CN105403558A - Method for on-line and quick detection of lead ions - Google Patents
Method for on-line and quick detection of lead ions Download PDFInfo
- Publication number
- CN105403558A CN105403558A CN201510796079.8A CN201510796079A CN105403558A CN 105403558 A CN105403558 A CN 105403558A CN 201510796079 A CN201510796079 A CN 201510796079A CN 105403558 A CN105403558 A CN 105403558A
- Authority
- CN
- China
- Prior art keywords
- solution
- gold
- plumbous
- detection
- particle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
Landscapes
- Physics & Mathematics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plasma & Fusion (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of heavy metal detection, and relates to a method for on-line and quick detection of heavy metal lead ions. In the method, gold nanoparticles are used as a signal sensing material, protein which has a specific recognition function on the lead ions is used as a lead ion ligand, and the purpose of detection of the lead ions is realized through change of resonance strength and wavelength of plasmas on the surfaces of the gold nanoparticles, which is caused by the coordination process of the ligand and the lead ions. The method is mild in reaction condition, simple and safe in operation, high in repeatability, capable of eliminating inconvenience caused by the fact that the conventional lead ion detection pretreatment process is complex, and lots of instrument and equipment operations are involved, excellent in specificity, and capable of being widely used for quick and convenient detection of the metal lead ions in food, cosmetics and environments.
Description
Technical field
The invention belongs to heavy metal analysis technical field, relate to a kind of a kind of method that is online, detection heavy metal lead ion fast.Utilize based on golden nanometer particle, construct the optical probe that a kind of heavy metal lead ion has specific recognition function, by the specific binding effect of plumbous associated proteins and lead ion, successfully construct the heavy metal lead ion transducer based on colorimetric analysis, realize the quick specific detection of lead ion.
Background technology
Along with scientific-technical progress industrial development, environmental pollution and food-safety problem manifest and increasingly sharpen.Heavy metal pollution serious threat is to the life health of people and ecologic environment, so heavy metal pollution has become one of matter of utmost importance paid close attention to recently.Instrument and the invention detection means of design sensitivity attract great attention, and a lot of Method and Technology develops gradually along with needs.Researchers are utilizing functional material as probe, utilize sensor to detect important ion in chemistry and biology and have dropped into sizable effort.
Nano material generally refers to the material of particle size within 100 nanometer range, due to special mesoscopic size, result in it and has and conventional material difference character.As the quantum size effect of nano material, surface effect, quantum tunneling effect, small-size effect etc.The development and application of metal nano material is the important branch of of Nanometer scale science and technology field, and golden nanometer particle is the most frequently used material of current nano material circle.Utilize the surface plasma resonance optical spectrum that golden nanometer particle is special, Gold nanoparticle is made to be applied to multiple fields such as chemistry, biology, medical science as a kind of sensitive optical probe, comprise the diagnosis of disease, in biosome or external imaging, sensing and nanometer treatment etc.Gold nano-material is because its strong surface plasmon absorption is in visible region, and preparation is simple, and high stability and bio-compatibility become the most frequently used optical sensing nano material.Because the size of the uniqueness of gold nano-material and optical property become one of important functional material detecting heavy metal ion.
In the past in evolution in 10 years, comprise the detection method of some heavy metal ion based on atomic absorption spectrography (AAS), atomic fluorescence spectrometry, inductivity coupled plasma mass spectrometry and electrochemical sensor, for sensitivity and accuracy, all these methods are effective instruments.But they are not only consuming time, and expensive, or need complex apparatus.Therefore, the detection of heavy metal ion method of exploitation simple and inexpensive energy real-time monitoring environment, biology and a production piece is needed.Golden nanometer particle has strong surface plasmon resonance absorption, has strong extinction coefficient in visible region.Present redness compared with the golden nanometer particle (5-20nm) of small particle diameter, and larger particle or small-particle are reunited, the color that presents is from purple to dark blue scope.Surface ligand is utilized to be combined the reunion that can control golden nanometer particle with target analytes in the solution.When one is specifically analyzed thing and is introduced into, a large amount of golden nanometer particle coordinations combines the solution colour subsequently that causes reuniting of changing and changes.Colorimetric metal ion sensor usually based on golden nanometer particle and different induction parts, as the method that oligonucleotides, DNA enzymatic, polypeptide, protein and mercaptide part etc. develop.Based on the research before us, we find that the method for this detection heavy metal has high selectivity and susceptibility and exempts from mark, fast advantage, are especially directed to Hg
2+, Pb
2+, and Ag
+.
Summary of the invention
Technical matters solved by the invention is to provide a kind of method of quick detection lead ion, and the method is easy to operate, simple and fast, has good specificity.
The present invention utilizes heavy metal lead ion to have plumbous associated proteins and the gold nano grain coupling of specific recognition function, construct heavy metal lead ion probe, utilize lead metal ion and the protein-bonded specific recognition effect of lead, the color change of sensing system can be made, the detection to lead metal ion can be reached by naked eyes.This method is not limited to the when and where of use, directly reads experimental result by naked eyes, judges testing result, qualitative and quantitative detection heavy metal lead ion.
The present invention is achieved through the following technical solutions:
The method of quick detection lead ion of the present invention, comprises the steps:
(1) preparation of golden nanometer particle:
(2) preparation of plumbous binding proteins specific:
(3) coupling of plumbous binding proteins specific and golden nanometer particle.
