CN104357463B - Function identification of antimony oxidase gene sboA in agrobacterium tumefaciens - Google Patents

Abstract

The invention belongs to the field of germ gene engineering, and relates to function identification of an antimony oxidase gene in agrobacterium tumefaciens. By means of methods including gene knockout, antimony growth oxidation experiments, heterologous expression and the like, the antimony oxidase gene sboA derived from agrobacterium tumefaciens GW4 is separated and cloned; the nucleotide sequence of the gene is represented as SEQ ID NO:1, and the gene coded protein sequence is represented as SEQ ID NO:2; and the gene coded enzyme can catalyze trivalent antimony [Sb (III)] with strong toxicity to be oxidized into pentavalent antimony [Sb (V)] with weak toxicity, and has potential of application to environmental antimony pollution purification. The gene is contained in a prokaryotic expression vector, escherichia coli BL21/pET28a-sboA containing the plasmid is preserved in CCTCC (China Center for Type Culture Collection), and the preservation number is CCTCC NO: 2014437.

Description

The Function Identification of antimony lysyloxidase gene sboa in Agrobacterium tumefaciems

Technical field

The invention belongs to bacterial gene engineering field, it is related to a kind of function of antimony lysyloxidase gene in Agrobacterium tumefaciems gw4 Identification.The method such as oxidation experiment and heterogenous expression is grown by gene knockout, antimony, separates, cloned one from crown gall New antimony lysyloxidase gene sboa in Agrobacterium gw4.The stronger trivalent antimony [sb (iii)] of the enzyme catalysiss toxicity of this gene code It is oxidizing to the weaker quinquevalence antimony of toxicity [sb (v)], there is the potential being applied to the purification of environment antimony pollution.

Background technology

Antimony (antimony, sb) be a kind of severe toxicity heavy metal element, in the periodic table of elements the 5th the cycle va race, extensively General it is distributed in rock, air, Soil sediment and water body.Its inorganic forms is mainly with simple substance antimony [sb (0)], trivalent antimony [sb (iii)] and quinquevalence antimony [sb (v)] form exist, organic form be mainly trimethylantimony compound (He Mengchang etc., 2004). The toxicology property of antimony is similar to arsenic but toxicity is far longer than arsenic, and the toxicity of inorganic antimony is better than antimony organic, the strong toxicity of sb (iii) In sb (v) (smichowski p.antimony in the environment as a global pollutant: areview on analytical methodologies for its determination in atmosphericaerosols.talanta,2008,75:2).Mankind's Long Term Contact antimony can cause skin, upper respiratory tract, the heart, Liver, lung etc. organize obvious damage, ultimately result in canceration (shotyk w, the krachler a.contamination of of body bottled waters with antimony leaching from polyethylene terephthalate(pet) increases upon storage.environ sci technol,2007,41:1560-1563).Of many uses, the bag of antimony Include production pottery, glass, alloy, battery, paint, pyrotechnic material and fire retardant etc., may further be used to treat various parasitic disease.But With the fast development of China's economy, while living standards of the people improve, also environment is caused with great pollution.Industry The use of " three wastes ", the discharge of motor-vehicle tail-gas, sewage irrigation and pesticide, herbicide, chemical fertilizer etc. and the development of mining industry, make big The antimony of amount and its compound enter into big gas and water and soil, and eventually enter in animals and plants and human body.According to IARC (iarc) report, ample evidence shows that sb (iii) has carcinogenesis (iarc.some organic to the animal in environment Solvents, resin monomers and related compounds, pigments and occupational exposures in paint manufacture and painting.lyon:iarc,1989.291-305).Due to antimony Toxicity and biological effectiveness, antimony and its compound are classified as priority pollutant by EPA and European Union, also will in the Japanese Environment Room It is classified as the pollutant of close attention.In Basel Convention, antimony is classified as danger in limiting by the transboundary migration with regard to hazardous waste Row (filella m, belzile n, the chen y w.antimony in the environment:a review of waste focused on natural waters i.occurrence.earthsci rev,2002,57:125-176).

Although antimony pollution seriously threatens human life and health, some microorganisms show pole to environment middle and high concentration antimony Strong adaptability simultaneously plays important role in the environment earth circulation of antimony.Therefore understand the heavy metal resistance machine of microorganism System, the related functional gene of research antimony resistance contributes to us and understands the detoxification machine of microorganism heavy metal from the level of gene System, and find new heavy metal pollution restorative procedure.Provide fundamental basis and technical support for the reparation of antimony pollution in environment, and The preferably environment earth circulation of understanding antimony element.

