CN104211811A - Copper silver ion fluorescin probe, and making method and application thereof - Google Patents

Copper silver ion fluorescin probe, and making method and application thereof Download PDF

Info

Publication number
CN104211811A
CN104211811A CN201310216584.1A CN201310216584A CN104211811A CN 104211811 A CN104211811 A CN 104211811A CN 201310216584 A CN201310216584 A CN 201310216584A CN 104211811 A CN104211811 A CN 104211811A
Authority
CN
China
Prior art keywords
ion
sequence
protein
albumen
fusion rotein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201310216584.1A
Other languages
Chinese (zh)
Inventor
杨弋
房晓明
邓敏琰
尹琴
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Original Assignee
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology filed Critical East China University of Science and Technology
Priority to CN201310216584.1A priority Critical patent/CN104211811A/en
Publication of CN104211811A publication Critical patent/CN104211811A/en
Pending legal-status Critical Current

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides a genetically encoded Cu/Ag ion fluorescence probe. The genetically encoded Cu/Ag ion fluorescence probe is composed of a protein sensitive to Cu/Ag ions and a part displaying the Cu/Ag ions through the changes of spectral properties, wherein the part displaying the Cu/Ag ions is a fluorescin sequence or its derivative, and the protein sensitive to Cu/Ag ions has the following polypeptides or functional fragments thereof: (1) a structural domain with a Cu/Ag ion binding property; and/or (2) a transcription regulation factor CueR protein sensitive to Cu/Ag ions. The invention also provides a fusion protein containing the fluorescence probe, a nucleotide sequence encoding the fluorescence probe or the fusion protein, an expression vector containing the nucleotide sequence, a preparation method of the fluorescence probe or the fusion protein, and a kit for detecting the Cu/Ag ions or screening drugs. The fluorescence probe uses the CueR protein to experience changes of Cu/Ag ion concentration and state in environment, can describe the Cu/Ag ions through the generation or not of fluorescence by the fluorescence protein the fluorescence intensity in a intuitive real-time manner, and can detect the Cu/Ag ions physiologically and subcellularly.

