CN104293939B - A kind of SNP site relevant to Wheat Seedling Low phosphorus tolerance and application thereof - Google Patents
A kind of SNP site relevant to Wheat Seedling Low phosphorus tolerance and application thereof Download PDFInfo
- Publication number
- CN104293939B CN104293939B CN201410520103.0A CN201410520103A CN104293939B CN 104293939 B CN104293939 B CN 104293939B CN 201410520103 A CN201410520103 A CN 201410520103A CN 104293939 B CN104293939 B CN 104293939B
- Authority
- CN
- China
- Prior art keywords
- sequence
- wheat
- gene
- low phosphorus
- karyomit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of SNP site relevant to Wheat Seedling Low phosphorus tolerance and application thereof.This SNP site be in sequence 4 from 5 ' end the 56th Nucleotide, this 56bp position Nucleotide is A and/or G; SEQ? ID? the 132.6cM position of DNA fragmentation shown in No.4 on chromosome of wheat 1BL.Present invention also offers the SNP site of the strong wheat breed of the assisting sifting Low phosphorus tolerance in a new Low phosphorus tolerance major gene loci QPt.caas-1B and this site.Utilize this site can screen the strong wheat of Low phosphorus tolerance, play a significant role in wheat breeding.
Description
Technical field
The invention belongs to biological technical field, particularly relate to a kind of SNP site relevant to Wheat Seedling Low phosphorus tolerance and application thereof.
Background technology
Cultivate the new variety that high-yield and high-efficiency is extensively fitted, not only need excellent economical character, and need higher fertilizer utilization efficiency.Phosphorus is one of required important element in crop growth process, but phosphorus is easily by soil fixing, and in wheat, this season utilization ratio only has 10-20%, is starkly lower than paddy rice and corn (Lu etc., 2004).Although increase Phosphorus fertilizer usage effectively can improve crop yield, because of the restriction of kind fertilizer utilization efficiency, cause excessive applying fertilizer to produce unnecessary waste, not only add the fixing phosphate fertilizer of production cost non-assimilation simultaneously but also exacerbate environmental pollution.Population and environmental stress bring great challenge to China's agriculture production, explore innovation, effective plant nutrition scheme, improve the fertilizer utilization efficiency of new variety further, significant to raising Wheat Production efficiency.
Because phosphate fertilizer has vital role in production estimation, utilizing genetic and breeding method to cultivate high, that adaptability the is wider new variety of phosphorus use efficiency is important breeding objectives.Although known portions Gene Handling phosphorus use efficiency, if PHR1 is plant phosphorus stress response gene, the expression of appropriate rise TaPHR1 can promote that growth of wheat roots is grown, strengthen the expression of phosphorus absorption and induced transport genes involved, and then improve the phosphorus nutrition of plant, increase tiller number, grain number per spike, improve output (Wang Jing, 2011), translocator PHT1.2 gene family can improve (the Wang etc. such as the assimilated efficiency of phosphorus,, but the major gene that really can be used in agriculture production is little 2013).Molecular Marker Assisted Selection Technology can follow the tracks of transformation or polymerization excellent genes, for cultivating that high yield is extensively suitable and the new variety of wheat of liquid manure efficiency utilization provides effective technique means.And excavation controls phosphorus use efficiency genes involved and genetic marker is the prerequisite of carrying out molecular mark.Because the research such as phosphorus forms and transport factor is more complicated, the Position Research of vegetable fertilizer utilising efficiency genes involved is started late, existing QTL Position Research focuses mostly on yield traits under different fertilizer process and corresponding fertilizer utilization efficiency (Gallais etc., 2004; Loudet etc., 2003; Li etc., 2005).At present, the wheat phosphorus use efficiency reported QTL site of being correlated with mainly is distributed on the karyomit(e)s such as 1A, 2B, 2D, 3A, 3B, 4B, 5A, 5B, 5D, 6A, 6B and 7A, part QTL site and the chain formation compact district of other economical character genes involved, as being positioned at site on 5A and 5D karyomit(e) and vernalization gene VRN-A1 and VRN-D1 chain (Su etc., 2006; 2009).In paddy rice, although the QTL site relevant to phosphate use found is more, only have Pup1 site under different genetic background, show stable (Chin etc. 2011; Vinod etc., 2012).Although nitrogen, phosphorus use efficiency are correlated with, QTL Position Research obtains greater advance, but known control nitrogen, phosphorus use efficiency main effect QTL site are little, specify plant to nutrition absorption, utilization ways, excavate effect gene in respective process and develop the emphasis that molecule marker is still research.