In described step (1), golden nanometer particle is golden nano spherical particle or golden rod-like nano particle, and described golden nanometer particle is adopted and prepared with the following method:
Gold nano spherical particle: 100-200mL distilled water is placed in the three-necked bottle of certain capacity, add 0.75-1.5mL reductant solution (0.01 ~ 0.5g/mL), stir and be heated to 20 ~ 100 DEG C, add 2-4mL gold chloride storing solution, adjust ph is 9 ~ 11, reaction 25-35min.Solution becomes pink, and preparation terminates.Be stored in 4 DEG C for subsequent use.
Gold rod-like nano particle: get 2 ~ 10mL cetyl trimethyl ammonium bromide (CTAB) stock solution, 0.08 ~ 0.2M, 100 ~ 500 μ L gold chloride storing solution 0.0025 ~ 0.02M, 200 ~ 800 μ L reductant solution mixing, 20 ~ 37 DEG C are reacted 1 ~ 3 hour, obtained seed solution.
Get 30 ~ 60mLCTAB storing solution, add 1 ~ 3mL gold chloride storing solution, 200 ~ 500 μ L liquor argenti nitratis ophthalmicuses (0.005 ~ 0.02M), 200 ~ 500 μ L reductant solutions (0.08 ~ 0.2M), 500 ~ 800 μ L hydrochloric acid, and 5 ~ 200 μ L seed solutions.At 25 ~ 37 DEG C of temperature, react 10 ~ 20 hours, obtained bar-shaped gold nano grain.
The preparation of plumbous binding proteins specific in described step (2), comprises the structure of expression vector, the abduction delivering of fusion and separation and purification, fibrin ferment cutting and protein sample preparation.
The structure of (a) expression vector
Applying gene recombinant technique, entirely synthesize plasmid containing genes of interest for template with Jin Weizhi bio tech ltd, Suzhou, design upstream and downstream primer, pcr amplification obtains genes of interest.Expression vector and genes of interest are connected respectively through double digestion, T4 ligase enzyme, after thermal transition and order-checking, obtains the right-on recombination bacillus coli of sequence.
The abduction delivering of (b) fusion and separation and purification
Get the correct bacterium liquid of order-checking to be seeded in the triangular flask of 400ml containing the fresh LB of 50 μ g/mlKanamycin according to 1/100, in 37 DEG C, being cultured to OD is 0.6 ~ 0.8, adds the IPTG that final concentration is 0.166mM, continues to cultivate 4h, terminates fermentation.Collected by centrifugation thalline, carries out SDS-PAGE analysis.Result shows, and target protein achieves solubility expression in recombination bacillus coli.
Expression thalline is resuspended in BufferA (20mmol/LTris-HCl, 500mmol/LNaCl, pH7.3) in, ultrasonication, centrifugal after, get supernatant, be splined on by the equilibrated Ni-IDA of BufferA, use BufferB (20mmol/LTris-HCl, 500mmol/LNaCl, 100mmol/Limidazole again, pH7.3) foreign protein is washed away, finally by BufferC (20mmol/LTris-HCl, 500mmol/LNaCl, 200mmol/Limidazole, pH7.3) wash-out, collects target protein eluting peak.Analyze through SDS-PAGE, result shows, and it is pure that target protein is issued to electrophoresis at BufferC elution requirement.
The cutting of (c) fibrin ferment and protein sample preparation
More firmly coordination bond can be formed with each metal ion species because of histidine-tagged, thus severe jamming is caused to experiment.In order to eliminate this impact, utilizing the thrombin cleavage site be present between histidine-tagged and target protein, carrying out fibrin ferment cutting experiment.Protein sample and fibrin ferment are mixed in the ratio of 12.06mol:1U, 37 DEG C of water-baths, spend the night.Through BufferA dialysis except after imidazoles, be again splined on through the equilibrated Ni-IDA of BufferA, collect through peak.Through SDS-PAGE electrophoresis showed, there is obvious displacement difference before recombinant protein cutting and after cutting, show that fibrin ferment can excise histidine-tagged.By collect through peak, through ultrafiltration desalination, concentrated after, replacement solvent is HEPES (pH7.4), obtains target protein sample, for the coupling with gold nano grain.
In described step (3), described coupling is that solution of gold nanoparticles step (1) obtained is centrifugal, removes supernatant, adding damping fluid makes it disperse, then adds plumbous associated proteins solution prepared by step (2), ultrasonic, place, centrifugal.
The coupling of plumbous binding proteins specific and golden nanometer particle: get solution of gold nanoparticles prepared by above-mentioned steps (1) and draw 0.5-2mL and be placed in EP pipe.Centrifugal 10000rpm/10-15min, removes supernatant.Adding damping fluid respectively makes it disperse, then adds plumbous associated proteins solution 0.5-2mL prepared by step (2), is placed in ultrasonic washing instrument ultrasonic.Room temperature is placed and golden nanometer particle is fully combined with plumbous associated proteins.Centrifugal, remove non-associated proteins.
The heavy metal lead ion sensor system based on golden nanometer particle obtained of as above coupling is used for detecting lead ion: the lead ion stock solution adding variable concentrations respectively, ultrasonic, albumen is combined completely with lead ion.Add 5mM ~ 30mM sodium chloride brine diluted system to 1mL, ultrasonic mixing, observe color change.
The present invention, by golden nanometer particle and the protein-bonded combination of lead, constructs lead ion optical sensor.This sensor is high for the detection sensitivity of lead ion, and specificity is good, and simple and convenient, naked eyes identifiable design.