Description

Copper silver ion fluorescin probe and its preparation method and application
Technical field
The present invention relates to the detection probes of Cu/Ag ion, be specifically related to the restructuring fluorescent fusion protein detection probes of Cu/Ag ion.The present invention also relates to the preparation method of above-mentioned detection probes and detecting the application in Cu/Ag ion.
Background technology
The traditional method of metal ion detection mainly contains atomic absorption spectrum, atomic emission spectrum, spectrophotometry, electric coupling ICP-MS, electrochemical process and fluorometry etc., these methods respectively have its relative merits, or there are certain requirements plant and instrument and operation and easily limited, or are easily disturbed in the detection the discrimination of transition metal radius is not high.Fluorometry is favored by investigator because it has high sensitivity and the advantage such as easy to operate, and the fluorescent small molecule chemical probe set up on its basis has had tremendous development.It is uneven that the small-molecule chemical probe being representative with aromatic hydrocarbons and polyamines class has sensitivity unavoidably, the shortcoming that interaction medium is single.And the chemical small molecule probe of external source synthesis will characterize the activity of intracellular metal ion, there is several factors that this process can not be carried out smoothly entering in cytolemma and the process that plays a role, as the permeable membrane of Small-molecule probe, cytotoxicity that may exist etc., thus can not meet the requirement of life medical scientific.Therefore, the specificity copper silver ion detection technique of development a kind of specific detection technology for copper silver ion, particularly a kind of applicable physiological level and subcellsular level is badly in need of in this area.
Along with the fast development of molecular biology and protein science, in cell, the structures and characteristics research of metal transcriptional regulation protein family is day by day clear, these transcriptional regulation proteins often have specific binding ability to metal ion, and they can be used to the content of inferring endocellular liberation metal ion to the affinity of metal ion.These albumen become the native pattern albumen utilizing fluorescin construction of strategy metal ions in cells probe.
And relative to traditional small molecule dyes detection technique and the quantum dots characterization technology that develops rapidly, fluorescin detection technique has unique overwhelming dominance at most active somatic cell imaging side mask, it can be directed in cell, tissue and even whole organ by heredity, therefore the fluorescin telltale that can activate as a full cell marker or gene promoter.
Green fluorescent protein is extract from Victoria's multitube luminescent jellyfish (Aequorea victoria) at first, and the AvGFP of wild-type is by 238 Amino acid profiles, and molecular weight is about 26kD.Current research confirms, in natural GFP albumen, three amino acid Ser-Tyr-Gly of 65th ~ 67 can spontaneous formation fluorescence chromophore: p-phenol methylene imidazolone (ρ-hydroxybenzylideneimidazolinone) is its main luminous position.The spectral signature of wild-type AvGFP is very complicated, and the main peak of its fluorescence excitation at 395nm place, and separately has an attached peak at 475nm place, the latter's oscillator intensity is about the former 1/3.Under the solution condition of standard, 395nm place excites the transmitting that can produce 508nm place, and the maximum emission wavelength of generation that excites at 475nm place is positioned at 503nm (Heim, R. etc., Proc Natl Acad Sci U S A.1994, V.91 (26), pp.12501-12504).
Day by day go deep into along with to the research of GFP protein mutation, utilize Protocols in Molecular Biology, develop multiple GFP derivative of having outstanding performance at present, by carrying out different simple point mutations or combination on wild-type GFP basis, such as enhancement type GFP (S65T, F64L), YFP (T203Y), CFP (Y66W) etc. can be obtained.And by rearranging GFP protein sequence, the N of former 145-238 amino acids part as new albumen is held, former 1-144 amino acids is held as the C of new albumen, two panels is intersegmental has flexible short peptide chain connection by a bit of, form a circular permutation fluorescin to spatial variations sensitivity (circular permutation fluorescent protein), the point mutation carried out former albumen T203Y on this basis just defines the yellow fluorescence protein cpYFP (Nagai of circular permutation, T. etc., Proc Natl Acad Sci U S A.2001, V.98 (6), pp.3197-3202).
Due to day by day deep to fluorescin research, some relevant analysis and detection technologies based on fluorescence also obtain further development.Such as current conventional FRET (fluorescence resonance energy transfer) (FRET) technology, this technology cardinal principle be when two fluorescence chromophoric groups enough near time, higher electron energy state is excited to after donor molecule absorbs the photon of certain frequency, before this electronics gets back to ground state, by dipole-dipole interaction, achieve energy to contiguous acceptor molecule transfer (namely resonance energy transfer occurring).FRET is a kind of non-radiative energy transition, interacted by intermolecular eelctric dipole, donor excited energy is transferred to the process of acceptor excited state, donor fluorescence intensity is reduced, and acceptor can launch the characteristic fluorescence (sensitized fluorescence) being more better than itself, also can not fluoresce (quenching of fluorescence).The current further research to green fluorescent protein finds, is the donor/acceptor pair done well for a pair derived from the cyan fluorescent protein (CFP) of modified enhanced green fluorescent protein and yellow fluorescence protein (YFP).The emmission spectrum of CFP and the absorption spectrum of YFP have suitable overlapping, when they enough close to time, excite by the absorbing wavelength of CFP, the chromophoric group of CFP will energy efficient rate ground resonance transfer on the chromophoric group of YFP, so the emitting fluorescence of CFP will weaken or disappear, dominant emission will be the fluorescence of YFP.6 powers of the effciency of energy transfer between two chromophoric groups and the space length between them are inversely proportional to, very sensitive to the change of locus.Therefore now studies have reported that and utilize genetically engineered recombinant means to expect that the protein gene two ends of research go out a brand-new fusion rotein respectively with CFP and YFP amalgamation and expression, namely the spatial variations that the combination of this albumen target molecules narrow spectrum with it produces is manifested intuitively by the change of fluorescence.
Therefore, fluorescent protein sequence used herein can come from fluorescin and the derivative thereof of Victoria's multitube luminescent jellyfish (Aequorea victoria), including, but not limited to these mutant: the sequence of yellow fluorescence protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP) etc., the wherein sequence of preferred yellow fluorescence protein YFP, the sequence of the yellow fluorescence protein cpYFP of more preferably circular permutation.
Another PROTEIN C ueR involved in this technology is a kind of bacterial transcription regulatory albumen known in the art, participates in regulating intracellular content of copper ion.According to the people such as Changela (A.Changela, K.Chen, Y.Xue, J.Holschen, C.Outten, T.O'Halloran, A.Mondragon, Molecular basis of metal-ion selectivity and zeptomolar sensitivity by CueR.Science301 (2003) 1383-1387.) function research that CueR is carried out, it contains three structural domains, respectively: the metal binding domain of C end, the DNA binding domains of N end and the dimer region of centre.The critical sites that research shows to relate in CueR albumen melts combine is positioned at the halfcystine of 112 and 120, when metal ion be attached to metal bonding pad, can there is deformation in albumen self, be beneficial to very much Cu in the cell that builds and combine with fluorescin +probe.
Although CueR albumen itself is to Cu/Ag ionic concn and state sensitive in environment, but himself occur change can not demonstrate intuitively and catch by the external world, and by means of this instrument of fluorescin, we can well by carrying out amalgamation and expression by both, obtain the fluorescent probe of a brand-new genes encoding, CueR albumen is utilized to experience the change of Cu/Ag ionic concn and state in environment and this change is passed to fluorescin, fluorescence is produced whether and the power of fluorescence by fluorescin, Cu/Ag ionic concn in environment and state are changed and carries out in real time and describe intuitively.
In sum, we think, utilize the restructuring fluorescent fusion protein comprising CueR albumen to meet to detect on physiological level and subcellsular level Cu/Ag ion in the urgent need to.
Should not think quoting or discussing and mean and admit that these reference are prior aries of the present invention reference described herein.
Summary of the invention
First object of the present invention is to provide a kind of Cu/Ag ion fluorescence probe of genetic coding.
Second object of the present invention is to provide the fusion rotein of the Cu/Ag ion fluorescence probe comprising genetic coding.
3rd object of the present invention is to provide nucleotide sequence or its complementary sequence of the described fluorescent probe of coding or described fusion rotein.
4th object of the present invention is to provide the expression vector comprising described nucleotide sequence.
5th object of the present invention is to provide the method for the described fluorescent probe of preparation or described fusion rotein.
6th object of the present invention is to provide the test kit for detecting Cu/Ag ion or screening of medicaments.
The Cu/Ag ion fluorescence probe of genetic coding provided by the invention is made up of the part that Cu/Ag ion shows the albumen to Cu/Ag ion-sensitive and the change by spectral quality, the wherein said change by spectral quality is fluorescent protein sequence or derivatives thereof to the part that Cu/Ag ion shows, and the described albumen to Cu/Ag ion-sensitive is polypeptide or its function fragment with following feature:
(1) there is the structural domain B of Cu/Ag ionic bond characteristic; And/or
(2) the transcriptional regulator CueR albumen to Cu/Ag ion-sensitive is derived from.
In a preferred embodiment, the described polypeptide to Cu/Ag ion-sensitive can have following characteristics:
(1) containing the transcriptional regulator CueR albumen coming from bacterium, the aminoacid sequence of this albumen is SEQ ID NO:1; With
(2) any homology or nonhomologous sequence with (1) described sequence with 70% homogeny, preferably any homology or nonhomologous sequence with (1) described sequence with 70% homogeny at least 24 amino-acid residues in aminoacid sequence.
In another embodiment, fluorescent probe of the present invention can comprise the Cys-Cys structure B shown in SEQ ID NO:1 with Cu/Ag ionic bond characteristic and respectively by fluorescent protein sequence A, A1 and/or the A2 shown in SEQ ID NO:2,3,4, its array configuration can be:
(1)B-A-B；
(2) A1-B-A2, wherein A1 and A2 can be identical or different, A1 can be the aminoacid sequence of the fluorescin or derivatives thereof coming from Victoria's multitube luminescent jellyfish, and A2 can be the aminoacid sequence of another fluorescin or derivatives thereof coming from Victoria's multitube luminescent jellyfish;
(3) second section of the first part-A-B of B, wherein A is inserted in the flexible region of B, thus B is divided into the first part of B and the second section of B, and the first part of B and the second section of B form complete B structural domain; Or
(4) second section-B of the first part-A-B of B, wherein A is inserted in the flexible region of B, thus B is divided into the first part of B and the second section of B, the first part of B and the second section of B form complete B structural domain, and the end of chimeric sequences also connects a B.
The above-mentioned A site be inserted in the flexible region of B can be any one in B structural domain flexible region in site 113,114,115,116,117,118 and 119, and the A inserted in the flexible region of B can be one or more.
In one embodiment, fluorescent probe provided by the invention comprises any fragment of fluorophore and CueR albumen or CueR albumen, derivative or analogue.In another embodiment, fluorescent probe provided by the invention comprises the varient of fluorophore and CueR albumen.In another embodiment, fluorescent probe provided by the invention comprises the soluble fragments of fluorophore and CueR albumen.
