpEGFP

<400> 2

Asn Val Tyr Ile Thr Ala Asp Lys Gln Lys Asn Gly Ile Lys Ala Asn

1 5 10 15

Phe Lys Ile Arg His Asn Val Glu Asp Gly Gly Val Gln Leu Ala Tyr

20 25 30

His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro

35 40 45

Asp Asn His Tyr Leu Ser Val Gln Ser Lys Leu Ser Lys Asp Pro Asn

50 55 60

Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val Thr Ala Ala Gly

65 70 75 80

Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys Gly Gly Thr Gly Gly Ser

85 90 95

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

100 105 110

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Arg Gly

115 120 125

Glu Gly Glu Gly Asp Ala Thr Asn Gly Lys Leu Thr Leu Lys Phe Ile

130 135 140

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

145 150 155 160

Leu Thr Tyr Gly Val Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys

165 170 175

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Ile Gln Glu

180 185 190

Arg Thr Ile Val Phe Lys Asp Asp Gly Thr Tyr Lys Thr Arg Ala Glu

195 200 205

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

210 215 220

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

225 230 235 240

Asn

<210> 3

<211> 285

<212> PRT

<213> CNBD-N

<400> 3

Met Ser Val Leu Pro Phe Leu Arg Ile Tyr Ala Pro Leu Asn Ala Val

1 5 10 15

Leu Ala Ala Pro Gly Leu Leu Ala Val Ala Ala Leu Thr Ile Pro Asp

20 25 30

Met Ser Gly Arg Ser Arg Leu Ala Leu Ala Ala Leu Leu Ala Val Ile

35 40 45

Trp Gly Ala Tyr Leu Leu Gln Leu Ala Ala Thr Leu Leu Lys Arg Arg

50 55 60

Ala Gly Val Val Arg Asp Arg Thr Pro Lys Ile Ala Ile Asp Val Leu

65 70 75 80

Ala Val Leu Val Pro Leu Ala Ala Phe Leu Leu Asp Gly Ser Pro Asp

85 90 95

Trp Ser Leu Tyr Cys Ala Val Trp Leu Leu Lys Pro Leu Arg Asp Ser

100 105 110

Thr Phe Phe Pro Val Leu Gly Arg Val Leu Ala Asn Glu Ala Arg Asn

115 120 125

Leu Ile Gly Val Thr Thr Leu Phe Gly Val Val Leu Phe Ala Val Ala

130 135 140

Leu Ala Ala Tyr Val Ile Glu Arg Asp Ile Gln Pro Glu Lys Phe Gly

145 150 155 160

Ser Ile Pro Gln Ala Met Trp Trp Ala Val Val Thr Leu Ser Thr Thr

165 170 175

Gly Tyr Gly Asp Thr Ile Pro Gln Ser Phe Ala Gly Arg Val Leu Ala

180 185 190

Gly Ala Val Met Met Ser Gly Ile Gly Ile Phe Gly Leu Trp Ala Gly

195 200 205

Ile Leu Ala Thr Gly Phe Tyr Gln Glu Val Arg Arg Gly Asp Phe Val

210 215 220

Arg Asn Trp Gln Leu Val Ala Ala Val Pro Leu Phe Gln Lys Leu Gly

225 230 235 240

Pro Ala Val Leu Val Glu Ile Val Arg Ala Leu Arg Ala Arg Thr Val

245 250 255

Pro Ala Gly Ala Val Ile Cys Arg Ile Gly Glu Pro Gly Asp Arg Met

260 265 270

Phe Phe Val Val Glu Gly Ser Val Ser Val Ala Thr Pro

275 280 285

<210> 4

<211> 70

<212> PRT

<213> CNBD-C

<400> 4

Asn Pro Val Glu Leu Gly Pro Gly Ala Phe Phe Gly Glu Met Ala Leu

1 5 10 15

Ile Ser Gly Glu Pro Arg Ser Ala Thr Val Ser Ala Ala Thr Thr Val

20 25 30

Ser Leu Leu Ser Leu His Ser Ala Asp Phe Gln Met Leu Cys Ser Ser

35 40 45

Ser Pro Glu Ile Ala Glu Ile Phe Arg Lys Thr Ala Leu Glu Arg Arg

50 55 60

Gly Ala Ala Ala Ser Ala

65 70

<210> 5

<211> 2

<212> PRT

<213> linker1

<400> 5

Trp Gly

1

<210> 6

<211> 2

<212> PRT

<213> linker2

<400> 6

Arg Val

1

<210> 7

<211> 422

<212> PRT

<213> cAMP fluorescent Probe (cAMP fluorescent Probe)