The present invention is that based target detection molecules causes nano particle gathering and produces the colorimetric analysis of color change, and colorimetric analysis is one of technology grown up at first in nanosensor technology.Adopt colorimetric analysis only to need nanoparticle surface to be carried out functional modification to enable optionally to produce response to target molecule, directly detected by naked eyes or simple optical spectrometer, the quantitative test to target molecule can be realized.This detection method easy and simple to handle and with low cost, has been widely used in various detection analysis and research work.After utilizing organic ligand, antibody protein and aptamer equimolecular to carry out functional modification to golden nanometer particle, find in solution containing after target molecule at functional molecular, cause the gathering of golden nanometer particle, the gathering of nano particle then causes solution colour generation conspicuousness to change, thus this colorimetric analysis is simple and quick, and has higher selectivity and sensitivity.
Accompanying drawing illustrates:
Fig. 1 is the response color change photo of plumbous optical sensor to lead at different concentrations solion.
Under visible ray, sensing system is along with the change photo of the increase system color of plumbum ion concentration.EP manages from left to right: AuNPs-a2m; AuNPs-a2m-NaCl; AuNPs-a2m-Pb (0.01 μM)-NaCl; AuNPs-a2m-Pb (0.05 μM)-NaCl; AuNPs-2am-Pb (0.1 μM)-NaCl; AuNPs-2am-Pb (0.5 μM)-NaCl; AuNPs-a2m-Pb (1 μM)-NaCl; AuNPs-a2m-Pb (3 μMs)-NaCl; AuNPs-a2m-Pb (5 μMs)-NaCl; AuNPs-a2m-Pb (7 μMs)-NaCl; AuNPs-a2m-Pb (9 μMs)-NaCl; AuNPs-a2m-Pb (11 μMs)-NaCl; AuNPs-a2m-Pb (13 μMs)-NaCl; AuNPs-a2m-Pb (15 μMs)-NaCl; AuNPs-a2m-Pb (16 μMs)-NaCl.
Fig. 2 is the ultraviolet-visible light spectrogram of plumbous optical sensor to lead at different concentrations solion.
Blank：AuNPs—a2m，blank-NaCl：AuNPs—a2m—NaCl。
Fig. 3 is the interference effect of many kinds of metal ions to plumbous optical sensor.
Control:AuNPs-a2m-NaCl, Pb
2+concentration is 10 μMs, Mg
2+concentration is 3mM, Ca
2+concentration is 0.5mM, Fe
2+concentration is 0.25mM, Ni
2+concentration is 0.5mM, Cd
2+concentration is 0.25mM, Hg
2+concentration is 0.1mM, Cu
2+concentration is 0.5mM, Sr
2+concentration is 3mM, Cr
3+concentration is 0.5mM, Ba
2+concentration is 3mM.
Embodiment:
Embodiment 1:
1, the preparation of golden nanometer particle:
100mL distilled water is added in 250mL three-necked bottle, then adds 750 μ L sodium citrate aqueous solutions (1g/10mL), stirs and is heated to 100 DEG C, then adding 2mLHAuCl
4(0.09424M), keep 100 DEG C, sustained response 30min, is cooled to room temperature.Solution becomes redness, and preparation terminates.Deionized water washes away undesired impurities, centrifugal, then is scattered in deionized water.
2, the preparation of plumbous binding proteins specific:
(1) preparation of α 2-microglobulin (a2m):
The structure of a.pET28a-a2m expression vector
According to the preferences of e. coli codon and the amino acid sequence of target protein, by Suzhou, Jin Weizhi bio tech ltd synthesizes target gene entirely, and sequence is as follows:
GAAGAAGCCAGCAGCACCCGCGGCAATCTGGACGTGGCCAAACTGAACGGCGATTG GTTTAGCATCGTGGTGGCCAGCAACAAACGCGAGAAAATCGAGGAGAACGGCAGCA TGCGCGTGTTTATGCAGCACATCGATGTGCTGGAGAATAGCCTGGGCTTCAAGTTC CGCATCAAAGAGAACGGCGAATGCCGCGAACTGTACCTGGTGGCCTATAAAACCCC GGAAGACGGCGAATACTTCGTGGAGTATGACGGCGGCAACACCTTCACCATCCTGA AGACCGATTACGACCGCTACGTGATGTTCCACCTGATTAATTTTAAAAATGGTGAA ACCTTCCAGCTGATGGTGCTGTATGGTCGCACCAAAGATCTGAGCAGCGATATCAA AGAAAAATTCGCCAAACTGTGCGAGGCCCATGGTATCACCCGCGACAACATCATCG ATCTGACCAAAACCGATCGCTGCCTGCAGGCCCGCGGT applying gene recombinant technique, entirely to synthesize target gene for template, a2m-F1/R1 (a2m-F1:5 '-CTAGCTAGCGAAGAAGCCAGCAGCACCCG-3 ', a2m-R1:5 '-CGGGATCCTTAACCGCGGGCCTGCAG-3 ') be upstream and downstream primer, pcr amplification obtains a2m genes of interest.After expression vector pET28a and genes of interest are reclaimed respectively through NheI and BamHI single endonuclease digestion, glue, connect also thermal transition through T4 ligase enzyme and enter expression type e. coli bl21 (DE3).Verified by bacterium colony PCR and check order the right-on recombinant expression carrier pET28a-a2m of screening acquisition sequence.
B. the abduction delivering of fusion His6-a2m and separation and purification
Getting the correct bacterium liquid 40 μ L of order-checking accesses in 4mlLB (50 μ g/mlKanamycin), in 37 DEG C, and 220r/min overnight incubation.Overnight culture be seeded in the triangular flask of 400ml containing the fresh LB of 50 μ g/mlKanamycin according to 1/100, in 37 DEG C, it is 0.6 ~ 0.8 that 220r/min is cultured to OD, adds the IPTG that final concentration is 0.166mM, continues to cultivate 4h, terminates fermentation.Collected by centrifugation thalline, carries out SDS-PAGE analysis.Result shows, and target protein achieves solubility expression in recombination bacillus coli, and expression is higher.