In a preferred embodiment, Cu/Ag ion-sensitive albumen in fluorescent probe provided by the invention, comprises any homology or the nonhomologous sequence with aminoacid sequence SEQ ID NO:1 with 70% homogeny.In a preferred embodiment, Cu/Ag ion-sensitive albumen in fluorescent probe provided by the invention, comprises any homology similar or identical in fact with aminoacid sequence SEQ ID NO:1 or nonhomologous sequence.In a preferred embodiment, Cu/Ag ion-sensitive albumen in fluorescent probe provided by the invention, comprises varient or the derivative of aminoacid sequence SEQ ID NO:1.
On the other hand, the invention provides a kind of fusion rotein, it comprises fluorescent probe of the present invention.In one embodiment, described fusion rotein comprises fluorescent probe of the present invention and specificity subcellular localization signal, and target protein can be positioned in the subcellular organelle of specifying by described signal for locating.Described specific localization signal can be plastosome location and endochylema location.One preferred embodiment in, described specific localization signal is plastosome signal for locating shown in SEQ ID NO:5.
On the other hand, the invention provides nucleotide sequence or its complementary sequence of a kind of code book invention fluorescent probe or fusion rotein.
In nucleotide sequence provided by the invention, comprise nucleotide sequence and the nucleotide sequence of coding to the protein of Cu/Ag ion-sensitive of encoding fluorescent protein.
In a preferred embodiment, the nucleotide sequence of described coding to the protein of Cu/Ag ion-sensitive is that coding has the polypeptide of following feature or the nucleotide sequence of its function fragment:
(1) there is the structural domain B of Cu/Ag ionic bond characteristic; And/or
(2) the transcriptional regulator CueR albumen to Cu/Ag ion-sensitive is derived from.
In another preferred embodiment, nucleotide sequence of the present invention comprises the encoding sequence b of the structural domain B with Cu/Ag ionic bond characteristic and encoding sequence a, a1 and/or a2 of fluorescin, and its array configuration can be:
(1)b-a-b；
(2) a1-b-a2, wherein a1 and a2 can be identical or different; A1 comes from the encoding sequence of the fluorescin or derivatives thereof of Victoria's multitube luminescent jellyfish, and a2 comes from the encoding sequence of another fluorescin or derivatives thereof of Victoria's multitube luminescent jellyfish;
(3) second section of the first part-a-b of b, wherein a is inserted in the flexible region of b, thus b is divided into the part 1 of b and the second section of b, and the first part of b and the second section of b form complete b structural domain;
(4) second section-b of the first part-a-b of b, wherein a is inserted in the flexible region of b, thus b is divided into the part 1 of b and the second section of b, the first part of b and the second section of b form complete b structural domain, also connect a b at the end of this chimeric sequences.
In another preferred embodiment, the invention provides a kind of nucleotide sequence, comprise nucleotide sequence SEQ ID NO:6,7 or 8.In another preferred embodiment, the invention provides a kind of nucleotide sequence, be included at least 405 bases longs any with nucleotide sequence SEQ ID NO:6,7 or 8 similar or identical in fact nucleotide sequences; In a preferred embodiment, the invention provides a kind of nucleotide sequence, comprise nucleotide sequence SEQ ID NO:6,7 or 8 varient or derivative.
The invention still further relates to complementary sequence and the varient of above-mentioned nucleotide sequence, it can comprise nucleotide sequence or its complementary sequence of the fragment of code book invention fluorescent probe or fusion rotein, analogue, derivative, soluble fragments and varient.
In another, the present invention also provides a kind of expression vector, and it comprises the nucleotide sequence of the present invention be connected with expression control sequenc operability.Described expression control sequenc can be replication orgin, promotor, enhanser, operon, terminator, ribosome bind site etc.
In another, the present invention also provides a kind of host cell, and it comprises expression vector of the present invention.
In another, the present invention also provides a kind of method preparing fluorescent probe of the present invention or fusion rotein, comprises the following steps:
A. expression vector of the present invention is transferred in host cell,
B. under the condition being applicable to described host cell expression, described host cell is cultivated, and
C. described fluorescent probe or fusion rotein is separated by described host cell.
The present invention also provides fluorescent probe of the present invention or fusion rotein detecting the application in Cu/Ag ion.In one embodiment, the invention provides fluorescent probe of the present invention or the application of fusion rotein in vitro or in body in detection Cu/Ag ion.In one embodiment, the invention provides fluorescent probe of the present invention or the application of fusion rotein in subcellsular level detection Cu/Ag ion.In one embodiment, the invention provides fluorescent probe of the present invention or fusion rotein and detect application in Cu/Ag ion in position.In another embodiment, the invention provides fluorescent probe of the present invention or the application of fusion rotein in screening of medicaments, described medicine can be used for the Cu/Ag ion concentration of controlled plant.In another embodiment, the invention provides fluorescent probe of the present invention or the application of fusion rotein in diagnosing the illness, described disease is relevant with Cu/Ag ion concentration.
Present invention also offers a kind of test kit detecting Cu/Ag ion or screening of medicaments, wherein comprise fluorescent probe of the present invention or fusion rotein, and working instructions.Described detection can in vivo, external, ubcellular or original position level carry out.The present invention also provides a kind of test kit of screening of medicaments, and described medicine can be used for the Cu/Ag ion concentration of controlled plant, and described test kit includes fluorescent probe of the present invention or the fusion rotein of effective amount.In use, those skilled in the art can determine described significant quantity easily according to the activity of described fusion rotein.
Detailed Description Of The Invention
I. define:
When providing numerical value or scope, term " about " used herein refers to that this numerical value or scope are within 20% of given numerical value or scope, within 10% and within 5%.
The implication that term used herein " comprises ", " comprising " and its equivalents comprise " containing " and " by ... composition ", the composition such as " comprising " X can only be made up of X maybe can contain other material, such as X+Y.
In the present invention, term " CueR albumen " refers to CueR albumen, and be a kind of bacterial transcription regulatory albumen known in the art, molecular weight is 15kDa, and its content of copper ion that can regulate and control in intestinal bacteria makes it to maintain in a more stable scope.It contains three structural domains, respectively: the metal binding domain of C end, and the DNA binding domains of N end and the dimer region of centre.The critical sites relating to melts combine in CueR albumen is positioned at the halfcystine of 112 and 120.By being connected containing 7 amino acid whose flexible regions between two cysteines." CueR albumen " involved in the present invention can comprise the aminoacid sequence that nucleotide sequence SEQ ID NO:1 encodes." flexible region " involved in the present invention refers to that some that exist in protein higher structure are specific as structures such as Loop structural domains, these structural domains have higher movability and flexibility compared to other protein higher structure, and structural domain occurrence dynamics can be caused to change, and protein also also exist trend space conformation greatly occurring and changes in these regions.Wherein involved in claims flexible region mainly refers to the P113-D119 region in CueR
This specification sheets term " Cu/Ag ion " used refers to monovalence and/or bivalent cupric ion, monovalence silver ions.
This specification sheets term used " fluorescent probe " refers to the albumen to Cu/Ag ion-sensitive in environment merged with fluorescin, the described polypeptide to Cu/Ag ion-sensitive in environment can be specifically CueR albumen, the conformational change produced after utilizing the Cys-Cys structure of wherein narrow spectrum Cu/Ag ionic bond and Cu/Ag ionic bond causes the conformational change of fluorescin, and then cause the fluorescence of fluorescence or the generation producing or disappear to change, and by the fluorescence drawing standard curve of the fluorescin measured under different Cu/Ag ionic concn, and then detect and analyze existence and/or the level of Cu/Ag ion.
This specification sheets term used " fusion rotein " and " fluorescent fusion protein " and " restructuring fluorescent fusion protein " synonym, refer to the aminoacid sequence comprising the first polypeptide or protein or its fragment, analogue or derivative, and the polypeptide of the aminoacid sequence of heterologous polypeptide or protein (that is, being different from the second polypeptide of the first polypeptide or protein or its fragment, analogue or derivative or protein or its fragment, analogue or derivative) or protein.In one embodiment, fusion rotein comprises the fluorescin merged with heterologous protein, polypeptide or peptide.According to this embodiment, heterologous protein, polypeptide or peptide may the dissimilar fluorescins of yes or no.In one embodiment, compared with the activity of the original polypeptide be blended in before heterologous protein, polypeptide or peptide or protein, fusion rotein maintain or improves activity.In an embodiment, fusion rotein comprises the fluorescent probe merged with heterologous protein, polypeptide or peptide, and described heterologous protein, polypeptide or peptide can be specificity subcellular localization signal.
This specification sheets term used " fluorophore " and " fluorescin " synonym, refer to the protein self sending fluorescence or send fluorescence under irradiation.Fluorescin is usually used as detection means, the green fluorescent protein GFP that biological example technical field is commonly used and BFP, CFP, YFP, cpYFP etc. of being derived by this protein mutation.
Term used herein " GFP " refers to green fluorescent protein, extract from Victoria's multitube luminescent jellyfish (Aequorea victoria) at first, the AvGFP of wild-type is by 238 Amino acid profiles, and molecular weight is about 26kD, and its aminoacid sequence is SEQ ID No:2.Current research confirms, in natural GFP albumen, three amino acid Ser-Tyr-Gly of 65th ~ 67 can spontaneous formation fluorescence chromophore: p-phenol methylene imidazolone (ρ-hydroxybenzylideneimidazolinone) is its main luminous position.The spectral signature of wild-type AvGFP is very complicated, and the main peak of its fluorescence excitation at 395nm place, and separately has an attached peak at 475nm place, the latter's oscillator intensity is about the former 1/3.Under the solution condition of standard, 395nm place excites the transmitting that can produce 508nm place, and the maximum emission wavelength of generation that excites at 475nm place is positioned at 503nm.
This specification sheets term used " YFP " refers to yellow fluorescence protein, this is protein derived from green fluorescent protein GFP, up to change crucial compared to GFP of more than 90%, YFP, its aminoacid sequence and GFP homology are that the 203rd amino acids sports tyrosine (T203Y) by Threonine.Then 527nm is changed into 514nm emission wavelength compared to the red shift of wavelength of the main excitation peak of original AvGFP, YFP.Carry out rite-directed mutagenesis (S65T) to YFP the 65th amino acids on this basis and can obtain Fluorescence Increasing type yellow fluorescence protein EYFP, typical EYFP aminoacid sequence is SEQ ID No:3.And rearranging EYFP protein sequence, the N of former 145-238 amino acids part as new albumen is held, former 1-144 amino acids is held as the C of new albumen, two panels is intersegmental to be connected by a bit of short peptide chain VDGGSGGTG with flexibility, form a circular permutation yellow fluorescence protein cpYFP to spatial variations sensitivity (circular permutation yellow fluorescent protein), typical cpYFP aminoacid sequence is SEQ ID No:4.
In the present invention, the CueR albumen merged with fluorophore can be separated total length from intestinal bacteria CueR albumen or its fragment, and preferably native E. coli belongs to the amino acid/11-135 of CueR albumen, the more preferably amino acid/11-135 of Colibacter CueR albumen.
" joint " refers in polypeptide of the present invention, protein or nucleic acid, connect two parts amino acid or nucleotide sequence.When connecting in polypeptide of the present invention or protein, the length of joint is not more than 6 amino acid, is preferably not more than 4 amino acid, is more preferably 3 amino acid.When connecting in nucleic acid of the present invention, the length of joint is not more than 18 Nucleotide, is preferably not more than 12 Nucleotide, is more preferably 9 Nucleotide.