At present, the research to antimony Resistance mechnism in antibacterial is less, and particularly related to antimony oxidation molecular mechanism is ground Study carefully quite deficient.Sb (iii) in environment can be converted into the relatively low sb (v) of toxicity by the oxidation of antibacterial antimony, reduce environmental toxicity, Environment antimony pollution is repaired significant.So far, researcher isolates more than 50 plant in succession from multiple kinds Antimony oxidation bacteria (shi z, cao z, qin d et al.correlation models between environmental factors and bacterial resistance to antimony and copper.plos one,2013,8: e78533；li j,wang q,zhang s z,qin d,wang g j.phylogenetic and genome analyses of antimony-oxidizing bacteria isolated from antimony mined soil.interna biodeter&biodegra,2013,76:76-80).But in the antimony oxidation bacteria having now been found that, there are two types: first kind antimony Oxidation bacteria not only can aoxidize sb (iii) but also can aoxidize as (iii).Lehr in 2007 et al. finds that Agrobacterium tumefaciems 5a is this The representative of class antimony oxidation bacteria.After having lacked arsenic oxidase large subunit gene aioa, sb (iii) oxidation is only subject to very micro- this bacterium Weak impact (lehr cr, kashyap dr, mcdermott tr.new insights into microbial oxidation of antimony and arsenic.appl environ microbiol,2007,73:2386-2389). Arsenic oxidase is not contained but it is also possible to aoxidize sb (iii) in Equations of The Second Kind antimony oxidizing bacteria.Although arsenic and antimony are located at same main group, These results suggest that the oxidation of antibacterial arsenic and antimony oxidation are two relatively independent processes, should exist in antibacterial and arsenic oxidase base Because of diverse antimony lysyloxidase gene.But at present, also not studies have found that specific antimony oxidase and regulation and control antimony oxidation The functional gene of process.

Therefore, applicant finds out Agrobacterium tumefaciems gw4 (wang q, qin by the analysis of the methods such as comparative proteome d,zhang s,et al.fate of arsenate following arsenite oxidation in agrobacterium tumefaciens gw4.environ microbiol,2014,doi:10.1111/1462- 2920.12465) the antimony lysyloxidase gene sboa in, and using gene knockout, the growth method such as oxidation experiment and heterogenous expression Identify the function of this enzyme antimony oxidation.The discovery of sboa gene is conducive to us to study the molecular mechanism of antimony oxidation and resistance, fills up Blank for antimony lysyloxidase gene research field both at home and abroad at present.Its heterogenous expression can repair ring for building genetic engineering bacterium Antimony pollution in border provides theoretical foundation and technical support.

Content of the invention

It is an object of the invention to separate and clone Agrobacterium tumefaciems gw4 in coding sb (iii) oxidasic gene Sboa, and functional verification and application are carried out to it.1-855 in the nucleotide sequence of this gene such as sequence table seq id.no:1 Sequence shown in bit base；The protein sequence of this gene code is as shown in seq id no:2.

The present invention is implemented by the following technical programs:

Applicant's previous work is to be isolatable from the Agrobacterium tumefaciems in ubac city of Shanxi Province underground water sediment (agrobacterium tumefaciens) gw4 (referring to: wang q, qin d, zhang s, et al..environ Microbiol, 2014, doi:10.1111/1462-2920.12465) it is object of study, adding 50 μm of sb (iii) and be not added with It is compared proteomics research under the conditions of sb (iii).Find after mass spectrum sequencing, the oxidoreductase table being encoded by sboa The amount of reaching raises.Belong to sdr family by comparing the albumen finding this gene code, can be in steroid, cofactors, carbon aquation Oxidoreduction phenotype (odermatt is showed in the metabolic process of compound, lipid, polyhydric alcohol, aromatic compound and aminoacid etc. a and nashev lg.the glucocorticoid-activating enzyme 11beta-433hydroxysteroid dehydrogenase type 1has broad substrate specificity:physiological and toxicological considerations.j.steroid biochem.mol.biol,2010,119:1-13).And antimony (antimony potassium tartrate) hydrolysed form in aqueous, similar to polyhydric alcohol, therefore speculates that sboa may be Agrobacterium tumefaciems gw4 In antimony oxidase, and by gene knockout, antimony grow the method such as oxidation experiment and heterogenous expression identify its antimony oxidation work( Energy.