<400> 7

Met Arg Gly Ser His His His His His His Gly Met Ala Ser Met Thr

1 5 10 15

Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys Asp

20 25 30

Pro Met Gly Phe Tyr Gln Glu Val Arg Arg Gly Asp Phe Val Arg Asn

35 40 45

Trp Gln Leu Val Ala Ala Val Pro Leu Phe Gln Lys Leu Gly Pro Ala

50 55 60

Val Leu Val Glu Ile Val Arg Ala Leu Arg Ala Arg Thr Val Pro Ala

65 70 75 80

Gly Ala Val Ile Cys Arg Ile Gly Glu Pro Gly Asp Arg Met Phe Phe

85 90 95

Val Val Glu Gly Ser Val Ser Val Ala Thr Pro Trp Gly Asn Val Tyr

100 105 110

Ile Thr Ala Asp Lys Gln Lys Asn Gly Ile Lys Ala Asn Phe Lys Ile

115 120 125

Arg His Asn Val Glu Asp Gly Gly Val Gln Leu Ala Tyr His Tyr Gln

130 135 140

Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His

145 150 155 160

Tyr Leu Ser Val Gln Ser Lys Leu Ser Lys Asp Pro Asn Glu Lys Arg

165 170 175

Asp His Met Val Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu

180 185 190

Gly Met Asp Glu Leu Tyr Lys Gly Gly Thr Gly Gly Ser Met Val Ser

195 200 205

Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu

210 215 220

Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Arg Gly Glu Gly Glu

225 230 235 240

Gly Asp Ala Thr Asn Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr

245 250 255

Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr

260 265 270

Gly Val Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys Gln His Asp

275 280 285

Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Ile Gln Glu Arg Thr Ile

290 295 300

Val Phe Lys Asp Asp Gly Thr Tyr Lys Thr Arg Ala Glu Val Lys Phe

305 310 315 320

Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe

325 330 335

Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Arg Val

340 345 350

Asn Pro Val Glu Leu Gly Pro Gly Ala Phe Phe Gly Glu Met Ala Leu

355 360 365

Ile Ser Gly Glu Pro Arg Ser Ala Thr Val Ser Ala Ala Thr Thr Val

370 375 380

Ser Leu Leu Ser Leu His Ser Ala Asp Phe Gln Met Leu Cys Ser Ser

385 390 395 400

Ser Pro Glu Ile Ala Glu Ile Phe Arg Lys Thr Ala Leu Glu Arg Arg

405 410 415

Gly Ala Ala Ala Ser Ala

420

<210> 8

<211> 1266

<212> DNA

<213> cAMP fluorescent Probe (cAMP fluorescent Probe)