When mentioning certain polypeptide or albumen, term used herein " varient " comprises and has described polypeptide or albumen identical function but the different varient of sequence.These varients comprise (but being not limited to): in the sequence of described polypeptide or albumen disappearance, insert and/or replace and one or morely (be generally 1-30, preferably 1-20, more preferably 1-10,1-5 best) amino acid, and add one or several at its C-terminal and/or N-terminal and (be generally within 20, within being preferably 10, within being more preferably 5) amino acid obtain sequence.Such as, in the art, when replacing with similar nature or similar amino acid, the function of polypeptide or albumen can not usually be changed.In the art, the similar amino acid of performance often refers to the amino acid residues with similar side chain, existingly in this area clearly defines.These families comprise amino acid (the such as Methionin with basic side chain, arginine, Histidine), there is amino acid (the such as aspartic acid of acid side-chain, L-glutamic acid), there is amino acid (the such as glycine of uncharged polar side chain, l-asparagine, glutamine, Serine, Threonine, tyrosine, halfcystine), there is amino acid (the such as L-Ala of non-polar sidechain, α-amino-isovaleric acid, leucine, Isoleucine proline(Pro), phenylalanine, methionine(Met), tryptophane), there is amino acid (the such as Threonine of β-branched building block, α-amino-isovaleric acid, Isoleucine) and there is amino acid (the such as tyrosine of aromatic side chain, phenylalanine, tryptophane, Histidine).Again such as, add at C-terminal and/or N-terminal the function that or several amino acid also can not change polypeptide or albumen usually.As well known to those skilled in the art, in gene clone operation, usually need to design suitable restriction enzyme site, this certainly will introduce one or more incoherent residue at expressed polypeptide or albumen end, and this does not affect the activity of desired polypeptides or albumen.And for example in order to construction of fusion protein, promote the expression of recombinant protein, obtain the recombinant protein be automatically secreted into outside host cell, or be beneficial to the purifying of recombinant protein, usually need some aminoacid addition to the N-end of recombinant protein, in other appropriate area in C-end or this albumen, such as, include but not limited to, the joint peptide be applicable to, signal peptide, leading peptide, end extends, glutathione S-transferase (GST), maltose E binding protein, albumin A, as the label of 6His or Flag, or the proteolytic ferment site of Xa factor or zymoplasm or enteropeptidase.The varient of polypeptide or albumen can comprise: homologous sequence, conservative variant, allelic variant, natural mutation, induced mutants, under high or low high stringency conditions can with the polypeptide coded by the DNA of the DNA hybridization of described polypeptide or albumen or albumen and the polypeptide utilizing the antiserum(antisera) of anti-described polypeptide or albumen to obtain or albumen.These varients also can comprise to be at least about 70% with the sequence thereto of described polypeptide or albumen, polypeptide at least about 75%, at least about 80%, at least about 24%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or 100% or albumen.
In two or more polypeptide or sequence of nucleic acid molecules, term " homogeny " or " homogeny percentage ratio " refer in comparison window or designated area, adopt means known in the art as sequence comparison algorithm, when comparing correspondence maximum with comparison by manual alignment and visual inspection, two or more sequence or subsequence is identical or wherein have in designated area the amino-acid residue of certain percentage ratio or Nucleotide identical (such as, 60%, 65%, 70%, 75%, 80%, 24%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% is identical).Such as, the optimization algorithm being applicable to measuring percent sequence identity and sequence similarity percentage ratio is BLAST and BLAST2.0 algorithm, respectively can see (1990) J.Mol.Biol.215:403 such as (1977) Nucleic Acids Res.25:3389 and Altschul such as Altschul.
Term used herein " soluble fragments " be often referred to have described full length protein sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about the fragment of 100 continuous amino acids.
Term used herein " function fragment ", " derivative " refer to " analogue " albumen substantially keeping the biological function identical with the natural CueR of the present invention or activity.The function fragment of CueR of the present invention, derivative or analogue can be the albumen that (i) has one or more conservative or non-conservative amino acid residue (preferred conservative amino acid) and be substituted, and the amino-acid residue of such replacement can may not be and encoded by genetic code, or (ii) has the albumen of substituted radical in one or more amino-acid residue, or (iii) maturation protein and another compound (such as extend the compound of protein half-life, such as polyoxyethylene glycol) merge the albumen formed, or (iv) additional aminoacid sequence is fused to this protein sequence and the albumen formed (as leader sequence or secretion sequence or be used for the sequence of this albumen of purifying or proprotein sequence, or with the fusion rotein of the formation of antigen I gG fragment).According to instruction herein, these function fragments, derivative and analogue belong to the known scope of those skilled in the art.
The difference of described analogue and natural CueR albumen can be the difference on aminoacid sequence, can be also the difference do not affected on the modified forms of sequence, or have both at the same time.These albumen comprise genetic variant that is natural or induction.Induce variation body can be obtained by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also obtains by site-directed mutagenesis or the biological technology of other known moleculars.
Described analogue also comprises the analogue with the residue (as D-amino acid) being different from natural L-amino acids, and has the analogue of amino acid (as β, gamma-amino acid) that is that non-natural exists or synthesis.Should be understood that CueR albumen of the present invention is not limited to above-mentioned representative albumen, fragment, derivative and the analogue enumerated.(usually the not changing primary structure) form of modification comprises: the chemically derived form of the albumen that body is interior or external is as acetylize or carboxylated.Modify and also comprise glycosylation, as carried out glycosylation modified and albumen that is that produce in those in the synthesis of albumen and processing or further procedure of processing.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) by being exposed to by albumen and completing.Modified forms also comprises the sequence with phosphorylated amino acid residue (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Also comprise and modified thus improve its anti-proteolysis performance or optimize the albumen of solubility property.
Term used herein " nucleic acid " can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature albumen can or its degeneracy variant identical with the coding region sequence shown in SEQ ID NO:6,7 or 8.As used herein, " degeneracy variant " refers to code book invention fluorescent fusion protein in the present invention, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NO:6,7 or 8.
When mentioning nucleic acid, term used herein " varient " can be the allelic variant of natural generation or the varient of non-natural generation.These nucleotide variants comprise degeneracy varient, replace varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of a nucleic acid, and it may be the replacement of one or more Nucleotide, disappearance or insertion, but can not from the function of albumen changing in fact its coding.Nucleic acid of the present invention can comprise to be at least about 70% with the sequence thereto of described nucleotide sequence, nucleotide sequence at least about 75%, at least about 80%, at least about 24%, at least about 90%, at least about 95%, at least about 98%, at least about 99% or 100%.
As used herein, term under high stringency conditions, " hybridize " nucleotide sequence that is used to describe typical at least 60% homology each other still can the hybridization of phase mutual cross and cleaning condition.Preferably, high stringency conditions is such condition, has at least 65%, more excellent at least 70% each other with this understanding and even the sequence of preferred at least 80% or higher homology generally still can phase mutual cross.This high stringency conditions is that those of ordinary skill in the art are known.One of high stringency conditions is preferably, and limiting examples is: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 0 DEG C; Or be added with denaturing agent, 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc. during (2) hybridization; Or (3) homogeny only between two sequences, at least more than 90%, is just hybridized when being more preferably more than 95%.Further, the albumen of interfertile nucleic acid encoding has identical biological function and activity with maturation protein.
The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment ", at least containing 15 Nucleotide, is better at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid.
The full length sequence of fluorescent probe of the present invention or fusion rotein or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.
Once obtain relevant sequence, just relevant sequence can be obtained in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, then obtains related polypeptide or albumen by ordinary method abstraction and purification from the host cell after propagation.
In addition, also relevant sequence can be synthesized, when especially fragment length is shorter by the method for synthetic.Usually, by first synthesizing multiple small segment, and then carry out connect can obtain the very long fragment of sequence.
At present, the DNA sequence dna of code book invention albumen (or its fragment, derivative, analogue or varient) can be obtained completely by chemosynthesis.Then this DNA sequence dna can be introduced in various existing DNA molecular (as carrier) as known in the art and cell.By method such as sudden change PCR or chemosynthesis etc., sudden change is introduced in protein sequence of the present invention.
Term used herein " expression vector " and " recombinant vectors " are used interchangeably, refer to protokaryon well known in the art or eukaryotic vector, such as bacterial plasmid, phage, yeast plasmid, vegetable cell virus, mammalian cell is viral as adenovirus, retrovirus or other carriers, these carriers can copy and stablize in host, and a key character of these recombinant vectorss is usually containing expression control sequenc.
Term used herein " expression control sequenc " refers to regulate and control the element that can be connected with goal gene operability of transcribing, translate and expressing of goal gene, can be replication orgin, promotor, marker gene or translation controlling elements, comprise enhanser, operon, terminator, ribosome bind site etc., host cell used is depended in the selection of expression control sequenc.Expression control sequenc mainly contains: 1. in the place of 5 ' about 20 ~ 30 Nucleotide in end transcripting start point upstream, have TATA frame; 2. in the place of 5 ' about 70 ~ 80 Nucleotide in end transcripting start point upstream, CAAT box is had; 3. hold about 100, transcripting start point upstream Nucleotide with position far away 5 ', some order can play the effect strengthening transcriptional activity, and it can make transcriptional activity strengthen hundreds of times, is therefore called as enhanser; 4. have a nucleotide sequence to be AATAAA in the downstream of 3 ' end termination codon, this order may play an important role to the tailing of mRNA (mRNA afterbody adds poly A).
The recombinant vectors be suitable in the present invention includes but not limited to bacterial plasmid.In recombinant expression vector, " operability connection " refers to that the nucleotide sequence of object is connected in the mode allowing nucleotide sequence and express with regulating sequence.Those skilled in the art knows and can be used for building containing fusion rotein encoding sequence of the present invention and the suitable method of transcribing/translating the expression vector of control signal.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, synthesizes to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprise CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus LTR and some other known can the promotor expressed in protokaryon or eukaryotic cell or its virus of controlling gene.Expression vector also comprises ribosome bind site and the transcription terminator of translation initiation.