Expression thalline is resuspended in BufferA (50mmol/LTris-HCl, 500mmol/LNaCl, pH7.3) in, carry out ultrasonication (600W, run 4s, interval 16s, work 4min altogether), the broken liquid supernatant of collected by centrifugation, be splined on metallic ion (Ni2+) chelate chroma-tography post (ChelatingSepharoseFastFlow) equilibrated through BufferA in advance, use BufferB (50mmol/LTris-HCl again, 500mmol/LNaCl, 100mmol/Limidazole, pH7.3) foreign protein is washed away, finally by BufferC (50mmol/LTris-HCl, 500mmol/LNaCl, 200mmol/Limidazole, pH7.3) wash-out, collect target protein eluting peak.Analyze through SDS-PAGE, result shows, and it is pure that target protein is issued to electrophoresis at BufferC elution requirement.
(2) preparation of acetyl coenzyme A associated proteins 3 (ACBP3)
The structure of a.pET28a-ACBP3 expression vector
According to the preferences of e. coli codon and the amino acid sequence of target protein, by Suzhou, Jin Weizhi bio tech ltd synthesizes target gene entirely, and sequence is as follows:
TCTCAGGCCGAGTTTGAGAAAGCGGCAGAGGAAGTGCGTCATCTGAAAACCAAGCC GAGCGATGAGGAAATGCTGTTCATTTATGGCCATTATAAACAGGCAACCGTGGGCG ACATCAATACCGAACGCCCGGGTATGCTGGATTTTACCGGCAAAGCCAAGTGGGAC GCCTGGAATGAGCTGAAAGGCACCAGCAAGGAAGATGCCATGAAAGCGTATATCAA CAAAGTTGAAGAGCTGAAGAAAAAATATGGTATC applying gene recombinant technique, entirely to synthesize target gene for template, ACBP3-F1/R1 (ACBP-F1:5 '-CGGGATCCTTAGATACCATATTTTTTCTTCAGCTCT-3 ', ACBP-R1:5 '-GGAATTCCATATGTCTCAGGCCGAGTTTGAG-3 ') be upstream and downstream primer, pcr amplification obtains ACBP3 genes of interest.After expression vector pET28a and genes of interest are reclaimed respectively through NheI and BamHI single endonuclease digestion, glue, connect also thermal transition through T4 ligase enzyme and enter expression type e. coli bl21 (DE3).Verified by bacterium colony PCR and check order the right-on recombinant expression carrier pET28a-ACBP3 of screening acquisition sequence.
B. the abduction delivering of fusion His6-ACBP3 and separation and purification
Getting the correct bacterium liquid 40 μ L of order-checking accesses in 4mlLB (50 μ g/mlKanamycin), in 37 DEG C, and 220r/min overnight incubation.Overnight culture be seeded in the triangular flask of 400ml containing the fresh LB of 50 μ g/mlKanamycin according to 1/100, in 37 DEG C, it is 0.6 ~ 0.8 that 220r/min is cultured to OD, adds the IPTG that final concentration is 0.166mM, continues to cultivate 4h, terminates fermentation.Collected by centrifugation thalline, carries out SDS-PAGE analysis.Result shows, and target protein achieves solubility expression in recombination bacillus coli, and expression is higher.
Expression thalline is resuspended in BufferA (50mmol/LTris-HCl, 500mmol/LNaCl, pH7.3) in, carry out ultrasonication (600W, run 4s, interval 16s, work 4min altogether), the broken liquid supernatant of collected by centrifugation, be splined on metallic ion (Ni2+) chelate chroma-tography post (ChelatingSepharoseFastFlow) equilibrated through BufferA in advance, use BufferB (50mmol/LTris-HCl again, 500mmol/LNaCl, 100mmol/Limidazole, pH7.3) foreign protein is washed away, finally by BufferC (50mmol/LTris-HCl, 500mmol/LNaCl, 200mmol/Limidazole, pH7.3) wash-out, collect target protein eluting peak.Analyze through SDS-PAGE, result shows, and it is pure that target protein is issued to electrophoresis at BufferC elution requirement.
(3) preparation of thymosin extrasin 4 (Thymosin β 4 is called for short T β 4)
The structure of a.pET28a-T β 4 expression vector
According to the preferences of e. coli codon and the amino acid sequence of target protein, by Suzhou, Jin Weizhi bio tech ltd synthesizes target gene entirely, and sequence is as follows:
GACAAACCGGACATGGCTGAAATCGAAAAATTCGACAAATCCAAACTGAAGAAGAC TGAAACTCAGGAAAAAAACCCGCTGCCGTCCAAAGAAACTATCGAACAGGAAAAAC AGGCTGGTGAATCC applying gene recombinant technique, entirely to synthesize target gene for template, T β 4-F1/R1 (T β 4-F1:5 '-CGGCTAGCGACAAACCGGACATGGCTGAAATCG-3 '; T β 4-R1:5'-CGGGATCCTTAGGATTCACCAGCCTGTTTTTCC-3 ') be upstream and downstream primer, pcr amplification obtains T β 4 genes of interest.After expression vector pET28a and genes of interest are reclaimed respectively through NheI and BamHI single endonuclease digestion, glue, connect also thermal transition through T4 ligase enzyme and enter expression type e. coli bl21 (DE3).Verified by bacterium colony PCR and check order screening acquisition sequence right-on recombinant expression carrier pET28a-T β 4.