The present invention adopts knockout carrier pjq200sk, and (Fig. 1 is shown in by its structure, and Montana, United States stand university, timothy wheat Ke Demote (timothy r.mcdermott) professor give) sboa gene is carried out with traceless knockout (link aj, phillips d,church gm.methods for generating precise deletions and insertions in the genome of wild-type escherichia coli:application to open reading frame characterization.j bacteriol,1997,179:6228-6237).Knockout carrier pjq-sboa building process is such as Under: according to sboa gene order in bacterial strain gw4 and its upstream and downstream sequence, separately design upstream and downstream homologous fragment primer psboa- 1f, as follows: (5'aaatctagagcggaacatcgggaatacg3')/psboa-1r (5' ) and psboa-2f (5' cattatcttccttgaatgcggggtggatggtcgtcataggtt3' ccgcattcaaggaagataatgcctatgacatcgtccagaacc3')/psboa-2r(5' aaaggatcctgaatagcgagccagacca3').By cross-over pcr by the upstream and downstream homologous fragment of sboa gene Connect together, then itself and pjq200sk knockout carrier are carried out double digestion using bamhi and xbai simultaneously, and connect conversion extremely In escherichia coli (escherichia coli) s17-1, finally successfully obtain knockout carrier e.coli s17-1/pjq-sboa. The carrier building is proceeded to wild type Agrobacterium Agrobacterium (agrobacterium using this hybridizing method of parents Tumefaciens) in gw4, carrier single-swap is made to be inserted in gw4 genome by homologous recombination, lethal finally by sucrose Obtain mutant gw4- δ sboa.By primer pmsboa-1f (5'aacaacagcaggcggagac3')/pmsboa-1r (5' ) and primer pmsboa-2f (5'cgctttccgccttcttt3')/pmsboa-2r (5' cgatggcggcaacaat3' Cgtacatcgccgacaagg3') amplification sboa upstream and downstream homologous fragment and gene internal fragment knock out successfully to verify simultaneously (see Fig. 3).

After knocking out success, build complementing vector pcpp30-sboa and verify that can complementary strain phenotype reply.Using primer csboa-f(5'aaactgcagcgaaacgacgcgaaggagaa3')/csboa-r(5' Aaaggatccctggaggttgccgtgcttaa3') expand complete sboa genetic fragment, with complementing vector pcpp30 (see figure 2) carry out psti-bamhi double digestion simultaneously, then pass through t₄Ligase converts to e.coli s17-1 final acquisition mutually after connecting Mend carrier.Complementing vector is converted by double parents and obtains complementary strain gw4- δ sboa- to mutant gw4- δ sboa C, simultaneously by complementing vector by double parents convert to wild type gw4 to overexpression strain gw4::sboa (see Fig. 3).

Respectively bacterial strain gw4, gw4- δ sboa, gw4- δ sboa-c and gw4::sboa are seeded to containing 10 μm and 50 μm In cdm (formula the is shown in annex) culture medium of sb (iii), every 8h sampling, detect its growth and oxidization condition.Using ultraviolet spectrometry Photometric determination od₆₀₀(beckman, du800), using high performance liquid chromatography-hydride generation-atomic fluorescence spectrometer (hplc-hg-afs, beijing titan instruments co., ltd.) measures the antimony content in culture medium.Result shows The mutant oxidation rate knocking out sboa gene reduces 27%, and the phenotypic reversion of complementary strain is to wild-type levels, and exceeded reaches The oxidation rate of bacterial strain improves 34%, illustrates that sboa gene have impact on the sb (iii) oxidation phenotype (see Fig. 4) of bacterial strain really.

In order to study sb (iii) oxidative function of sboa further, we are by proceeding to complementing vector pcpp30-sboa Carry out heterogenous expression in e.coli s17-1 without this gene and detect its sb (iii) oxidation phenotype.With wild type e.coli S17-1 and e.coli s17-1 (pcpp30) the conduct comparison proceeding to pcpp30 empty carrier.Result shows although e.coli S17-1 can aoxidize a small amount of sb (iii) with the e.coli s17-1 (pcpp30) proceeding to zero load, but proceed to pcpp30-sboa and carry Sb (iii) the oxidation phenotype of the e.coli s17-1 (pcpp30-sboa) of body is substantially accelerated, and illustrates that sboa accelerates really Antimony oxidation reaction in e.coli s17-1 (pcpp30-sboa), has the ability (see Fig. 5) that catalysis antibacterial sb (iii) aoxidizes.