<400> 8

atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60

atgggtcggg atctgtacga cgatgacgat aaggatccga tgggcttcta tcaagaagtc 120

cgtcgcgggg atttcgtccg caattggcaa ttggtcgccg ccgtgccgtt gtttcagaag 180

ctcggcccgg ccgtgctggt cgagatcgtg cgcgccttaa gagcccgcac ggtgccggcg 240

ggcgccgtga tctgccgcat tggcgagccc ggcgatcgga tgttcttcgt cgtggagggg 300

agcgtcagcg tcgcgacgcc gtgggggaac gtctatatca cagccgacaa gcagaagaac 360

ggcatcaagg cgaacttcaa gatccgccac aacgttgagg acggcggcgt gcagctcgcc 420

taccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 480

tacctgagcg tgcagtccaa actttcgaaa gaccccaacg agaagcgcga tcacatggtc 540

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagggc 600

ggtaccggag ggagcatggt gagcaagggc gaggagctgt tcaccggggt ggtgcccatc 660

ctggtcgagc tggacggcga cgtaaacggc cacaagttca gcgtgcgtgg cgagggtgag 720

ggcgatgcca ccaatggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc 780

gtgccctggc ccaccctcgt gaccaccctg acctacggcg tgcagtgctt cgcacgctac 840

cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacatccag 900

gagcgcacca tcgttttcaa ggacgacggc acctacaaga cccgcgccga ggtgaagttc 960

gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc 1020

aacatcctgg ggcacaagct ggagtacaac cgcgtgaatc cggtggagct tggccctggc 1080

gccttcttcg gcgagatggc gctgatcagc ggcgaaccgc gttcggcgac cgtcagcgcc 1140

gcaacgacgg tctcactcct gtcgctgcat tcggcggatt tccagatgtt gtgcagcagc 1200

agcccggaga tcgcggaaat cttccgcaag accgcgctcg agcgtcgcgg cgctgcggcg 1260

agcgct 1266

<210> 9

<211> 1266

<212> DNA

<213> 285-ins-ORF

<400> 9

atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatgactgg tggacagcaa 60

atgggtcggg atctgtacga cgatgacgat aaggatccga tgggcttcta tcaagaagtc 120

cgtcgcgggg atttcgtccg caattggcaa ttggtcgccg ccgtgccgtt gtttcagaag 180

ctcggcccgg ccgtgctggt cgagatcgtg cgcgccttaa gagcccgcac ggtgccggcg 240

ggcgccgtga tctgccgcat tggcgagccc ggcgatcgga tgttcttcgt cgtggagggg 300

agcgtcagcg tcgcgacgcc gtgggggaac gtctatatca cagccgacaa gcagaagaac 360

ggcatcaagg cgaacttcaa gatccgccac aacgttgagg acggcggcgt gcagctcgcc 420

taccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 480

tacctgagcg tgcagtccaa actttcgaaa gaccccaacg agaagcgcga tcacatggtc 540

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagggc 600

ggtaccggag ggagcatggt gagcaagggc gaggagctgt tcaccggggt ggtgcccatc 660

ctggtcgagc tggacggcga cgtaaacggc cacaagttca gcgtgcgtgg cgagggtgag 720

ggcgatgcca ccaatggcaa gctgaccctg aagttcatct gcaccaccgg caagctgccc 780

gtgccctggc ccaccctcgt gaccaccctg acctacggcg tgcagtgctt cgcacgctac 840

cccgaccaca tgaagcagca cgacttcttc aagtccgcca tgcccgaagg ctacatccag 900

gagcgcacca tcgttttcaa ggacgacggc acctacaaga cccgcgccga ggtgaagttc 960

gagggcgaca ccctggtgaa ccgcatcgag ctgaagggca tcgacttcaa ggaggacggc 1020

aacatcctgg ggcacaagct ggagtacaac cgcgtgaatc cggtggagct tggccctggc 1080

gccttcttcg gcgagatggc gctgatcagc ggcgaaccgc gttcggcgac cgtcagcgcc 1140

gcaacgacgg tctcactcct gtcgctgcat tcggcggatt tccagatgtt gtgcagcagc 1200

agcccggaga tcgcggaaat cttccgcaag accgcgctcg agcgtcgcgg cgctgcggcg 1260

agcgct 1266

<210> 10

<211> 422

<212> PRT

<213> 285-ins-ORF

<400> 10

Met Arg Gly Ser His His His His His His Gly Met Ala Ser Met Thr

1 5 10 15

Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys Asp

20 25 30

Pro Met Gly Phe Tyr Gln Glu Val Arg Arg Gly Asp Phe Val Arg Asn