Those of ordinary skill in the art can understand, and the design of recombinant expression vector can be depending on the factor such as selection, required protein expression level as the host cell for transforming.In addition, recombinant expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character of host cell selecting to transform, as colibacillary paraxin or amicillin resistance.
In one embodiment, by the encoding sequence of fluorescent probe of the present invention or fusion rotein after NheI and HindIII double digestion with the pRSET of NheI and HindIII double digestion bcarrier connects, and obtains Recombinant protein expression carrier.Can expression vector of the present invention be transferred in host cell, to produce the albumen or peptide that comprise fusion rotein.This kind of transfer process can be carried out with routine techniquess well known to those skilled in the art such as conversion or transfections.
Herein being also called recipient cell at term used " host cell ", referring to the cell that can receive and hold recombinant DNA molecules, is the place of recombination amplification, and desirable recipient cell should meet and is easy to obtain and propagation two conditions." host cell " of the present invention can comprise prokaryotic cell prokaryocyte and eukaryotic cell, specifically comprises bacterial cell, yeast cell, insect cell and mammalian cell.
Expression vector of the present invention is used in protokaryon or eukaryotic expression fluorescent probe of the present invention or fusion rotein.Thus, the present invention relates to the host cell, the preferably intestinal bacteria that import expression vector of the present invention.Host cell can be any protokaryon or eukaryotic cell, representative example has: intestinal bacteria, streptomyces, the bacterial cell of Salmonella typhimurium, fungal cell as yeast, vegetable cell, the insect cell of fruit bat S2 or Sf9, the zooblast etc. of CHO, COS, 293 cells or Bowes melanoma cells, comprising but be not limited to those above-mentioned host cells.Described host cell is the various cell being beneficial to gene product expression or fermentative production preferably, and this type of cell has been well known and conventional, such as various Bacillus coli cells and yeast cell.In an embodiment of the invention, the host cell of e. coli bl21 construction expression fusion rotein of the present invention is selected.Persons skilled in the art all know how to select suitable carrier, promotor, enhanser and host cell.
Term used herein " conversion " and " transfection ", " joint " and " transduction " mean well known in the art various by exogenous nucleic acid (such as, linear DNA or RNA are (such as, linearized vector or DNAcarrier free independent gene construct)) or carrier format nucleic acid (such as, plasmid, clay, phage, phasmid, phagemid, transposon or other DNA) import the technology of host cell, comprise calcium phosphate or calcium chloride co-percipitation, the transfection of DEAE-mannosans-mediation, fat transfection, natural competence, the transfer of chemistry mediation or electroporation.When host be prokaryotic organism as intestinal bacteria time, the competent cell that can absorb DNA can be gathered in the crops at exponential growth after date, uses CaCl 2method process, step used is well-known in this area.Another kind method uses MgCl 2.If needed, transform and also can be undertaken by the method for electroporation.When host cell is eukaryotic cell, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods is as microinjection, electroporation, liposome packaging etc.
Can cultivate by the ordinary method being applicable to described host cell expression the transformant obtained, express fusion rotein of the present invention.According to host cell used, substratum used in cultivation can be various conventional medium.Cultivate under the condition being suitable for host cell growth.When after host cell growth to suitable cell density, the promotor selected with the induction of suitable method (as temperature transition or chemical induction), cultivates for some time again by cell.
Recombinant protein in the above methods can be expressed or be secreted into extracellular in cell or on cytolemma.If needed, can utilize its physics, the albumen of being recombinated by various separation method isolated or purified with other characteristic of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation process, combination by protein precipitant process (salting-out method), centrifugal, the broken bacterium of infiltration, super process, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
In one embodiment, by comprising Escherichia coli fermentation production fluorescent probe of the present invention or the fusion rotein of fusion rotein encoding sequence of the present invention, and by ammonium sulfate precipitation, ion exchange chromatography and gel chromatography obtain fluorescent probe of the present invention or the fusion rotein of pure form.
The purposes of fluorescent probe of the present invention or fusion rotein includes but not limited to: detect Cu/Ag ion, detect Cu/Ag ion under physiological status, detect Cu/Ag ion, in situ detection Cu/Ag ion, screening of medicaments, the diagnosis disease etc. relevant with Cu/Ag ion concentration at subcellsular level.
In this article, the form of concentration, content, percentage ratio and the equal usable range of other numerical value represents.Also should understand, use this range format just for convenience and simplicity, flexibly should be read as and be comprised the specifically mentioned numerical value of scope bound, also should be comprised all single numerical value or subrange that comprise within the scope of this, just look like clearly mention each numerical value and subrange such.
Brief description of drawings
Fig. 1 shows the SDS-PAGE qualification result of recombinant plasmid pRSETb-CueRa-cpYFP-CueRb expression product.
Fig. 2 shows the spectroscopic properties of recombinant plasmid CueRa-cpYFP-CueRb.
Fig. 3 shows CueRa-cpYFP-CueRb and derives serial each mutagenic samples to the fluorescence response of Cu/Ag ion.
Fig. 4 shows acb-C1N5 fluorescin brachymemma sample to the fluorescence response of cupric ion.
Fig. 5 shows the metal selective of acb-C1N5C129/130S.
Fig. 6 shows the metal selective of acb-C1N5A118P.
Fig. 7 shows the detection of expression result of acb-C1N5C129/130S in Mammals.
Fig. 8 shows the detection of expression result of acb-C1N5A118P in Mammals.
Fig. 9 shows the result of co-focusing imaging after the expression of acb-C1N5A118P in intestinal bacteria.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.
The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as Sambrook etc., " Molecular Cloning: A Laboratory room guide " (New York, United States: CSH Press (Cold Spring Harbor Laboratory Press), 1989); Or carry out according to the condition that manufacturer advises.In this article, unless otherwise indicated, per-cent and number are all calculated by weight.
I. experiment material and reagent
Reagent: except special mark, other are all from Shanghai Chemical Reagent Co., Ltd., Sinopharm Group (Chinese Shanghai).
The Taq enzyme that pcr amplification uses, damping fluid, dNTP, the proteolytic enzyme, damping fluid, T4DNA ligase enzyme, T4DNA ligase enzyme damping fluid, T4 polynueleotide kinase (PNK), the T4PNK damping fluid that use in molecular biosciences experiment, all from Fu Meitaisi company (Fermentas, Lithuania Vilnius).
Embodiment 1pRSET bthe structure of-CueR (a)-cpYFP-CueR (b) and prokaryotic expression
1. the nucleotide sequence of amplification cpYFP:
With pMD19-cpYFP (Nagai, T. etc., Proc Natl Acad Sci U S A.2001, V.98 (6), pp.3197-3202) (be template available from East China University of Science's protein chemistry laboratory (Chinese Shanghai), utilize the encoding sequence of primer P1 and P2 amplification yellow fluorescence protein (cpYFP), primer sequence (primer is synthesized by Shanghai Sheng Gong biotechnology company limited (Chinese Shanghai)) is as follows:
P1:TCTGCAGGCTACAACAGCGACAACGTCTATATC(sequence 9)
P2:GCC gGTACCgTTGTACTCCAGCTTGTGCC(sequence 10)
By pcr amplification product electrophoresis 30 minutes in the sepharose of 1%, obtain the cpYFP fragment of about 750bp.Utilize the raw work DNA fragmentation in Shanghai to reclaim purification kit (Shanghai biotechnology company limited, Chinese Shanghai) to reclaim from gel and purifying cpYFP fragment according to manufacturers instruction.
2. from intestinal bacteria (Escherichia.coli) Origami cell, extract goal gene sequence:
A. sample preparation
I () intestinal bacteria (Escherichia.coli) Origami cell preserves bacterial strain from East China University of Science's protein chemistry laboratory (Chinese Shanghai).
(ii) get the Origami cell that 100 μ l cultivate, measure the optical density(OD) of nutrient solution at 600nm place, OD 600when=0.1, cell density is 1 × 10 7~ 5 × 10 7individual/milliliter, calculates actual cell quantity accordingly, and then to every 1 × 10 7individual Bacillus coli cells adds 1ml TRIzol reagent and (processes from hero company (Invitrogen, California, USA).
(iii) get a certain amount of bacterium liquid, 4 DEG C, centrifugal 10 minutes of 5000rpm, abandon supernatant liquor.
(iv) (10mM Tris-HCl, 1mM EDTA pH8.0, reagent is from Emma Cisco System Co. (Amresco, Ohio, USA) cleaning, and centrifugal 10 minutes of 5000rpm, abandons supernatant liquor with 100 μ l1 × TE damping fluids for bacterial sediment.
V (), with 100 μ l1 × TE damping fluids (containing 2mg/ml N,O-Diacetylmuramidase (biological from U.S. season, Chinese Shanghai)) resuspended bacterial sediment, hatches 30 minutes for 37 DEG C.
B. be separated
I () adds 1ml TRIzol reagent (hero company), with pipettor piping and druming mixing, room temperature leaves standstill 5 minutes.
(ii) add 200 μ l chloroforms, continue concussion mixing in 15 seconds, room temperature leaves standstill 2 ~ 3 minutes, 4 DEG C, 12,000g centrifugal 15 minutes.
(iii) centrifugal rear solution layering, upper water accounts for 40% mutually, and containing RNA, lower floor's organic phase accounts for 60%, containing DNA and protein, draws carefully and removes upper strata aqueous phase.
C. the removal of impurity
Add 50 μ l10%SDS and 250 μ l saturated aqueous common salts in organic phase, concussion mixing, 4 DEG C, 12,000g centrifugal 5 minutes, discards upper strata aqueous phase.
D.DNA alcohol settling
Organic phase adds 95% ethanol of 750 μ l precoolings, upset mixing, and-80 DEG C leave standstill 15 minutes to precipitate DNA.
E.DNA cleans
I () is inclined upper organic phase.
(ii) precipitation with the cleaning of 1ml0.1M Trisodium Citrate/10% ethanolic soln repeatedly, equal 4 DEG C at every turn, 12,000g centrifugal 5 minutes.
(iii) 75% ethanol purge is finally used once, 4 DEG C, 12,000g centrifugal 5 minutes.
(iv) room temperature natural air drying ethanol.
F. dissolving DNA
With the DNA of 50 μ l8mM NaOH solution precipitations, 4 DEG C or-20 DEG C of preservations.
With the genome extracted as mentioned above for template, primer P3 and P4, P3 and P6, P5 and P4 is utilized to increase respectively intestinal bacteria CueR full length gene, CueR fragment a and CueR fragment b.Wherein primer P3 and P4 increases and obtains N end containing the CueR protein gene full length fragment of NheI restriction enzyme site C end containing HindIII restriction enzyme site.Primer P3, P4, P5 and P6 sequence is as follows:
P3:CCCCTA gCTAGCaTGAACATCAGCGATGTAGCAAAAA(sequence 11)
P4:CTTTTT aAGCTTtCACCCTGCCCGATGATGACAGCAGCCG(sequence 12)
P5:GTACAACGGTACCGGCAGCGCCGACTGCCCGATTATCGAAAA(sequence 13)
P6:GTTGTAGCCTGCAGAGTCATCGCCAGGGC(sequence 14)
By pcr amplification product electrophoresis 30 minutes in the sepharose of 1%, obtain the CueR fragment that size is about 400bp, the CueR fragment b of the CueR fragment a of about 350bp, about 60bp.Utilize the raw work DNA fragmentation in Shanghai to reclaim purification kit (Shanghai biotechnology company limited, Chinese Shanghai) to reclaim and purifying CueR fragment according to manufacturers instruction.
3. the connection of goal gene fragment and carrier
Utilize overlap extension pcr with CueRa, cpYFP, CueRb for template, with P3 and P4 for primer carries out PCR, PCR system is:
PCR condition is:
(1) template segments is carried out purifying.
(2) do not contain forward and reverse primer in initial reaction system, primer adds in reaction system after having carried out 10 circulations by reaction again.
By pcr amplification product electrophoresis 40 minutes in the sepharose of 1%, obtain the CueRa-cpYFP-CueRb fragment that size is about 1200bp.PCR fragment CueRa-cpYFP-CueRb and the vector plasmid pRSET of purifying will be reclaimed bcarry out double digestion respectively, system is as follows:
Reaction conditions: 37 DEG C, 5 hours.