B. the abduction delivering of fusion His6-T β 4 and separation and purification
Getting the correct bacterium liquid 40 μ L of order-checking accesses in 4mlLB (50 μ g/mlKanamycin), in 37 DEG C, and 220r/min overnight incubation.Overnight culture be seeded in the triangular flask of 400ml containing the fresh LB of 50 μ g/mlKanamycin according to 1/100, in 37 DEG C, it is 0.6 ~ 0.8 that 220r/min is cultured to OD, adds the IPTG that final concentration is 0.166mM, continues to cultivate 4h, terminates fermentation.Collected by centrifugation thalline, carries out SDS-PAGE analysis.Result shows, and target protein achieves solubility expression in recombination bacillus coli, and expression is higher.
Expression thalline is resuspended in BufferA (50mmol/LTris-HCl, 500mmol/LNaCl, pH7.3) in, carry out ultrasonication (600W, run 4s, interval 16s, work 4min altogether), the broken liquid supernatant of collected by centrifugation, be splined on metallic ion (Ni2+) chelate chroma-tography post (ChelatingSepharoseFastFlow) equilibrated through BufferA in advance, use BufferB (50mmol/LTris-HCl again, 500mmol/LNaCl, 100mmol/Limidazole, pH7.3) foreign protein is washed away, finally by BufferC (50mmol/LTris-HCl, 500mmol/LNaCl, 200mmol/Limidazole, pH7.3) wash-out, collect target protein eluting peak.Analyze through SDS-PAGE, result shows, and it is pure that target protein is issued to electrophoresis at BufferC elution requirement.
(4) fibrin ferment cutting and three kinds of plumbous associated proteins sample preparations
More firmly coordination bond can be formed with each metal ion species because of histidine-tagged, thus severe jamming is caused to our experiment.In order to eliminate this impact, we utilize the thrombin cleavage site be present between histidine-tagged and target protein, carry out fibrin ferment cutting experiment.Protein sample and fibrin ferment are mixed in the ratio of 12.06mol:1U, 37 DEG C of water-baths, spend the night.Through BufferA dialysis except after imidazoles, be again splined on through the equilibrated Ni-IDA of BufferA, collect through peak.Through SDS-PAGE electrophoresis showed, there is obvious displacement difference before recombinant protein cutting and after cutting, show that fibrin ferment can excise completely histidine-tagged.By collect through peak, through ultrafiltration desalination, concentrated after, replacement solvent is HEPES (pH7.4), obtains target protein sample, for the coupling with gold nano grain.
3, the coupling of plumbous binding proteins specific and golden nanometer particle.
The solution of gold nanoparticles absorption 2mL getting above-mentioned preparation is placed in EP pipe.Centrifugal 10000rpm/10min, removes supernatant.Adding damping fluid respectively makes it disperse, then adds the plumbous associated proteins solution 1mL of above-mentioned preparation, is placed in the ultrasonic 10min of ultrasonic washing instrument.Room temperature is placed and golden nanometer particle is fully combined with plumbous associated proteins.Centrifugal, remove non-associated proteins.
The lead ion stock solution adding different amount is respectively diluted to 1mL, and concentration range is 0.01 μM ~ 20 μMs, and ultrasonic 10min makes plumbous associated proteins fully contact with lead ion.Add sodium chloride brine, ultrasonic mixing, observe color change.
The present invention utilizes heavy metal lead ion to have plumbous associated proteins and the gold nano grain coupling of specific recognition function, construct heavy metal lead ion probe, utilize lead metal ion and the protein-bonded specific recognition effect of lead, the color change of sensing system can be made, the detection to lead metal ion can be reached by naked eyes.This method is not limited to the when and where of use, directly reads experimental result by naked eyes, judges testing result.This sensor is high for the detection sensitivity of lead ion, and specificity is good, and simple and convenient, naked eyes identifiable design.
This experiment is that based target detection molecules causes nano particle gathering and produces the colorimetric analysis of color change, and colorimetric analysis is one of technology grown up at first in nanosensor technology.Adopt colorimetric analysis only to need nanoparticle surface to be carried out functional modification to enable optionally to produce response to target molecule, directly detected by naked eyes or simple optical spectrometer, the quantitative test to target molecule can be realized.This detection method easy and simple to handle and with low cost, has been widely used in various detection analysis and research work.After utilizing organic ligand, antibody protein and aptamer equimolecular to carry out functional modification to golden nanometer particle, find in solution containing after target molecule at functional molecular, cause the gathering of golden nanometer particle, the gathering of nano particle then causes solution colour generation conspicuousness to change, thus this colorimetric analysis is simple and quick, and has higher selectivity and sensitivity.
For the sensor that α 2-microglobulin (a2m) and golden nanometer particle coupling obtain, can be found out by uv-visible absorption spectra, along with the increase of plumbum ion concentration, gold nano grain reduces gradually in the surface plasma absorption peak strength at 525nm place, and occur Red Shift Phenomena, and occur at 604nm place gradually absorbing.This is because lead ion exists as bridge, impel the gathering with the gold nano grain of plumbous associated proteins coupling, thus the surface plasma that have impact on golden nanometer particle absorbs peak position, along with the increase of gold nanometer particle grain size, plasmon absorption red shift gradually (as Fig. 2).The color of the solution of gold nanoparticles that detects by an unaided eye is gradually become blue (Fig. 1) by pink.Tested by interfering ion, can find out that common metallic ion is for the lead ion sensor disturbance constructed by us less (Fig. 3), its detection for lead ion can not be affected.