For the antimony oxidability of deep confirmation sboa, we pass through prokaryotic expression purification sboa albumen, and Detect its oxidability to sb (iii) in vitro.Using the primer esboa-f with ecori and hindiii restriction enzyme site (5'aaagaattcatgacgaccatccacccc3')/esboa-r (5'aaaaagcttcggcacccgtaaaatctg3) expands Complete sboa genetic fragment, and by it with pet-28a (+) expression vector is connected and is built into (see Fig. 6) after recombinant vector, proceed to Expression strain is in escherichia coli bl21.Applicant by the escherichia coli bl21/pet28a-sboa of the restructuring building, Escherichia coli bl21/pet28a-sboa, delivers to China on 22nd in September in 2014. Wuhan. China of Wuhan University allusion quotation Type culture collection (English abbreviation cctcc) preservation, its preserving number is cctcc no:m2014437.

The mycology feature of escherichia coli pet28a-sboa

Recombination bacillus coli (or referred to as expression strain) the e.coli bl21/pet28a-sboa that the present invention builds is the most suitable 37 DEG C of growth temperature；For gram negative bacilli, whole body flagellum, can move, no spore；There is kanamycin (kan) resistance.

Expression strain e.coli bl21 (pet28a-sboa) of restructuring is cultivated to od at 37 DEG C₆₀₀When being about 0.3-0.4 Add 0.2mm iptg, collects thalline pressure breaking after 28 DEG C of induction 2h, combine the purpose egg with his label using nickel post In vain, then by the imidazoles of variable concentrations destination protein is eluted, finally successfully obtain sboa albumen.Due to sboa in vitro Oxidation sb (iii) needs an electron acceptor, and current research does not also find the electron acceptor that sb (iii) aoxidizes, therefore The mutant strain gw4- δ sboa having lacked sboa gene is taken carefully after culture 24h under conditions of adding 10 μm of sb (iii) by we The supernatant that born of the same parents crush, as electron acceptor, adds 1 μm of sb (iii), 200 μm of coenzyme nadp⁺With variable concentrations after purification Sboa albumen, using 50mm tris-hcl (ph=8.0) as buffer system, 28 DEG C incubation 0.5h after by high performance liquid chromatography- Hydride generation-atomic fluorescence spectrometric instrument detects that sboa aoxidizes the ability of sb (iii) in vitro.Result shows compared to being not added with sboa Albumen, after adding variable concentrations sboa albumen, sb (iii) oxidability gradually strengthens it was demonstrated that sboa has oxidation sb in vitro (iii) ability (see Fig. 7).

Advantages of the present invention is as follows:

1. in nature, a lot of antibacterials can aoxidize sb (iii), but also not studies have found that the antimony in antibacterial so far Lysyloxidase gene, innovative point of the present invention is to disclose antimony lysyloxidase gene in antibacterial first, fills up both at home and abroad with regard to antibacterial antimony oxygen Change the blank of enzyme research field.

2. the heavy metal pollution of current China is serious, and the related functional gene of research antibacterial antimony resistance contributes to us from gene Level on understand the detoxication mechanisms to antimony for the microorganism, also can make we preferably recognize antimony element on the earth material circulation.

3. heterogenous expression sboa can make sb (iii) oxidation rate of e.coli s17-1 accelerate, and is conducive to our exploitations New heavy metal pollution restorative procedure, the structure of the original position microorganism remediation for antimony pollution in environment and genetic engineering bacterium provides Theoretical basiss and technical support.

Brief description

Sequence table seq id no:1 is the nucleotide sequence of antimony lysyloxidase gene sboa of the present invention, and sequence length is 855bp (this gene coding region is 1-855bp, shows corresponding aminoacid sequence).

Sequence table seq id no:2 is the protein sequence of antimony lysyloxidase gene sboa coding of the present invention, encodes 284 ammonia Base acid.

Fig. 1: knockout carrier pjq200sk-sboa schematic diagram used in the present invention.

Fig. 2: complementing vector pcpp30-sboa schematic diagram used in the present invention.

The schematic diagram of Fig. 3: sboa gene and its surrounding genes and inspection pcr result.

Wherein: a in Fig. 3 is the schematic diagram of antimony lysyloxidase gene sboa and its surrounding genes.A:b ' in figure 3 is Sboa gene and its upstream and downstream homologous fragment, c ' is sboa gene internal fragment.B in Fig. 3 is using primer pmsboa-1f/ B ' the segment length of pmsboa-1r amplification, the c in Fig. 3 is c ' the piece segment length using primer pmsboa-2f/pmsboa-2r amplification Degree.Swimming lane illustrates: 1- is wild type gw4, and 2- is mutant gw4- δ sboa, and 3- is complementary strain gw4- δ sboa-c, and m is dl 2000plus marker.From the figure 3, it may be seen that mutant and complementary strain successfully construct.

Fig. 4: it is wild-type strain gw4, mutant gw4- δ sboa, complementary strain gw4- δ sboa-c and overexpression bacterial strain Gw4::sboa plus variable concentrations sb (iii) under the conditions of growth and oxidation curve.

Wherein: a and c in Fig. 4 is life under the conditions of adding 10 μm of sb (iii) for escherichia coli (e.coli) the s17-1 bacterial strain Long oxidation curve, b and d in Fig. 4 is growth under the conditions of adding 50 μm of sb (iii) for escherichia coli (e.coli) the s17-1 bacterial strain Oxidation curve.

The oxidation of sb (iii) in Fig. 5: escherichia coli (e.coli) s17-1.

Wherein: a in Fig. 5 is 0.5h, the separately sampled detection of 1h, 1.5h and 2h proceeds to plasmid (i.e. complementing vector) The e.coli s17-1 (pcpp30-sboa) of pcpp30-sboa and control strain e.coli s17-1 (pcpp30), e.coli The growth curve of s17-1.B in Fig. 5 is sb (iii) the oxidation curve of each bacterial strain.

Fig. 6: recombinant expression carrier pet-28a-sboa schematic diagram used in the present invention.

Fig. 7: the sboa external oxidation experiment to sb (iii).

Specific embodiment

Embodiment 1:sboa gene knockout, complementary and exceeded reach experiment

1st, knockout carrier builds

The present embodiment adopts pjq200sk, and (see Fig. 1, Montana, United States found university, timothy McDermott (timothy r.mcdermott) professor give)) knockout carrier carries out traceless knockout to sboa gene.Knockout carrier built Journey is as follows: according to sboa gene order in bacterial strain gw4, design is drawn with bamhi and xbai restriction enzyme site upstream homologous fragment Primer psboa-2f and psboa-2r of thing psboa-1f and psboa-1r and downstream homologous fragment.Then configuration pcr system: 5 μ l 10 × pcr buffer, 1 μ l dntps, each 1 μ l of left and right primer, 2 μ l dna templates, 0.5 μ l taq dna polymerase, Moisturizing is to 50 μ l afterwards.Pcr program: 95 DEG C of denaturations 5min, 95 DEG C of degeneration 45sec, 50 DEG C of annealing 45sec, 72 DEG C of extensions 30sec, last 72 DEG C of extension 10min, cycle-index is set to 30 times.

After pcr terminates, take 5 μ l point samples respectively, using trans 2k plus marker (Beijing Quan Shi King Company).1% After electrophoresis (120v, 30min) in agarose gel, dyeing 10min in eb (ethidium bromide, ethidium bromide), it After be placed under uvp gel imaging system (alpha innotech company) observe.If expanded successfully, adopt pcr product purification Test kit (Shanghai SBS Genetech company) purification.Purification step is: draw 0.4ml Purification Resin (using front abundant mixing) load from In heart purification column, it is then respectively adding 100 μ l pcr reactant liquors, overturns and mix and stand 5min, 12000r/min is centrifuged 30s, Outwell the waste liquid in collecting pipe.Add 500 μ l 80% ethanol suspension, 12000r/min is centrifuged 30s, outwells in collecting pipe Waste liquid.Repeat and drill work once, 12000r/min is centrifuged 2min, now don't fail to eliminate ethanol.Afterwards by centrifugal purification Post is nested in a clean 1.5ml centrifuge tube, adds 20 μ l te buffer of preheating (to note being sure to on Purification Resin Tube hub to be added in is it is impossible to be bonded on tube wall).Place 2min, 12000r/min is centrifuged 30s.Liquid in centrifuge tube is pure Dna fragment sboa-f changed and sboa-r.Finally, by the method for cross-over pcr, sboa-f and sboa-r is connected Together.Configuration pcr system: 5 μ l 10 × pcr buffer, 1 μ l dntps, forward primer and each 1 μ l of reverse primer, 2 μ l Dna template, 0.5 μ l taq dna polymerase, finally mend distilled water to 50 μ l.Pcr program: 95 DEG C of denaturations 5min, 95 DEG C of changes Property 45sec, 50 DEG C of annealing 45sec, 72 DEG C of extension 60sec, last 72 DEG C of extension 10min, cycle-index is set to 30 times.Pcr is complete Cheng Hou, after 1% agarose gel electrophoresiies detection, purification pcr product.Then configure linked system: add 7 μ l purification good Dna fragment, 1 μ l pgem-t carrier (purchased from promega company of the U.S.) connects, 1 μ l 10 × dna ligase buffer and 1 μ L dna ligase, is incubated 5h at room temperature.

After question response terminates, 10 μ l connection products are mixed homogeneously with e.coli dh5 α competent cell, places on ice 30min, after 42 DEG C of water-bath heat shock 45s, places 5min, (formula is shown in attached to add the lb culture medium of 500ml pre-cooling immediately on ice Record) recovery culture 1h in 37 DEG C of shaking tables, take 100 μ l to be coated in afterwards and be added with ampicillin (amp), isopropylthio gala On the lb solid plate of glucosides (iptg) and the bromo- 4- of 5- chloro- 3- indole-beta-d-galactopyranoside glycosides (x-gal), 37 DEG C of overnight incubation. After growing bacterium colony, with toothpick picking white colony, put into added with 50 μ l ddh₂In the 1.5ml centrifuge tube of o, eluting is simultaneously broken up Thalline, places 5min, repeat the above steps immediately on ice, takes after last 12000r/min centrifugation 5min after 100 DEG C of heat shock 5min Supernatant carries out pcr (system and program are ibid) as dna template.After the completion of pcr, positive colony is served the raw work biotechnology in sea Company is sequenced.Sequencing result is compared with antimony lysyloxidase gene sboa.If correct, extracting respectively comprises purpose fragment Pgem-t carrier and the pjq200sk carrier knocking out plasmid.Then 50 μ l enzyme action systems: 36 μ l dna are configured, 10 μ l 10 × Tango buffer, 2 μ l bamhi and 2 μ l xbai, 37 DEG C of enzyme action are overnight.

Reclaim digestion products using purification QIAquick Gel Extraction Kit purification.Through 1% agarose gel electrophoresiies detection level.Then join Put linked system: add the good dna fragment of 5 μ l purification, (Montana, United States found university's timothy to 3 μ l plasmid pjq200sk McDermott professor (timothy r.mcdermott) give), 1 μ l 10 × dna ligase buffer and 1 μ l dna ligase.Subsequently, react 5h at room temperature.The product connecting is mixed homogeneously with e.coli dh5 α competent cell, on ice Place 30min, after 42 DEG C of water-bath heat shock 45s, place 5min on ice immediately, the lb culture medium adding 500ml pre-cooling is at 37 DEG C In shaking table, recovery culture 1h, takes 100 μ l to be coated on the lb solid plate being added with gentamycin (gm) afterwards, cultivated at 37 DEG C Night.Carry out pcr detection (method is ibid) afterwards, positive colony is carried out preservation of ruling.

2nd, double parents

Picking F-strain Agrobacterium tumefaciems gw4 (amp^r, ampicillin) and (gm of pjq200sk containing donor plasmid^r, celebrating Big mycin) F+strain e.coli s17-1 monoclonal activated.When bacterium solution od₆₀₀When value reaches 0.5-0.6, in 6000rpm centrifugation 5min collects 1.5-3ml thalline.Collect the thalline obtaining and utilize 1ml ddh₂O or normal saline are resuspended, 6000rpm is centrifuged 5min collects thalline again, repeated washing 2 times.The last time in washing process, by donor bacterium e.coli S17-1 and recipient bacterium Agrobacterium tumefaciems gw4 is combined into a pipe, using 100 μ l ddh₂O or normal saline resuspended after, Deca paving On the filter paper of lb flat board, dry up latter 28 DEG C and be inverted culture 3-5d.

After Mycoderma is evident that on filter paper, use 5ml ddh₂Bacterium is washed down and makes bacterium and hang by o or normal saline Liquid, then carry out gradient dilution.100 μ l dilution factors are respectively taken to be 10^-4、10^-5With 10^-6Bacteria suspension, be spread evenly across containing 100 μ g/ In the solid cdm culture medium of ml amp and 50 μ g/ml gm.The donor bacterium (ibid) and the recipient bacterium that are respectively coated debita spissitudo are (same On) suspension makees negative control, is inverted culture 48h in 28 DEG C.After clone is grown on resistant panel, picked clones, carry out resistance Verify (according to a conventional method) with pcr, determine the accuracy of insertion.

3rd, sucrose screening experiment

By in this experiment of parents obtain muton add gm resistance lb culture medium in concussion and cultivate.Work as od₆₀₀Reach During 0.5-0.6,100 μ l bacterium solution are coated on after 28 DEG C of inversion culture 3-5d on the cdm flat board containing 20-25% sucrose, picking Clone carries out resistance checking.The clone's profit that can grow but can not grow in gm resistant panel is chosen on amp resistant panel Expanded respectively with primer pmsboa-1f/pmsboa-1r and pmsboa-2f/pmsboa-2r, using the dna of wild type gw4 as right According to；If just differ the length and with internal gene no of sboa gene with external primers amplified fragments and wild-type fragment size Method amplifies sboa genetic fragment, then the bacterial strain obtaining is judged to mutant gw4- δ sboa.In the result display gw4 of Fig. 3 The success of sboa gene knockout.

4th, complementation test and overexpression experiment

Carry out pcr amplification using primer csboa-f and csboa-f-r with psti and bamhi restriction enzyme site to obtain The complete sequence of sboa gene, then uses restricted enzyme psti and bamhi to amplified production after purification and carrier Pcpp30 (Montana, United States found university's timothy McDermott professor (timothy r.mcdermott) and give) is carried out Double digestion.Digestion products are carried out purification, and configures the linked system of 10 μ l.Connect 5h at room temperature, then pass through heat shock method The complementing vector building pcpp30-sboa is transformed in e.coli s17-l competent cell.Will by double parents Carrier pcpp30-sboa is transformed in gw4- δ sboa, recycles tc and amp antibiotic and pcr to be screened, and obtains complementary Strain gw4- δ sboa-c, the complementary strain of Fig. 3 pcr result display successfully constructs.The complementing vector building is proceeded to wild type gw4 In obtain exceeded reach a plant gw4::sboa, extract plasmid, whether contain this matter using in psti and bamhi double digestion checking gw4 Grain.

Embodiment 2: wild strain gw4, sboa mutant (gw4- δ sboa), sboa complementation strain (gw4- δ sboa-c) and The growth of sboa overexpression strain (gw4::sboa) and antimony oxidation experiment

Picking wild type gw4, sboa mutant gw4- δ sboa, sboa complementation strain gw4- δ sboa-c and overexpression strain The monoclonal of gw4::sboa, is inoculated in 5ml cdm culture medium, 28 DEG C of shaking table shaken cultivation 24h respectively.Take its fresh bacterium solution Each 100 μ l are inoculated in the 100ml cdm culture medium containing 10 μm of ol/l sb (iii) and 50 μm of ol/l sb (iii) respectively.28 DEG C shaking table shaken cultivation, to be not added with the condition of sb (iii) as comparison.

According to strain growth situation, take a sample every 8h, for measuring od₆₀₀(light absorption value at 600nm wavelength, Du800 type spectrophotometer) and culture medium in different shape antimony content.Using high performance liquid chromatography-hydride generation-atom Fluorescence spectrophotometer (hplc-hg-afs) measures antimony content in culture medium.Stop sampling after thalline reaches stable phase.By each Stage samples the od of gained₆₀₀It is depicted as curve chart (see Fig. 4) with different valence state antimony content data in culture medium, carry out contrast and see Examine analysis.

Fig. 4 result shows: knock out the sboa mutant gw4- δ sboa of sboa gene, antimony oxidation rate reduces 27%, And the antimony oxidation phenotype of sboa complementation strain gw4- δ sboa-c is replied, and the antimony of overexpression bacterial strain gw4::sboa oxidation speed Rate improves 34%, illustrates that sboa gene have impact on sb (iii) the oxidation phenotype of bacterial strain really.

Embodiment 3:sboa overexpression and antimony oxidation identification in escherichia coli e.coli s17-1

In the e.coli s17-1 that complementing vector pcpp30-sboa in embodiment 1 is proceeded to without sboa gene so as to Heterogenous expression in e.coli.With the e.coli s17-1 (pcpp30) that wild type e.coli s17-1 is unloaded with proceeding to pcpp30 As comparison, detect its sb (iii) oxidation phenotype.

By the bacterial strain having activated s17-1 (pcpp30-sboa), s17-1 (pcpp30) and s17-1 is inoculated in lb culture medium It is enlarged cultivating, then low-speed centrifugal (5000rpm) collects thalline wash 2 times with 50mm tris-hcl (ph=8.0).So Being inoculated in afterwards in the cdm culture medium containing 0.02% yeast powder and 10 μ μ sb (iii) and adjusting biomass makes initial od₆₀₀Reach 0.5 about.It is placed in 37 DEG C of shaking tables to be cultivated.Od is measured by sampling respectively at 0.5h, 1h, 1.5h and 2h₆₀₀And different shape antimony contains Amount.

The external oxidation experiment to sb (iii) for embodiment 4:sboa

Expand the full length gene of sboa, institute using high-fidelity enzyme fast pfu dna polymerase (transgen) pcr It is esboa-f/esboa-r with primer.Purification reclaim pcr product, with extracting pet28a (+) carrier (German novagen company Give) overnight using 37 DEG C of double digestions of ecori-hindiii simultaneously, then by digestion products purification, by expression vector after connection Proceed in e.coli efficient expression strain bl21startm (de3) plyss competence, select positive colony, finally give sboa Expression strain e.coli bl21 (pet28a-sboa).This expression strain is seeded to the lb that 5ml contains 100 μ g/ml kan In culture medium, 37 DEG C of incubated overnight.The bacterium solution of 1ml incubated overnight is inoculated into the lb culture that 100ml contains 100 μ g/ml kan In base, cultivate 2-3h to od₆₀₀When reaching 0.3-0.4, add the iptg of final concentration 0.2mm, 28 DEG C of induction 2h.

Cultured thalline is used 8000r/min, 4 DEG C of centrifugations are all collected, with the 50mm containing 300 μm of nacl After tris-hcl (ph=8.0) washs 3 times, finally contain above-mentioned buffer with 10ml resuspended, and fully break up.Cell is on ice Through 30% ultrasonic disruption to after clarify, 12000r/min, 4 DEG C of centrifugation 10min.Take the miaow that supernatant adds final concentration of 20mm Azoles, profinitytm imac resins (bio-rad) pretreated with 1ml mixes, and 4 DEG C of vertical shaking table combines 2h, So that being fully combined with resin containing histidine-tagged solvable destination protein.Then resin is transferred to protein mixture In the protein purification pipe of 10ml, first delay eluting foreign protein for several times with the imidazoles 50mm tris-hcl (ph 8.0) containing 20mm.Again Successively with 40,60,100,200,300,400, the imidazoles wash-out protein of 500mm.The albumen being finally purified uses 10% Sds-page detects (liu gh, liu my, kim eh et al.a periplasmic arsenite-binding protein involved in regulating arsenite oxidation.environ microbiol,2012,14 (7): 1624-1634), with conventional Coomassie brilliant blue r250 dyeing, and observed result.The albumen being purified adds 10% Glycerol is stored in -80 DEG C of refrigerators.

Bacterial strain gw4- δ sboa is inoculated in the 50ml cdm culture medium containing 10 μm of sb (iii), after 28 DEG C of culture 24h Collect whole thalline.After being washed 3 times and be resuspended with 50mm tris-hcl (ph=8.0), as sonicated cells on ice, 12000r/min is centrifuged, and takes supernatant as the buffer system containing required electron acceptor in sb (iii) oxidizing process.Again to this 1 μm of sb (iii), 200 μm of coenzyme nadp are added in system⁺, and the sboa albumen of variable concentrations, finally use 50mm tris-hcl (ph=8.0) by system polishing to 5ml, and it is incubated 0.5h at 28 DEG C.To be not added with the system of coenzyme as comparison, by efficient liquid Phase chromatograph-hydride generation-atomic fluorescence spectrometric instrument (hplc-hg-afs) detects the sboa oxidation sb of variable concentrations gradient respectively (iii) content.

Annex

(1) lb culture medium prescription (1l)

Tryptone 10g

Yeast extract 5g

nacl 10g

Use 10m naoh to adjust ph to 7.0 after dissolving, add ddh₂O is settled to 1l, high temperature sterilize.

(2) cdm culture medium prescription

Solution a (1l):

ddh₂O is settled to 1l, high temperature sterilize.

Solution b (1l):

feso₄·7h₂o 1.33g

ddh₂O is settled to 1l, filtration sterilization.

Solution c (1l):

nahco₃79.8g

ddh₂O is settled to 1l, filtration sterilization.

Prepare 1l cdm culture medium: add 100ml solution a, 2.5ml solution b, 10ml solution in 887.5ml sterilized water C, adjusts ph to 7.0.

Claims (2)

1. application in oxidation environment antimony pollution for the antimony lysyloxidase gene sboa shown in sequence table seq id no:1.

2. the antimony lysyloxidase gene sboa shown in sequence table seq id no:1 as claimed in claim 1 is dirty in oxidation environment antimony Application in dye is it is characterised in that described antimony is trivalent antimony.