Capital 411 was once the main breed of the nineties in last century, one of Ye Shi Northern Winter district backbone parent; The first kind in middle wheat 175 Shi Benmai district and district's examination check variety, have extremely strong resistance to low fertilizer and Drought resistance, at the Yellow River and Huai He River drought fertile ground spread; Beijing 0045 is the first kind of Northern Hebei Province in 2008-10, still establishing in large scale so far; Middle wheat 415, middle wheat 816 and Xin Dong 37 are in authorizing respectively by country and Xinjiang in recent years.Solution culture method method has been widely used in research (Su etc., 2006 of crops seedling stage cultivation and the proterties such as Root Characteristics, fertilizer susceptibility; Xiao Yonggui etc., 2014).Phosphate fertilizer is particularly important in crops seedling stage role, can promote to tiller ahead of time.The research such as Peng is thought, accumulates the maximum rice varieties fertilizer utilization efficiency of nitrogen the highest (Peng etc., 1994) after rice transplanting in 35 days.Under controlled nutritional condition, by the process of different concns phosphorus, analyze different genotype fertilizer utilization efficiency in seedling stage and correlated character, and utilize the phosphorus use efficiency correlated inheritance section that full-length genome SNP marker analysis selected materials carries, resolve the reason of its difference between different genotype, can for cultivating the kind based theoretical that extensively fit of high-yield and high-efficiency and providing molecule assisted Selection means.
Summary of the invention
An object of the present invention is to provide a kind of method of assistant identification wheat Low phosphorus tolerance.
Method provided by the invention, be the 56th deoxyribonucleotide of the gene of the 1B karyomit(e) 132.6cM position detecting wheat to be measured be A or G or A and G, AA or AG or GG with the genotype of the gene determining wheat 1B karyomit(e) 132.6cM position to be measured, the genotype determination Low phosphorus tolerance according to described wheat to be measured: the Low phosphorus tolerance of the genotypic wheat to be measured of GG higher than or candidate higher than the genotypic wheat to be measured of AG or AA; Described GG genotype is the 56th deoxyribonucleotide of the gene of 1B karyomit(e) 132.6cM position is the homozygote of G, described AG because of the 56th deoxyribonucleotide of the gene of type 1B karyomit(e) 132.6cM position be the heterozygote for A and G, the 56th deoxyribonucleotide that described AA is the gene of 1B karyomit(e) 132.6cM position because of type is the homozygote of A.
In aforesaid method, the 56th deoxyribonucleotide of the gene of the 1B karyomit(e) 132.6cM position of described detection wheat to be measured is that A or G or A and G comprise pcr amplification and carry out gene type to pcr amplification product and identify two steps;
Described pcr amplification primer pair used meets following condition: with the genomic dna of described wheat to be measured for product that template carries out pcr amplification contains the 56th deoxyribonucleotide of the gene of 1B karyomit(e) 132.6cM position.
In aforesaid method, the primer sets that described pcr amplification primer used is made up of the single strand dna shown in sequence 3 in the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1, sequence table and sequence table;
5 ' end of the single strand dna shown in described sequence 1 adds specific fluorescence sequence FAM;
5 ' end of the single strand dna shown in described sequence 2 adds specific fluorescence sequence HEX;
Described gene type qualification adopts fluorescence microplate reader;
In described Tolerant to low P, the final concentration of phosphorus is 0.25mmol/L;
The nucleotides sequence of the gene of described 1B karyomit(e) 132.6cM position is classified as sequence 4 in sequence table.
Another object of the present invention is to provide a kind of reagent of Low phosphorus tolerance of assistant identification wheat.
Reagent provided by the invention is the 56th deoxyribonucleotide of the gene of the 1B karyomit(e) 132.6cM position of wheat to be measured is the material of A or G or A and G.