After reaction terminates, in 50 μ l reaction systems, add 10 μ l6 × sample-loading buffer termination reactions.Then be separated object fragment by agarose gel electrophoresis, utilize the raw work DNA fragmentation in Shanghai to reclaim purification kit (Shanghai biotechnology company limited, Chinese Shanghai) and reclaim and purified fragments according to manufacturers instruction.
By the CueRa-cpYFP-CueRb double digestion product that is recovered to and vector plasmid pRSET bdouble digestion product connects, and system is as follows:
Reaction conditions: 16 DEG C are spent the night.Thus form connection product pRSET b-CueRa-cpYFP-CueRb.
Get bacterium colony PCR and be accredited as positive clone, adopt universal primer order-checking, by Shanghai, Beijing Liuhe Huada Genomics Technology Co., Ltd, branch office checks order.The sequence Vector NTI8.0 measured carries out comparing analysis.Result shows the nucleotide sequence (as shown in SEQ ID NO:6 in sequence table) really inserting CueRa-cpYFP-CueRb in this plasmid.
4. transform
((Chinese Shanghai) is preserved in East China University of Science's protein chemistry laboratory recombinant plasmid pRSETb-CueRa-cpYFP-CueRb to be transformed into competent intestinal bacteria (E.coli) BL21 (DE3) pLys, biochemical purchased from sky root at first, (BeiJing, China)) in, obtain recombinant bacterium, concrete grammar is as follows:
I (), under cleaning condition, is got 1 μ l plasmid or 10 μ l and is connected product and add in 100 μ l competence, ice bath 45 minutes;
(ii) after ice bath, heat shock 90 ~ 120 seconds in 42 DEG C of water-baths rapidly;
(iii) ice bath 5 minutes again;
(iv) 600ul LB liquid nutrient medium is added, 37 DEG C, 150rpm shaking table recovers 1 hour;
V () 4000rpm, normal temperature is after centrifugal 5 minutes, supernatant discarded;
(vi) by a small amount of resuspended precipitation of fresh LB, subsequently whole bacterium liquid is spread evenly across on required LB flat board, is inverted overnight incubation for 37 DEG C.
5. plasmid identification and prokaryotic protein expression
Adopt conventional colony polymerase chain reaction (PCR) method screening positive clone, and proceed to 5ml and contain in the LB liquid nutrient medium of corresponding resistant, 37 DEG C, 220rpm incubated overnight.Transform that to have a recombinant bacterium of object plasmid 37 DEG C are cultured to cell concentration OD in LB substratum be 0.6, add 1mM IPTG, 18 DEG C of abduction deliverings 20 hours, use Ni 2+affinity column (General Electric Corporation, Uppsala, SWE) separation and purification recombinant protein from cellular lysate liquid, as shown in Figure 1, only have a protein band at about 43kD place, be recombinant protein to SDS-PAGE qualification result.
Embodiment 2. recombinant protein c ueRa-cpYFP-CueRb spectroscopic properties
According to the spectral quality of fluorescin, recombinant protein c ueRa ?cpYFP ?CueRb (acb) 400nm and 500nm place left and right have two absorption peaks.Excite as rigid condition with 530nm transmitting and 485nm respectively, carry out the research of excitation and emission spectra, obtained standardized data mapped, result is as Fig. 2.Therefore in actual testing process, self test conditions of binding tests room, chooses 390nm and 485nm as two excitation wavelength, and 528nm is as the change in fluorescence of probe under emission wavelength detection different condition.
Embodiment 3.CueRa ?cpYFP ?CueRb derives structure, prokaryotic expression and the detection of plurality of probes
Probe builds principle: utilize and build pRSET b-CueRa-cpYFP-CueRb is template, according to the principle of rite-directed mutagenesis, carries out the structure of derivative plurality of probes.Truncated mutant sequence is schematically as follows:
1. original series model:
CueRa-CCTGGCGATGAC TCTGCAGGC-cpYFP- GGTACCGGCAGCGCCGAC-CueRb
N1:CueRa-CCTGGCGATGAC-cpYFP- GGTACCGGCAGCGCCGAC-CueRb
N2:CueRa-CCTGGCGAT-cpYFP- GGTACCGGCAGCGCCGAC-CueRb
N3:CueRa-CCTGGC-cpYFP- GGTACCGGCAGCGCCGAC-CueRb
N4:CueRa-CCT-cpYFP- GGTACCGGCAGCGCCGAC-CueRb
N5:CueRa-cpYFP- GGTACCGGCAGCGCCGAC-CueRb
C1:CueRa-CCTGGCGATGAC? TCTGCAGGC-cpYFP-AGCGCCGAC-CueRb
C2:CueRa-CCTGGCGATGAC? TCTGCAGGC-cpYFP-GCCGAC-CueRb
C3:CueRa-CCTGGCGATGAC? TCTGCAGGC-cpYFP-GAC-CueRb
C4:CueRa-CCTGGCGATGAC? TCTGCAGGC-cpYFP-CueRb
The foundation of mutated library
1. design of primers (the raw work in Shanghai)
2.PCR increases
Rite-directed mutagenesis PCR is utilized to carry out truncated mutant and rite-directed mutagenesis.
Sudden change PCR amplification system (primer, enzyme, dNTP etc. are from Fu Meitaisi company):
The separation of 3.DNA fragment, purifying, connection, conversion
Specific experiment operation is with embodiment 1.
4. build probe sets
According to aforesaid method, further obtain following probe sets, amino acid number as shown in Table:
6. plasmid identification and prokaryotic protein expression
Adopt the method identical with embodiment 1 to carry out plasmid identification and prokaryotic protein expression, SDS-PAGE qualification result all shows and only has a protein band.
7. conventional viable inspection detects
Object plasmid transformation escherichia coli BL21 (DE3) pLys cell, dull and stereotyped picking mono-clonal carries out one-level cultivation in EP pipe, connects bacterium and in test tube, carries out secondary cultivation, as thalline OD 600reach about 0.6, induce with 1mM IPTG, 18 ° of C express 20 hours.Get 1mM bacterium liquid, centrifugal 5 minutes of room temperature 4000rpm, abandons supernatant.By the resuspended precipitation of damping fluid, adjustment thalline OD 600=0.05, get this bacterium liquid of 80 μ l in 384 hole fluorescent plates, measure each sample by microplate reader and drip fluorescent value before and after the copper of different concns, silver ion solution, result does normalized.Above-mentioned each mutagenic samples is shown in Fig. 3 to cupric ion and silver ions response.
Structure, prokaryotic expression and the detection of embodiment 4.acb-C1N5 saturation mutation probe
Probe builds principle:
Utilize pRSETb-acb-C1N5 middle transition plasmid to be template, carry out saturation mutation in conjunction with the amino acid near metal.
Design of primers
What the NNN part in the primer of synthesis represented is exactly the Codon sequences treating mutating acid.
The molecular biology manipulations of detailed process is with embodiment 1, and product is as following table:
Build plasmid list
The detected result of above-mentioned sample is seen the following form:
77
81
117
118
119
121
122
123
Structure, prokaryotic expression and the detection of embodiment 5.acb-C1N5 fluorescin brachymemma probe
Probe builds principle:
Utilize pRSETb-acb-C1N5 middle transition plasmid to be template, saturation mutation is carried out to the amino acid near metal binding domain.
1. design of primers
2. Inverse PCR amplification
Pcr amplification in concrete amplification system reference example 2, cuts glue and reclaims PCR primer.
3.DpnI digests PCR primer
Reaction conditions: 37 ° of C, 3h.80 ° of C20 minute heat inactivations.
4. object fragment phosphorates
Reaction conditions: 37 ° of C1h, 75 ° of C20 minute heat inactivations.
5. carrier is from connecting
Reaction conditions: 22 ° of C1h
6. connect product conversion clone strain
Conversion in specific experiment step reference example 1.
7. plasmid construction list
8. plasmid identification
With embodiment 1.
9. sample is to the response results of metal ion
The response results of acb-C1N5 fluorescin brachymemma probe sample to cupric ion is shown in Fig. 4.
Structure, prokaryotic expression and the detection of embodiment 6.C129/130S saltant type fluorescent probe
Probe builds principle:
By mutational site design in the middle of primer, after using Inverse PCR amplification carrier, the cysteine mutation of 129,130 of acb-C1N5 is become Serine (SEQ ID NO.77) from the mode connected.
Concrete construction process is with embodiment 5.Detected result is shown in Fig. 5.
Embodiment 7.Cu/Ag ion fluorescence probe is to the response of other metal ion
By fluorescent probe plasmid transformation escherichia coli BL21 (DE3) the pLys cell prepared as mentioned above, abduction delivering, after 20 hours, cleans resuspended by mensuration damping fluid (100mM HEPES, pH7.4).Ag, Cu, K, Na, Ca, Mg, Zn, Fe, Au, Mn, Al, Ni and Hg are mixed with respectively the liquid storage of different concns with measuring damping fluid (100mM HEPES, pH7.4), be diluted to 21 μMs stand-by.
Get the fluorescent probe thalline re-suspension liquid of 80 μ l OD600=0.05, drip 4 μ l21 μM Ag, Cu, K, Na, Ca, Mg, Zn, Fe, Au, Mn, Al, Ni and Hg respectively in bacterium liquid, to measure in 30 minutes the change in fluorescence of the fluorescence intensity of launching in 528nm after 424nm or 420nm fluorescence excitation, reading time interval 1.5 minutes, before each reading, concussion 3s treats abundant reaction.To the fluorescence excitation of sample, launch mensuration and utilize Multifunction fluorescent microplate reader (cooperate 2 types, Bai Teng company) to complete.
Measurement result (Fig. 5, Fig. 6) shows, and under same concentrations, (1 μM) Cu/Ag ion fluorescence probe only has obvious response to Cu ion or Ag ion, and there is no obvious response for other metal ions.
Embodiment 8.Cu/Ag ion fluorescence probe is expressed in different subcellular organelle inner position
With pRSETb-acb-C1N5A118P and pRSETb-acb-C1N5C129/130S for template, again to increase object fragment with the upstream primer P35:TATGGATCCCGCCACCATGAACATCAGCGATGTAGCAAAAA (sequence 80) containing BamHI and original downstream primer, utilize (BamHI and HindIII double digestion Cu/Ag ion fluorescence probe gene, digestion products fragment is connected respectively to pcDNA3.1-Hygro-Cyto after reclaiming, pcDNA3.1-Hygro-Mito carrier (East China University of Science's protein chemistry laboratory of Chinese Shanghai obtains from commercial vectors pcDNA3.1-Hygro house of correction).
Preparation method: without special declaration, all primers of present method are by Shanghai raw work synthesis (the raw work in Shanghai, Chinese Shanghai).First build pcDNA3.1-Hygro-Cyto carrier, based on pcDNA3.1-Hygro (+) (Invitrogen, California, USA), design two primer P36 and P37,
P36:CTAGCATGGCGGATCCACTAGTAAGCTTAAGC (sequence 81)
P37:TCGAGCTTAAGCTTACTAGTGGATCCGCCATG (sequence 82)
Containing restriction enzyme site and initiator codon ATG in this group primer, structure is " NheI-ATG-GC-BamHI-HindIII-XhoI ", the primer of acquisition is operated as follows and carries out decoding for DTMF annealing: by primer dry powder dedicated buffering liquid (10mM Tris, pH7.5-8.0; 50mM NaCl, 1mM EDTA) be diluted to 100 μMs, the primer pair that will anneal, wait a mole mixing, cumulative volume does not surpass 500 μ l, is heated to 95 ° of C, and then slowly cool to room temperature (lower than 30 DEG C), product is stand-by as-20 DEG C.Signal for locating Mito is adopted to the method for artificial synthesized sequence, at signal for locating N end, NheI restriction enzyme site is set after C end arranges BamHI restriction enzyme site, is sent out by the side of double digestion and signal for locating is got involved in pcDNA3.1-Hygro (+) carrier.
Construction recombination plasmid pcDNA3.1-Hygro-Cyto-acb-C1N5A118P, pcDNA3.1-Hygro-mito-acb-C1N5A118P, pcDNA3.1-Hygro-Cyto-acb-C1N5C129/130S, pcDNA3.1-Hygro-mito-acb-C1N5C129/130S.Check order, sequencing result to show in the aminoacid sequence table of object fragment shown in SEQ ID NO:77 and SEQ ID NO:83.Utilize the Transfected Recombinant Plasmid HEK293 cell of gained.
Embodiment 9. merges the change of Cu/Ag ion in probe instruction mammalian cell
Cu/Ag ion fluorescence probe the real time measure Cu/Ag ions across membranes enters cell and causes Cu/Ag ion concentration in different subcellular compartment to increase.
According to embodiment 8, Cu/Ag ion fluorescence probe is expressed in the different subcellular organelle of HEK293 cell, result shows the impact (Fig. 7, Fig. 8) that this plurality of probes can detect Cu/Ag ion concentration in additional Cu/Ag ion pair cell in cell culture medium in real time.We utilize this plurality of probes to detect the impact of Cu/Ag ion concentration in additional other organoids of Cu/Ag ion pair further, and result shows additional Cu +also also Cu in plastosome can be caused +the increase of level, to sum up result shows, Cu/Ag ion fluorescence probe of the present invention can indicate Cu/Ag ions across membranes well and enter in mammalian cell the increase causing Cu/Ag ion concentration in cell.
The viable cell imaging of embodiment 10. silver ions fluorescent probe
Ag fluorescent probe the real time measure Ag ions across membranes in prokaryotic cell prokaryocyte enters the Ag ion concentration caused in cell to be increased.By Ag ion fluorescence probe in E.coli BL21 (DE3) pLys cells, when in cell culture medium during additional Ag ion, (the cross-film migration situation of Ag ion in the cell of object probe is have expressed from NIKON (Nikon, Japan) Real Time Observation with laser confocal microscope.Viable cell imaging results (Fig. 9) shows, and the emitting fluorescence under 488nm fluorescence excitation under probe 528nm has remarkable enhancing than control group, Ag +cross-film can enter cell, cause Ag in cell +level increases immediately.

Claims (10)

1. the Cu/Ag ion fluorescence probe of a genetic coding, the albumen to Cu/Ag ion-sensitive and the change by spectral quality, the part that Cu/Ag ion shows is made up of, the wherein said change by spectral quality is fluorescent protein sequence or derivatives thereof to the part that Cu/Ag ion shows, and the described albumen to Cu/Ag ion-sensitive is polypeptide or its function fragment with following feature:
(1) there is the structural domain B of Cu/Ag ionic bond characteristic; And/or
(2) the transcriptional regulator CueR albumen to Cu/Ag ion-sensitive is derived from.
2. Cu/Ag ion fluorescence probe as claimed in claim 1, the wherein said albumen to Cu/Ag ion-sensitive is selected from:
(1) derive from the transcriptional regulator CueR albumen of bacterium, the aminoacid sequence of described CueR albumen is SEQ ID NO:1; With
(2) any homology or nonhomologous sequence with (1) described sequence with 70% homogeny.
3. Cu/Ag ion fluorescence probe as claimed in claim 1 or 2, it is characterized in that, comprise the Cys-Cys structure with Cu/Ag ionic bond characteristic and respectively by fluorescent protein sequence A, A1 and/or the A2 shown in SEQ ID NO:2,3,4, its array configuration is selected from:
(1)B-A-B；
(2) A1-B-A2, wherein A1 and A2 is the identical or different aminoacid sequence coming from the fluorescin or derivatives thereof of Victoria's multitube luminescent jellyfish;
(3) one or more A chimeric after any one in the site 113,114,115,116,117,118 and 119 in B structural domain flexible region; With
(4) one or more A chimeric after any one in the site 113,114,115,116,117,118 and 119 in B structural domain flexible region, and connect a B at the end of chimeric sequences.
4. a fusion rotein, it comprises fluorescent probe according to claim 1.
5. fusion rotein as claimed in claim 4, is characterized in that, described fusion rotein is merged by fluorescent probe described in claim 1 and specificity subcellular localization signal and forms, and target protein can be positioned in the subcellular organelle of specifying by described signal for locating.
6. fusion rotein as claimed in claim 5, it is characterized in that, described specificity subcellular localization signal is plastosome signal for locating shown in SEQ ID NO:5.
7. to encode the nucleotide sequence of fusion rotein according to any one of fluorescent probe according to any one of claim 1-3 or claim 4-6 or its complementary sequence.
8. an expression vector, it comprises the nucleotide sequence according to claim 7 be connected with expression control sequenc operability.
9. prepare a method for fusion rotein according to any one of fluorescent probe according to any one of claim 1-3 or claim 4-6, comprise the following steps:
(1) expression vector according to claim 8 is transferred in host cell,
(2) under the condition being applicable to described host cell expression, described host cell is cultivated, and
(3) described fluorescent probe or fusion rotein is separated by described host cell.
10., for detecting a test kit for Cu/Ag ion or screening of medicaments, it comprises the fluorescent probe according to any one of claim 1-3 or the fusion rotein according to any one of claim 4-6, and working instructions.
CN201310216584.1A 2013-06-03 2013-06-03 Copper silver ion fluorescin probe, and making method and application thereof Pending CN104211811A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310216584.1A CN104211811A (en) 2013-06-03 2013-06-03 Copper silver ion fluorescin probe, and making method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310216584.1A CN104211811A (en) 2013-06-03 2013-06-03 Copper silver ion fluorescin probe, and making method and application thereof

Publications (1)

Publication Number Publication Date
CN104211811A true CN104211811A (en) 2014-12-17

Family

ID=52093744

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310216584.1A Pending CN104211811A (en) 2013-06-03 2013-06-03 Copper silver ion fluorescin probe, and making method and application thereof

Country Status (1)

Country Link
CN (1) CN104211811A (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105403558A (en) * 2015-11-18 2016-03-16 沈阳药科大学 Method for on-line and quick detection of lead ions
CN105646716A (en) * 2014-11-14 2016-06-08 华东理工大学 A gene-encoded cyclic adenylic acid fluorescence probe, and a preparing method and applications thereof
CN110186891A (en) * 2019-06-12 2019-08-30 兰州大学 A kind of polypeptide fluorescent probe specifically binding copper ion and cysteine
CN114249833A (en) * 2021-12-21 2022-03-29 华南理工大学 Gene-coded inorganic cadmium fluorescent probe and preparation method and application thereof
CN114989093A (en) * 2022-06-29 2022-09-02 江汉大学 Preparation and application of AIE fluorescent material
CN115991757A (en) * 2022-07-15 2023-04-21 南宁师范大学 Fluorescent protein probe for detecting mercury ions through signal enhancement, and preparation and application thereof

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105646716A (en) * 2014-11-14 2016-06-08 华东理工大学 A gene-encoded cyclic adenylic acid fluorescence probe, and a preparing method and applications thereof
CN105403558A (en) * 2015-11-18 2016-03-16 沈阳药科大学 Method for on-line and quick detection of lead ions
CN105403558B (en) * 2015-11-18 2019-04-02 沈阳药科大学 A kind of method of quick detection lead ion
CN110186891A (en) * 2019-06-12 2019-08-30 兰州大学 A kind of polypeptide fluorescent probe specifically binding copper ion and cysteine
CN114249833A (en) * 2021-12-21 2022-03-29 华南理工大学 Gene-coded inorganic cadmium fluorescent probe and preparation method and application thereof
CN114249833B (en) * 2021-12-21 2023-08-22 华南理工大学 Gene-coded inorganic cadmium fluorescent probe and preparation method and application thereof
CN114989093A (en) * 2022-06-29 2022-09-02 江汉大学 Preparation and application of AIE fluorescent material
CN114989093B (en) * 2022-06-29 2023-05-16 江汉大学 Preparation and application of AIE fluorescent material
CN115991757A (en) * 2022-07-15 2023-04-21 南宁师范大学 Fluorescent protein probe for detecting mercury ions through signal enhancement, and preparation and application thereof
CN115991757B (en) * 2022-07-15 2023-08-11 南宁师范大学 Fluorescent protein probe for detecting mercury ions through signal enhancement, and preparation and application thereof

Similar Documents

Publication Publication Date Title
CN102344494B (en) Nicotinamide adenine dinucleotide gene coding fluorescent probe as well as preparation method and application thereof
CN104211811A (en) Copper silver ion fluorescin probe, and making method and application thereof
EP1954713B1 (en) Modified green fluorescent proteins and methods for using same
PT804457E (en) MODIFIED FLUORESCENT GREEN PROTEINS
WO2000071565A2 (en) Fluorescent protein indicators
JP7449572B2 (en) Branched-chain amino acid fluorescent sensor and its use
CN104403003B (en) NADH fluorescence probe of gene code and its preparation method and application
JP4644600B2 (en) Fluorescent and pigment proteins from non-Owan jellyfish hydrozoa species and methods for their use
JP2004187544A (en) Fluorescent indicator using fret
WO2010131115A1 (en) Modified fluorescent proteins and methods for using same
US7893207B2 (en) Fluorescent and colored proteins, and polynucleotides that encode these proteins
US20080104721A1 (en) Fluorescent Proteins From Copepoda Species and Methods for Using Same
CN105585625B (en) Enhanced green fluorescent protein
US8541558B2 (en) Fluorescent proteins and uses thereof
US7960510B2 (en) Fluorescent and colored proteins, and polynucleotides that encode these proteins
CN104277120B (en) NAD gene code fluorescence probe and its preparation method and application
JP3760222B2 (en) Toika squid photoprotein, gene encoding Toika squid photoprotein
RU2338785C2 (en) Fluorescing proteins and chromoproteins from kinds hydrozoa which are not concerning to aequorea, and methods of their obtaining
WO2004022757A1 (en) A anemone fluoresent protein and its clone, expression and use
Yang et al. Developing new fluorescent proteins with stagger extension process

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20141217