Embodiment 2:
Get 9mLCTAB stock solution 0.1M, 250 μ L gold chloride storing solutions, 600 μ L sodium borohydride solution mixing, 25 DEG C are reacted 2 hours, obtained seed solution.
Get 40mLCTAB storing solution, add 2mL gold chloride storing solution, 400 μ L liquor argenti nitratis ophthalmicuses (0.01M), 300 μ L ascorbic acid solutions (0.1M), 800 μ L hydrochloric acid, and 10 μ L seed solutions.At 37 DEG C of temperature, react 12 hours, obtained bar-shaped gold nano grain.
The bar-shaped solution of gold nanoparticles absorption 2mL getting above-mentioned preparation is placed in EP pipe.Centrifugal 8000rpm/10min, removes supernatant.Adding damping fluid respectively makes it disperse, then adds the plumbous associated proteins solution 1mL of above-mentioned preparation, is placed in the ultrasonic 10min of ultrasonic washing instrument.Room temperature is placed and gold nanorods is fully combined with plumbous associated proteins.Centrifugal, remove non-associated proteins.
The lead ion stock solution adding different amount is respectively diluted to 1mL, and concentration range is 0.01 μM ~ 20 μMs, and ultrasonic 10min makes plumbous associated proteins fully contact with lead ion, ultrasonic mixing, observes color change.
When utilizing bar-shaped golden nanometer particle as sensor signal source, because the overall particle diameter of nanometer rods is greater than spherical nano particle, so when sensing system runs into lead ion, more easily producing agglomerating effect, in experiment, the effect identical with spherical golden nanometer particle can be obtained without the need to using sodium chloride solution.
<110> Shenyang Pharmaceutical University
<120> mono-kind detects the method for lead ion fast
<160>3
<210>1
<211>486
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>
<223> designs according to the preferences of e. coli codon and the amino acid sequence of target protein
<400>1
GAAGAAGCCAGCAGCACCCGCGGCAATCTGGACGTGGCCAAACTGAACGGCGATTGGTTT60
AGCATCGTGGTGGCCAGCAACAAACGCGAGAAAATCGAGGAGAACGGCAGCATGCGCGTG120
TTTATGCAGCACATCGATGTGCTGGAGAATAGCCTGGGCTTCAAGTTCCGCATCAAAGAG180
AACGGCGAATGCCGCGAACTGTACCTGGTGGCCTATAAAACCCCGGAAGACGGCGAATAC240
TTCGTGGAGTATGACGGCGGCAACACCTTCACCATCCTGAAGACCGATTACGACCGCTAC300
GTGATGTTCCACCTGATTAATTTTAAAAATGGTGAAACCTTCCAGCTGATGGTGCTGTAT360
GGTCGCACCAAAGATCTGAGCAGCGATATCAAAGAAAAATTCGCCAAACTGTGCGAGGCC420
CATGGTATCACCCGCGACAACATCATCGATCTGACCAAAACCGATCGCTGCCTGCAGGCC480
CGCGGT486
<210>2
<211>258
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>
<223> designs according to the preferences of e. coli codon and the amino acid sequence of target protein
<400>2
TCTCAGGCCGAGTTTGAGAAAGCGGCAGAGGAAGTGCGTCATCTGAAAACCAAGCCGAGC60
GATGAGGAAATGCTGTTCATTTATGGCCATTATAAACAGGCAACCGTGGGCGACATCAAT120
ACCGAACGCCCGGGTATGCTGGATTTTACCGGCAAAGCCAAGTGGGACGCCTGGAATGAG180
CTGAAAGGCACCAGCAAGGAAGATGCCATGAAAGCGTATATCAACAAAGTTGAAGAGCTG240
AAGAAAAAATATGGTATC258
<210>3
<211>126
<212>DNA
<213> artificial sequence
<220>
<221>misc_feature
<222>
<223> designs according to the preferences of e. coli codon and the amino acid sequence of target protein
<400>3
GACAAACCGGACATGGCTGAAATCGAAAAATTCGACAAATCCAAACTGAAGAAGACTGAA60
ACTCAGGAAAAAAACCCGCTGCCGTCCAAAGAAACTATCGAACAGGAAAAACAGGCTGGT120
GAATCC126
Claims (10)
1. detect a method for heavy metal lead ion fast, it is characterized in that, adopt following step:
(1) preparation of golden nanometer particle;
(2) preparation of plumbous binding proteins specific;
(3) coupling of plumbous binding proteins specific and golden nanometer particle.
2. a kind of optical sensor construction method detecting heavy metal lead ion according to claim 1, is characterized in that, the golden nanometer particle described in step (1) is the one in golden nano spherical particle or golden rod-like nano particle.
3. method according to claim 1 and 2, is characterized in that, the golden nanometer particle described in step (1) is prepared by the following method:
Gold nano spherical particle: 100-200mL distilled water is placed in the three-necked bottle of certain capacity, add 0.75-1.5mL reductant solution (0.01 ~ 0.5g/mL), stir and be heated to 20 ~ 100 DEG C, add 2-4mL gold chloride storing solution, adjust ph is 9 ~ 11, reaction 25-35min, and solution becomes pink, preparation terminate, be stored in 4 DEG C for subsequent use;
Gold rod-like nano particle: get 2 ~ 10mL cetyl trimethyl ammonium bromide (CTAB) stock solution, 0.08 ~ 0.2M, 100 ~ 500 μ L gold chloride storing solution 0.0025 ~ 0.02M, 200 ~ 800 μ L reductant solution mixing, 20 ~ 37 DEG C are reacted 1 ~ 3 hour, obtained seed solution;
Get 30 ~ 60mLCTAB storing solution, add 1 ~ 3mL gold chloride storing solution, 200 ~ 500 μ L liquor argenti nitratis ophthalmicuses (0.005 ~ 0.02M), 200 ~ 500 μ L reductant solutions (0.08 ~ 0.2M), 500 ~ 800 μ L hydrochloric acid, and 5 ~ 200 μ L seed solutions, at 25 ~ 37 DEG C of temperature, react 10 ~ 20 hours, obtained bar-shaped gold nano grain.