In mentioned reagent, the primer sets of described material for being made up of the single strand dna shown in sequence 3 in the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1, sequence table and sequence table;
Single strand dna shown in above-mentioned sequence 1 and the single strand dna shown in sequence 3 are different fluorescent mark, and 5 ' end of the single strand dna shown in described sequence 1 specifically adds specific fluorescence sequence FAM; 5 ' end of the single strand dna shown in described sequence 2 specifically adds specific fluorescence sequence HEX.
Banding pattern can be judged according to fluorescence color, single strand dna shown in above-mentioned sequence 1 and the single strand dna shown in sequence 3 combine and increase, amplification SNP site genotype is the fragment of G:G, carries the product after the sequence pcr amplification of FAM and irradiates display redness through fluorescence;
Single strand dna shown in above-mentioned sequence 2 and the single strand dna shown in sequence 3 combine and increase, and amplification SNP site genotype is the fragment of A:A, carry the product after the sequence pcr amplification of HEX and irradiate display blueness through fluorescence.
The present invention's the 3rd object is to provide the test kit of the Low phosphorus tolerance of assistant identification wheat.
Test kit provided by the invention, containing above-mentioned reagent.
Above-mentioned reagent or above-mentioned test kit are also the scope of protection of the invention in the application of auxiliary detection wheat Low phosphorus tolerance;
Or the application in preparation auxiliary detection wheat Low phosphorus tolerance product of above-mentioned reagent or above-mentioned test kit is also the scope of protection of the invention.
The application in seed selection Tolerant to low P wheat of above-mentioned method, reagent or test kit is also the scope of protection of the invention.
The present invention's the 4th object is to provide a kind of SNP site relevant to wheat Low phosphorus tolerance.
The SNP site relevant to wheat Low phosphorus tolerance provided by the invention, this site is the 56th deoxyribonucleotide of the gene of the 1B karyomit(e) 132.6cM position of wheat, and this 56bp position Nucleotide is A and/or G; The nucleotides sequence of the gene of the 1B karyomit(e) 132.6cM position of wheat is classified as sequence 4 in sequence table.
The present invention's the 5th object is to provide a kind of DNA fragmentation containing SNP site relevant to wheat Low phosphorus tolerance.
The DNA fragmentation containing SNP site relevant to wheat Low phosphorus tolerance provided by the invention, its nucleotides sequence is classified as sequence 4 in sequence table, and wherein, this sequence 56bp place base is A and/or G; And the 132.6cM position of this DNA fragmentation on wheat 1B karyomit(e).
In above-mentioned application, described wheat specifically can be any one or several in following kind: capital winter 17, tobacco grower 19, section lose 5214, middle wheat 895, middle wheat 875, Jimai 22, Jimai 23, Jimai 24, mountain agriculture 715, stone wheat 15, stone wheat 19, Shi You 20, weighing apparatus sight 35, good star 99, Zheng wheat 0943, all wheats 16, all wheats 18, all wheats 22, Luohan No.2, shortly anti-ly 58, little lay down 101, Wheatear.
Experiment of the present invention proves, the invention provides the SNP site that a new Low phosphorus tolerance gene locus QPt.caas-1B and assisting sifting have the wheat breed of stronger Low phosphorus tolerance.Utilize this SNP site can screen the excellent wheat of Low phosphorus tolerance, to cultivation heavy duty detergent wheat breed, there is vital role.
Accompanying drawing explanation
Fig. 1 is middle wheat 175 (left side) and capital winter 17 (right side) growing way figure under 3 phosphorus concentrations
Fig. 2 is Low phosphorus tolerance related SNP mark and QPt.caas-1B linkage map
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
The acquisition of embodiment 1, the SNP site relevant to wheat Low phosphorus tolerance
Select winter wheat backbone parent capital 411 and 14 derived varietiess (being) thereof, comprise a derivative generation 6 parts, derivative two generation 8 parts.