35 40 45

Trp Gln Leu Val Ala Ala Val Pro Leu Phe Gln Lys Leu Gly Pro Ala

50 55 60

Val Leu Val Glu Ile Val Arg Ala Leu Arg Ala Arg Thr Val Pro Ala

65 70 75 80

Gly Ala Val Ile Cys Arg Ile Gly Glu Pro Gly Asp Arg Met Phe Phe

85 90 95

Val Val Glu Gly Ser Val Ser Val Ala Thr Pro Leu Glu Asn Val Tyr

100 105 110

Ile Lys Ala Asp Lys Gln Lys Asn Gly Ile Lys Ala Asn Phe Lys Ile

115 120 125

Arg His Asn Ile Glu Asp Gly Gly Val Gln Leu Ala Tyr His Tyr Gln

130 135 140

Gln Asn Thr Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His

145 150 155 160

Tyr Leu Ser Val Gln Ser Lys Leu Ser Lys Asp Pro Asn Glu Lys Arg

165 170 175

Asp His Met Val Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu

180 185 190

Gly Met Asp Glu Leu Tyr Lys Gly Gly Thr Gly Gly Ser Met Val Ser

195 200 205

Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val Glu Leu

210 215 220

Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu Gly Glu

225 230 235 240

Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys Thr Thr

245 250 255

Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu Thr Tyr

260 265 270

Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln His Asp

275 280 285

Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Ile Gln Glu Arg Thr Ile

290 295 300

Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val Lys Phe

305 310 315 320

Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile Asp Phe

325 330 335

Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn Leu Pro

340 345 350

Asn Pro Val Glu Leu Gly Pro Gly Ala Phe Phe Gly Glu Met Ala Leu

355 360 365

Ile Ser Gly Glu Pro Arg Ser Ala Thr Val Ser Ala Ala Thr Thr Val

370 375 380

Ser Leu Leu Ser Leu His Ser Ala Asp Phe Gln Met Leu Cys Ser Ser

385 390 395 400

Ser Pro Glu Ile Ala Glu Ile Phe Arg Lys Thr Ala Leu Glu Arg Arg

405 410 415

Gly Ala Ala Ala Ser Ala

420

<210> 11

<211> 1065

<212> DNA

<213> mICNBD

<400> 11

atgtcggtac tgcctttctt aagaatttac gcgccgctca acgcggtgct ggctgcgcct 60

gggttgctgg cggtggctgc gctcacgata ccggacatgt ccggacgaag cagactggct 120

ctggctgccc tgctcgctgt catctggggc gcctatctcc tgcaactggc cgcgacgctg 180

ctcaagcgcc gggcgggagt cgtacgggac aggacgccca aaatcgccat cgatgtgctc 240

gcagtcttgg ttccactcgc cgcatttctg ctcgacggct cgcctgactg gagcctctac 300

tgtgctgtct ggctgctgaa accgctgcgc gactcgactt tcttcccggt cctgggcagg 360

gtcctggcca acgaagcacg caatctgatc ggcgtcacca cgctcttcgg cgtcgttctg 420

ttcgcagtgg cgctcgcagc ctatgtcatc gagcgcgata tccaaccgga aaagttcggc 480

agcattcccc aggcaatgtg gtgggcggtg gtcacgctgt ccaccaccgg ctatggggac 540

actatcccgc aaagcttcgc cggccgcgtc cttgccgggg cggtcatgat gagtggcatc 600

ggcatcttcg gactctgggc cggcattctt gccacaggct tctatcaaga agtccgtcgc 660

ggggatttcg tccgcaattg gcaattggtc gccgccgtgc cgttgtttca gaagctcggc 720

ccggccgtgc tggtcgagat cgtgcgcgcc ttaagagccc gcacggtgcc ggcgggcgcc 780

gtgatctgcc gcattggcga gcccggcgat cggatgttct tcgtcgtgga ggggagcgtc 840

agcgtcgcga cgccgaatcc ggtggagctt ggccctggcg ccttcttcgg cgagatggcg 900

ctgatcagcg gcgaaccgcg ttcggcgacc gtcagcgccg caacgacggt ctcactcctg 960

tcgctgcatt cggcggattt ccagatgttg tgcagcagca gcccggagat cgcggaaatc 1020

ttccgcaaga ccgcgctcga gcgtcgcggc gctgcggcga gcgct 1065

<210> 12

<211> 355

<212> PRT

<213> mICNBD

<400> 12