4. method as claimed in claim 3, is characterized in that: described reductive agent is the one in sodium borohydride, hyposulfite, sulphite, nitrite, vitamin C, sodium citrate, hydrazine hydrate, azanol.
5. as the method for claim 1-4 as described in any one, it is characterized in that, the preparation of plumbous binding proteins specific in described step (2), comprising: the structure of expression vector, the abduction delivering of fusion and separation and purification, fibrin ferment cutting and protein sample preparation.
6. method as claimed in claim 5, is characterized in that, being configured to of described expression vector: applying gene recombinant technique, with gold only intelligence entirely synthesize plasmid containing genes of interest for template, design upstream and downstream primer, pcr amplification obtains genes of interest; Expression vector pET28a and genes of interest are connected respectively through double digestion, T4 ligase enzyme, after thermal transition and order-checking, obtains the right-on recombination bacillus coli of sequence.
7. the method as described in claim 5 or 6, is characterized in that, get the correct bacterium liquid of order-checking and be seeded in the triangular flask of fresh LB, being cultured to OD is 0.6 ~ 0.8, adds IPTG, continues to cultivate, and terminates fermentation, collected by centrifugation thalline;
Expression thalline is resuspended in BufferA (20mmol/LTris-HCl, 500mmol/LNaCl, pH7.3) in, ultrasonication, centrifugal after, get supernatant, be splined on by the equilibrated Ni-IDA of BufferA, use BufferB (20mmol/LTris-HCl, 500mmol/LNaCl, 100mmol/Limidazole again, pH7.3) foreign protein is washed away, finally by BufferC (20mmol/LTris-HCl, 500mmol/LNaCl, 200mmol/Limidazole, pH7.3) wash-out, collects target protein eluting peak.
8., according to the method for claim 3 ~ 8 described in any one, it is characterized in that the concentration of described gold chloride storing solution is 0.0025M ~ 0.02M.
9., according to the method for claim 3 ~ 8 described in any one, it is characterized in that: reductant solution compound concentration is 0.001 ~ 1M.
10., according to the method for claim 1 ~ 9 described in any one, it is characterized in that: described plumbous binding proteins specific is α 2-microglobulin, acetyl coenzyme A associated proteins 3, the one in thymosin extrasin 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510796079.8A CN105403558B (en) | 2015-11-18 | 2015-11-18 | A kind of method of quick detection lead ion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510796079.8A CN105403558B (en) | 2015-11-18 | 2015-11-18 | A kind of method of quick detection lead ion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105403558A true CN105403558A (en) | 2016-03-16 |
| CN105403558B CN105403558B (en) | 2019-04-02 |
Family
ID=55469178
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510796079.8A Active CN105403558B (en) | 2015-11-18 | 2015-11-18 | A kind of method of quick detection lead ion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105403558B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108872213A (en) * | 2018-05-08 | 2018-11-23 | 中国航发北京航空材料研究院 | A method of high content nickel element in measurement Au82Ni alloy |
| CN109324045A (en) * | 2018-11-12 | 2019-02-12 | 安庆师范大学 | A kind of kit and its detection method of quick detection Cadmium In The Water Body ion |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101241129A (en) * | 2008-01-11 | 2008-08-13 | 东北农业大学 | Chicken A-FABP antiserum preparing and its application method in specificity identification |
| KR20110031689A (en) * | 2009-09-21 | 2011-03-29 | 숭실대학교산학협력단 | Colorimetric sensor possible to detect amino acids using surface-modified gold nanoparticles and detection method of the amino acids and peptide using color recovery of the gold nanoparticles |
| CN102735639A (en) * | 2012-06-29 | 2012-10-17 | 陕西师范大学 | Unlabeled-type homogeneous colorimetric method for detecting lead ions |
| CN104004780A (en) * | 2014-06-17 | 2014-08-27 | 南京大学 | Method for expressing and purifying human cytoplasmic gelsolin |
| CN104165855A (en) * | 2014-05-09 | 2014-11-26 | 上海大学 | Specific polypeptide modified colorimetric sensor and making method thereof |
| CN104211811A (en) * | 2013-06-03 | 2014-12-17 | 华东理工大学 | Copper silver ion fluorescin probe, and making method and application thereof |
| CN104419701A (en) * | 2013-08-29 | 2015-03-18 | 天津大学 | Rapid assembling method of multi-fragment DNA yeast |
| CN104655578A (en) * | 2015-02-13 | 2015-05-27 | 王利兵 | Colorimetric method for detecting lead ions |
-
2015
- 2015-11-18 CN CN201510796079.8A patent/CN105403558B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101241129A (en) * | 2008-01-11 | 2008-08-13 | 东北农业大学 | Chicken A-FABP antiserum preparing and its application method in specificity identification |
| KR20110031689A (en) * | 2009-09-21 | 2011-03-29 | 숭실대학교산학협력단 | Colorimetric sensor possible to detect amino acids using surface-modified gold nanoparticles and detection method of the amino acids and peptide using color recovery of the gold nanoparticles |
| CN102735639A (en) * | 2012-06-29 | 2012-10-17 | 陕西师范大学 | Unlabeled-type homogeneous colorimetric method for detecting lead ions |