1, Wheat Seedling is cultivated and Low phosphorus tolerance investigation
Adopt Solution culture method method, 3 KH are set
2pO
4concentration nutritive medium: 0,0.005,0.25 (mmol/L) KH
2pO
4.Basic nutrient solution is: K
2sO
40.75, KCl0.1, MgSO
40.6, FeEDTA4.0 × 10
-2, H
3bO
31.0 × 10
-3, MnSO
41.0 × 10
-3, ZnSO
41.0 × 10
-3, CuSO
41.0 × 10
-4, (Na)
6mo
2o
45.0 × 10
-6, Ca (NO
3)
22.0.Do not execute with low-phosphorous process in KCl, K+ is added to 0.25mmol/L par, concrete formula is as follows:
0mmol/LKH
2pO
4nutritive medium (mmol/L): except basic nutrient solution, supplements 0.25mmol/LKCl, composition 0mmol/LKH
2pO
4nutritive medium;
0.005mmol/LKH
2pO
4nutritive medium: by basic nutrient solution and 0.005mmol/LKH
2pO
4mixing, separately supplements 0.245mmol/LKCl, composition 0.005mmol/LKH
2pO
4nutritive medium;
0.25mmol/LKH
2pO
4nutritive medium: by basic nutrient solution and 0.25mmol/LKH
2pO
4mixing, composition 0.25mmol/LKH
2pO
4nutritive medium.
Treatment process: every kind selected seed 50, with the H of 10%
2o
2process 20-30 minute, aseptic water washing 5-6 time.Choose seed full and of the same size and be placed in the culture dish being covered with filter paper, in the vernalization of incubator darkroom.After seed shows money or valuables one carries unintentionally, transplant and cultivate one week to quartz sand.Select the uniform seedling replanting of growing way to having containing different concns KH
2pO
4in the cultivation box of nutritive medium.Within every 3 days, change one time of nutrition liquid, cultured continuously was gathered in the crops after 20 days.Measure overground part dry weight SDW under each process
0(0mmol/LKH
2pO
4), SDW
1(0.005mmol/LKH
2pO
4), SDW
2(0.25mmol/LKH
2pO
4), calculate do not execute phosphorus and low-phosphorous under Low phosphorus tolerance (Abilityoftolerancetolowphosphorus, ATP), calculation formula is as follows:
ATP
0＝(SDW
0/SDW
2)×100；ATP
1＝(SDW
1/SDW
2)×100。
ATP
0and ATP
1be respectively do not execute phosphorus and low-phosphorous under Low phosphorus tolerance.
2, primer obtains and SNP site analysis
SNP (single nucleotide polymorphism) is marked at Boao Biological Co., Ltd (CapitalBioCorporation, Beijing, China; Http:// bioservices.capitalbio.com) utilize IlluminaSNP genotype tests, be mainly divided into following steps: 1) wheat breed genomic dna to be measured is carried out whole genome amplification; 2) random endonuclease digestion disconnectedization of amplified production; 3) DNA fragmentation and chip are hybridized, the microballon of chip is connected with 50-mers length specificity capture probe, gDNA enzyme is cut after product and is combined with probes complementary sequence; 4) that do not hybridize or on mismatch hybridization DNA fragmentation is removed in cleaning; 5) nucleotides substrate (A/T and C/G) that dinitrophenol (dinitrophenol) and vitamin H (biotin) mark carries out single-basic extension on capture probe, only has the complementary probe combined occurs with gDNA just to be extended; By dyeing, A/T and C/G will mark different fluorescence dyes respectively; 6) chip scanning, and utilize software according to two kinds of fluorescence interpretations and export genotyping result.
IlluminaSNP gene type research platform is utilized to carry out 90kSNP chip somatotype to capital 411 and derived varieties (being) DNA thereof, comprise the series of markings such as BS, BobWhite, CAP, D_contig, amount to 81587, wherein there are differences in 24080 SNP marker 411 Derived Populations in Beijing.
3, the discovery of associated gene location and linked marker
SAS9.2 software (SASInstitute.2000) is utilized to carry out basic statistics amount, multiple comparison analyse, and in conjunction with the Glmselect program of SAS, successive Regression is carried out to SNP data and root traits, judge association site according to P value (P<0.01).Orient the SNP marker BS00015519_51 controlling wheat Low phosphorus tolerance to associate (P<0.001) with gene Qpue.caas-1B.
4, the allele specific Marker Identification in BS00015519_51 site
Extract the complete genome DNA of capital 411 and 14 derived varietiess respectively.With each genomic dna for template, carry out genotype tests by the allele specific marker combination in the SNP marker BS00015519_51 site of wheat Low phosphorus tolerance, occur that the fragment of G:G somatotype then illustrates that this mark effectively can identify wheat breed Low phosphorus tolerance gene.
Table 1 is the separation in Low phosphorus tolerance mark allelic variation 411 Derived Populations in Beijing
Result is as table 1, can find out, the genotype in BS00015519_51 site (in sequence 4 from 5 ' end the 56th Nucleotide) is the wheat breed Low phosphorus tolerance of G:G is the wheat breed of A:A or G:A higher than the genotype in BS00015519_51 site, therefore, this site can be used for judging wheat Low phosphorus tolerance height.
According to the wheat molecular marker collection of illustrative plates that (2011) such as WheatDArTmapsVersion1.2 (http://www.triticarte.com.au) and Allen announce, mark BS00015519_51 is incorporated on wheat genetic collection of illustrative plates, result as shown in Figure 2, determines the 132.6cM position of QPt.caas-1B on karyomit(e) 1B.
The design of the primer pair of the SNP site that 5, increases
According to the nucleotide sequence (sequence 4) of the gene of the 132.6cM position on the SNP site designation of chromosome 1B of BS00015519_51, be designed for the primer of this SNP site of amplification, totally 3:
Sequence 1:5 ' caattcaactggccagccatcg3 '
Sequence 2:5 ' gcaattcaactggccagccatca3 '
Sequence 3:5 ' cgctcaacagagtcacttttggaaccaa3 '
Shown in sequence 1,5 ' end of primer adds specific fluorescence sequence FAM (5 ' GAAGGTGACCAAGTTCATGCT3 '), and shown in sequence 2,5 ' end of primer adds specific fluorescence sequence HEX (5 ' GAAGGTCGGAGTCAACGGATT3 ').
The application of embodiment 2, SNP site
Select 22 non-capital 411 offsprings as test kind, using middle wheat 175 as Low phosphorus tolerance check variety (Fig. 1).Test kind is the capital winter 17 respectively, tobacco grower 19, section lose 5214, middle wheat 895, middle wheat 875, Jimai 22, Jimai 23, Jimai 24, mountain agriculture 715, stone wheat 15, stone wheat 19, Shi You 20, weighing apparatus sight 35, good star 99, Zheng wheat 0943, all wheats 16, all wheats 18, all wheats 22, Luohan No.2, shortly anti-ly 58, little lay down 101, Wheatear.
1, the Wheat Seedling Low phosphorus tolerance of different varieties is detected
The Low phosphorus tolerance in seedling stage of kind detects and carries out in crop science institute of the Chinese Academy of Agricultural Sciences greenhouse.Adopt Solution culture method method, 3 KH are set
2pO
4concentration nutritive medium: 0,0.005,0.25 (mmol/L) KH
2pO
4.Basic nutrient solution is: K
2sO
40.75, KCl0.1, MgSO
40.6, FeEDTA4.0 × 10
-2, H
3bO
31.0 × 10
-3, MnSO
41.0 × 10
-3, ZnSO41.0 × 10
-3, CuSO
41.0 × 10
-4, (Na)
6mo
2o
45.0 × 10
-6, Ca (NO
3)
22.0.Do not execute with low-phosphorous process in KCl, K+ is added to 0.25mmol/L par, concrete formula is as follows:
0mmol/LKH
2pO
4nutritive medium (mmol/L): except basic nutrient solution, supplements 0.25mmol/LKCl, composition 0mmol/LKH
2pO
4nutritive medium;
0.005mmol/LKH
2pO
4nutritive medium: by basic nutrient solution and 0.005mmol/LKH
2pO
4mixing, separately supplements 0.245mmol/LKCl, composition 0.005mmol/LKH
2pO
4nutritive medium;
0.25mmol/LKH
2pO
4nutritive medium: by basic nutrient solution and 0.25mmol/LKH
2pO
4mixing, composition 0.25mmol/LKH
2pO
4nutritive medium.
Treatment process: every kind selected seed 50, with the H of 10%
2o
2process 20-30 minute, aseptic water washing 5-6 time.Choose seed full and of the same size and be placed in the culture dish being covered with filter paper, in the vernalization of incubator darkroom.After seed shows money or valuables one carries unintentionally, transplant and cultivate one week to quartz sand.Select the uniform seedling replanting of growing way to having containing different concns KH
2pO
4in the cultivation box of nutritive medium.Within every 3 days, change one time of nutrition liquid, cultured continuously was gathered in the crops after 20 days.Measure overground part dry weight SDW under each process
0(0mmol/LKH
2pO
4), SDW
1(0.005mmol/LKH
2pO
4), SDW
2(0.25mmol/LKH
2pO
4), calculate do not execute phosphorus and low-phosphorous under Low phosphorus tolerance (Abilityoftolerancetolowphosphorus, ATP), calculation formula is as follows:
ATP
0＝(SDW
0/SDW
2)×100；ATP
1＝(SDW
1/SDW
2)×100。
ATP
0and ATP
1be respectively do not execute phosphorus and low-phosphorous under Low phosphorus tolerance.
The results are shown in Table shown in 2.
2, the genotype of the SNP site of different varieties wheat is detected
Extract the genomic dna of each product grow wheat respectively, take genomic dna as template, shown in sequence 1,5 ' end of primer adds specific fluorescence sequence FAM (5 ' GAAGGTGACCAAGTTCATGCT3 '), and shown in sequence 2,5 ' end of primer adds specific fluorescence sequence HEX (5 ' GAAGGTCGGAGTCAACGGATT3 ').Carry the product after the sequence pcr amplification of FAM and irradiate display redness through fluorescence, and it is blue through fluorescence irradiation display to carry the product after the sequence pcr amplification of HEX.
Sequence 1 and sequence 3 are combined, sequence 2 and sequence 3 combine, and carry out pcr amplification respectively with these two groups of primers to same material DNA.Sequence 1 and sequence 3 combine the fragment that the SNP site genotype that can increase is G:G, and sequence 2 and sequence 3 combine the fragment that the SNP site genotype that can increase is A:A.
PCR amplification system is as follows: 12 μ LPCR reaction systems comprise: in Specific primer pair, every bar primer final concentration is 0.25uM, and final concentration is 1mmolL
-1tris-HCl (pH9.0), final concentration is 5mmolL
-1kCl, final concentration is 2.5mmolL
-1mgCl
2(Promega company), final concentration is 200 μm of olL
-1dNTPs (TaKaRa company), Taq DNA polymerase 1.5U (Tiangen company), template DNA 15ng.
Pcr amplification reaction carries out on PTC-200PCR amplification instrument, and amplification program is: 94 DEG C of denaturation 3min; 94 DEG C of sex change 20s, 50 DEG C of annealing 30s, 72 DEG C extend 15s, 35 circulations; 72 DEG C extend 4min; 10 DEG C of preservations.
The pcr amplification product obtained is irradiated with fluorescence on fluorescence microplate reader and carries out gene type, then at KlusterCaller
tMsoftware reads the data after somatotype, only show blue image and then illustrate that the 56bp place SNP site of the gene of wheat 1B karyomit(e) 132.6cM position to be measured is A, genotype is A:A (pcr amplification product is sent to order-checking, and sequence is sequence 4 in sequence table, and 56bp place base is A); Only show red image and then illustrate that SNP site base is G, genotype is G:G (pcr amplification product is sent to order-checking, and sequence is sequence 4 in sequence table, and 56bp place base is G); Display redness and blue image then illustrate that SNP site base is G/A, and genotype is G:A (pcr amplification product is sent to order-checking, and sequence is sequence 4 in sequence table, and 56bp place base is A/G).
The wheat pcr amplification product of each kind is compared between two,
If the pcr amplification product of A wheat is only display redness, (gene the 56th deoxyribonucleotide of its 1B karyomit(e) 132.6cM position is the homozygote of G, genotype is G:G), the pcr amplification product of B wheat is only show blue or display is red and blue (gene the 56th deoxyribonucleotide of its 1B karyomit(e) 132.6cM position is the homozygote of A, genotype is gene the 56th deoxyribonucleotide of A:A or its 1B karyomit(e) 132.6cM position is G/A heterozygote, genotype is G:A), then the Low phosphorus tolerance of A wheat is higher than B wheat.
Genotype and the wheat Low phosphorus tolerance thereof of each wheat above-mentioned are shown in Table 2.
Table 2 is genotype and the Low phosphorus tolerance result of the SNP site of 22 kinds
Low phosphorus tolerance
Above result shows, the capital winter 17, tobacco grower 19, middle wheat 895, middle wheat 875, Jimai 22, Jimai 23, Jimai 24, mountain agriculture 715, stone wheat 15, stone wheat 19, Shi You 20, weighing apparatus sight 35, all wheats 16, all wheats 18, Luohan No.2, little lay down 101 and Wheatear be G:G in SNP site genotype, show as Low phosphorus tolerance stronger, and section loses 5214, good star 99, Zheng wheat 0943, all wheats 22 and short anti-58 are A:A in SNP site genotype, show as Low phosphorus tolerance more weak.
Said gene type is judged wheat Low phosphorus tolerance and above-mentioned 1 calculates wheat Low phosphorus tolerance result consistent, illustrate that method of the present invention is correct.
The above results shows, above-mentioned SNP site can differentiate whether wheat breed has higher Low phosphorus tolerance seedling stage quickly and efficiently.
Claims (9)
1. the method for an assistant identification wheat Low phosphorus tolerance, be the 56th deoxyribonucleotide of the gene of the 1B karyomit(e) 132.6cM position detecting wheat to be measured be A or G or A and G, AA or AG or GG with the genotype of the gene determining wheat 1B karyomit(e) 132.6cM position to be measured, the genotype determination Low phosphorus tolerance according to described wheat to be measured: the Low phosphorus tolerance of the genotypic wheat to be measured of GG higher than or candidate higher than the genotypic wheat to be measured of AG or AA; Described GG genotype is the 56th deoxyribonucleotide of the gene of 1B karyomit(e) 132.6cM position is the homozygote of G, described AG because of the 56th deoxyribonucleotide of the gene of type 1B karyomit(e) 132.6cM position be the heterozygote for A and G, the 56th deoxyribonucleotide that described AA is the gene of 1B karyomit(e) 132.6cM position because of type is the homozygote of A.
2. method according to claim 1, is characterized in that: the 56th deoxyribonucleotide of the gene of the 1B karyomit(e) 132.6cM position of described detection wheat to be measured is that A or G or A and G comprise pcr amplification and carry out gene type to pcr amplification product and identify two steps;
Described pcr amplification primer pair used meets following condition: with the genomic dna of described wheat to be measured for product that template carries out pcr amplification contains the 56th deoxyribonucleotide of the gene of 1B karyomit(e) 132.6cM position.
3. method according to claim 2, is characterized in that: the primer sets that described pcr amplification primer used is made up of the single strand dna shown in sequence 3 in the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1, sequence table and sequence table;
5 ' end of the single strand dna shown in described sequence 1 adds specific fluorescence sequence FAM;
5 ' end of the single strand dna shown in described sequence 2 adds specific fluorescence sequence HEX;
Described gene type qualification adopts fluorescence microplate reader;
In described Tolerant to low P, the final concentration of phosphorus is 0.25mmol/L;
The nucleotides sequence of the gene of described 1B karyomit(e) 132.6cM position is classified as sequence 4 in sequence table.
4. a reagent for the Low phosphorus tolerance of assistant identification wheat is the 56th deoxyribonucleotide of the gene of the 1B karyomit(e) 132.6cM position detecting wheat to be measured is the material of A or G or A and G.
5. reagent according to claim 4, is characterized in that: the primer sets of described material for being made up of the single strand dna shown in sequence 3 in the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1, sequence table and sequence table;
5 ' end of the single strand dna shown in described sequence 1 specifically adds specific fluorescence sequence FAM;
5 ' end of the single strand dna shown in described sequence 2 specifically adds specific fluorescence sequence HEX.
6. the test kit of the Low phosphorus tolerance of assistant identification wheat, containing the reagent described in claim 4 or 5.
7. the reagent described in claim 4 or 5 or test kit according to claim 6 are in the application of auxiliary detection wheat Low phosphorus tolerance;
Or reagent described in claim 4 or 5 or the application of test kit according to claim 6 in preparation auxiliary detection wheat Low phosphorus tolerance product.
8. the method described in claim 1-3, the reagent described in claim 4-5, the application of test kit according to claim 6 in seed selection Tolerant to low P wheat.
9. a DNA fragmentation containing SNP site relevant to wheat Low phosphorus tolerance, its nucleotides sequence is classified as sequence 4 in sequence table, and wherein, this sequence 56bp place base is A and/or G; And the 132.6cM position of this DNA fragmentation on wheat 1B karyomit(e).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410520103.0A CN104293939B (en) | 2014-09-30 | 2014-09-30 | A kind of SNP site relevant to Wheat Seedling Low phosphorus tolerance and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410520103.0A CN104293939B (en) | 2014-09-30 | 2014-09-30 | A kind of SNP site relevant to Wheat Seedling Low phosphorus tolerance and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293939A CN104293939A (en) | 2015-01-21 |
| CN104293939B true CN104293939B (en) | 2016-03-02 |
Family
ID=52313886
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410520103.0A Expired - Fee Related CN104293939B (en) | 2014-09-30 | 2014-09-30 | A kind of SNP site relevant to Wheat Seedling Low phosphorus tolerance and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104293939B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106577268A (en) * | 2016-11-17 | 2017-04-26 | 甘肃农业大学 | Method for screening variety with high phosphorus utilization efficiency from multiple wheat varieties |
| CN109295179B (en) * | 2018-10-23 | 2022-05-17 | 中国农业科学院作物科学研究所 | Method for screening wheat with different zinc content and iron content and special kit thereof |
| CN113073144B (en) * | 2021-05-18 | 2022-11-18 | 河南农业大学 | Molecular marker CAPS-799 for screening wheat with high phosphorus utilization efficiency, primer group and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103952402B (en) * | 2014-04-18 | 2016-03-09 | 中国农业科学院作物科学研究所 | A kind of SNP site relevant to root system of plant proterties and application thereof |
-
2014
- 2014-09-30 CN CN201410520103.0A patent/CN104293939B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104293939A (en) | 2015-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107805673B (en) | SNP (Single nucleotide polymorphism) marker related to root system characters of wheat in seedling stage and application | |
| CN108060262B (en) | KASP marker related to wheat root system character and application thereof | |
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| CN112080582B (en) | KASP molecular marker closely linked with major QTL locus of wheat spike length and application thereof | |
| CN108977439B (en) | Method for assisting in identifying temperature character of wheat canopy and special primer group thereof | |
| CN101138313A (en) | Maize inbred line resistant to MRDV bred by using molecule making | |
| CN111778352B (en) | KASP primer group related to wheat grain weight and application thereof | |
| CN104293939B (en) | A kind of SNP site relevant to Wheat Seedling Low phosphorus tolerance and application thereof | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN112760402B (en) | KASP primer group for detecting wheat spike number and biomass density and application thereof | |
| CN111926104B (en) | SSR molecular marker for identifying authenticity of sugarcane and festuca arundinacea filial generation and method thereof | |
| CN107586874A (en) | For identifying primer pair and its application of capsicum yellow flower pesticide character | |
| CN102766625B (en) | Molecular marker of rice major gene bph22 (t) resistant to brown planthoppers and application thereof | |
| CN112662802B (en) | Wheat root length molecular marker and application thereof | |
| CN112126703A (en) | Molecular marker of multiple-effect QTLs locus qTLS-4 for regulating rice leaf size and application thereof | |
| CN106755413A (en) | Nitrogen in Rice absorbs site qNUE6 and its molecule labelling method | |
| CN101491212A (en) | Marker-assisted selection quick incubation method of rice strain containing amylase of middle content | |
| CN108048599B (en) | Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN105821153A (en) | Molecular marker related to oilseed rape pod-shattering resistance quantitative trait loci (QTL) and application | |
| CN114032235B (en) | SSR marker, primer pair, application of primer pair and screening method of SSR marker locus related to upland cotton early-maturing molecular breeding | |
| CN115807119A (en) | Multiple KASP marker primer group of wheat plant high major gene and application thereof | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
| CN108728576B (en) | Marker of wheat chlorophyll content related gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160302 Termination date: 20170930 |