Met Ser Val Leu Pro Phe Leu Arg Ile Tyr Ala Pro Leu Asn Ala Val

1 5 10 15

Leu Ala Ala Pro Gly Leu Leu Ala Val Ala Ala Leu Thr Ile Pro Asp

20 25 30

Met Ser Gly Arg Ser Arg Leu Ala Leu Ala Ala Leu Leu Ala Val Ile

35 40 45

Trp Gly Ala Tyr Leu Leu Gln Leu Ala Ala Thr Leu Leu Lys Arg Arg

50 55 60

Ala Gly Val Val Arg Asp Arg Thr Pro Lys Ile Ala Ile Asp Val Leu

65 70 75 80

Ala Val Leu Val Pro Leu Ala Ala Phe Leu Leu Asp Gly Ser Pro Asp

85 90 95

Trp Ser Leu Tyr Cys Ala Val Trp Leu Leu Lys Pro Leu Arg Asp Ser

100 105 110

Thr Phe Phe Pro Val Leu Gly Arg Val Leu Ala Asn Glu Ala Arg Asn

115 120 125

Leu Ile Gly Val Thr Thr Leu Phe Gly Val Val Leu Phe Ala Val Ala

130 135 140

Leu Ala Ala Tyr Val Ile Glu Arg Asp Ile Gln Pro Glu Lys Phe Gly

145 150 155 160

Ser Ile Pro Gln Ala Met Trp Trp Ala Val Val Thr Leu Ser Thr Thr

165 170 175

Gly Tyr Gly Asp Thr Ile Pro Gln Ser Phe Ala Gly Arg Val Leu Ala

180 185 190

Gly Ala Val Met Met Ser Gly Ile Gly Ile Phe Gly Leu Trp Ala Gly

195 200 205

Ile Leu Ala Thr Gly Phe Tyr Gln Glu Val Arg Arg Gly Asp Phe Val

210 215 220

Arg Asn Trp Gln Leu Val Ala Ala Val Pro Leu Phe Gln Lys Leu Gly

225 230 235 240

Pro Ala Val Leu Val Glu Ile Val Arg Ala Leu Arg Ala Arg Thr Val

245 250 255

Pro Ala Gly Ala Val Ile Cys Arg Ile Gly Glu Pro Gly Asp Arg Met

260 265 270

Phe Phe Val Val Glu Gly Ser Val Ser Val Ala Thr Pro Asn Pro Val

275 280 285

Glu Leu Gly Pro Gly Ala Phe Phe Gly Glu Met Ala Leu Ile Ser Gly

290 295 300

Glu Pro Arg Ser Ala Thr Val Ser Ala Ala Thr Thr Val Ser Leu Leu

305 310 315 320

Ser Leu His Ser Ala Asp Phe Gln Met Leu Cys Ser Ser Ser Pro Glu

325 330 335

Ile Ala Glu Ile Phe Arg Lys Thr Ala Leu Glu Arg Arg Gly Ala Ala

340 345 350

Ala Ser Ala

355

Claims

1. The amino acid sequence of the cAMP fluorescent probe is shown as SEQ ID NO. 7.

2. A nucleotide encoding the cAMP fluorescent probe of claim 1.

3. The nucleotide of claim 2, having:

(1) the nucleotide sequence shown as SEQ ID NO. 8;

(2) and (2) a sequence having at least 80% homology with the nucleotide sequence of (1).

4. An expression vector comprising nucleotides encoding the cAMP fluorescent probe of claim 1.

5. A host cell transformed or transfected with the expression vector of claim 4.

6. The method for preparing cAMP fluorescent probe according to claim 1, comprising: culturing the host cell of claim 5, inducing expression of the cAMP fluorescent probe.

7. Use of the cAMP fluorescent probe according to claim 1 for the detection of cAMP for non-diagnostic purposes.

8. Use of the cAMP fluorescent probe according to claim 1 for the detection of changes in cAMP in living cells for non-diagnostic purposes.

9. A method for the detection of cAMP of non-diagnostic purpose, comprising the steps of:

step 1, constructing an expression vector, wherein the expression vector comprises nucleotides for encoding the cAMP fluorescent probe in the claim 1;

step 2, obtaining a host cell for transforming or transfecting the expression vector;

step 3, culturing the host cell of claim 5, inducing the expression of the cAMP fluorescent probe;

and 4, obtaining the concentration of the cAMP through the response of the cAMP fluorescent probe to the cAMP in a sample to be detected.

10. A kit comprising the cAMP fluorescent probe according to claim 1.