| CN104211811A (en) * | 2013-06-03 | 2014-12-17 | 华东理工大学 | Copper silver ion fluorescin probe, and making method and application thereof |
| CN104419701A (en) * | 2013-08-29 | 2015-03-18 | 天津大学 | Rapid assembling method of multi-fragment DNA yeast |
| CN104165855A (en) * | 2014-05-09 | 2014-11-26 | 上海大学 | Specific polypeptide modified colorimetric sensor and making method thereof |
| CN104004780A (en) * | 2014-06-17 | 2014-08-27 | 南京大学 | Method for expressing and purifying human cytoplasmic gelsolin |
| CN104655578A (en) * | 2015-02-13 | 2015-05-27 | 王利兵 | Colorimetric method for detecting lead ions |
Non-Patent Citations (3)
| Title |
|---|
| 叶春洁等: "金纳米粒子与蛋白质的相互作用及其应用", 《中国科学：化学》 * |
| 周桂凤等: "铅结合蛋白研究进展", 《国外医学卫生分册》 * |
| 杨东萍等: "蝎镇痛抗菌活性肽BmK AS的融合表达及蛋白切割", 《沈阳药科大学学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108872213A (en) * | 2018-05-08 | 2018-11-23 | 中国航发北京航空材料研究院 | A method of high content nickel element in measurement Au82Ni alloy |
| CN108872213B (en) * | 2018-05-08 | 2020-12-29 | 中国航发北京航空材料研究院 | Method for measuring high-content nickel element in Au82Ni alloy |
| CN109324045A (en) * | 2018-11-12 | 2019-02-12 | 安庆师范大学 | A kind of kit and its detection method of quick detection Cadmium In The Water Body ion |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105403558B (en) | 2019-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jazayeri et al. | Colorimetric detection based on gold nano particles (GNPs): An easy, fast, inexpensive, low-cost and short time method in detection of analytes (protein, DNA, and ion) | |
| Yang et al. | A novel surface-enhanced Raman scattering (SERS) strategy for ultrasensitive detection of bacteria based on three-dimensional (3D) DNA walker | |
| Liu et al. | Amino acid-mediated ‘turn-off/turn-on’nanozyme activity of gold nanoclusters for sensitive and selective detection of copper ions and histidine | |
| Pan et al. | A novel and sensitive fluorescence sensor for glutathione detection by controlling the surface passivation degree of carbon quantum dots | |
| Li et al. | Colorimetric response of peptide modified gold nanoparticles: An original assay for ultrasensitive silver detection | |
| Zhao et al. | Gold nanoparticle coupled with fluorophore for ultrasensitive detection of protamine and heparin | |
| CN105548109A (en) | A fluorescence detecting system for heavy metal cadmium and a fluorescence detecting method | |
| Xu et al. | Multi-emission fluorescent sensor array based on carbon dots and lanthanide for detection of heavy metal ions under stepwise prediction strategy | |
| Wang et al. | DNA-functionalized gold nanoparticle-based fluorescence polarization for the sensitive detection of silver ions | |
| Shamsipur et al. | Development of a novel flow injection liquid–liquid microextraction method for the on-line separation and preconcentration for determination of zinc (II) using 5-(8-hydroxy-2-quinolinylmethyl)-2, 8-dithia-5-aza-2, 6-pyridinophane as a sensitive and selective fluorescent chemosensor | |
| Jiang et al. | A colorimetric sensor based on Glutathione-AgNPs as peroxidase mimetics for the sensitive detection of Thiamine (Vitamin B1) | |
| Huang et al. | Fluorescent sensing of mercury (II) and copper (II) ions based on DNA-templated Cu/Ag nanoclusters | |
| Chen et al. | Detection of Ag+ ions and cysteine based on chelation actions between Ag+ ions and guanine bases | |
| CN106872682B (en) | A kind of colorimetric bio sensor and preparation method thereof detecting mercury ion | |
| Guo et al. | Enzymatic reaction modulated gold nanoparticle aggregation-induced photothermal and smartphone readable colorimetry dual-mode biosensing platform for trypsin detection in clinical samples | |
| Deng et al. | Schiff base and Lewis acid-base interaction-regulated aggregation/dispersion of gold nanoparticles for colorimetric recognition of rare-earth Sc3+ ions | |
| Luo et al. | Fluorescence and surface-enhanced Raman scattering dual-mode nanoprobe for monitoring telomerase activity in living cells | |
| Lin et al. | A colorimetric sensor for the detection of hydrogen peroxide using DNA-modified gold nanoparticles | |
| Zhuang et al. | A colorimetric and SERS dual-readout sensor for sensitive detection of tyrosinase activity based on 4-mercaptophenyl boronic acid modified AuNPs | |
| Kong et al. | Dual-responsive ratiometric fluorescence detection of Ce4+ and ascorbic acid by regulating oxidase-mimicking activity of Ce4+-based nanocomplex | |
| CN105403558A (en) | Method for on-line and quick detection of lead ions | |
| Yuan et al. | Single particle detection based colorimetric melamine assay with MnO2-modified gold nanoparticles | |
| Yao et al. | A highly sensitive and selective resonance Rayleigh scattering method for bisphenol A detection based on the aptamer–nanogold catalysis of the HAuCl 4–vitamin C particle reaction | |
| Qu et al. | Fluorescent turn-off/on bioassay for hemoglobin based on dual-emission carbon nanodots-graphene oxide system with multi-detection strategies | |
| Qiu et al. | A Turn‐On Fluorescent Sensor for Glutathione Based on Bovine Serum Albumin‐Stabilized Gold Nanoclusters |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |