CN104293824B - Method for transforming Crypthecodinium cohnii - Google Patents

Abstract

The present invention relates to a method for transforming Crypthecodinium cohnii, comprising the steps of: pre-culturing Crypthecodinium cohnii; pre-culturing agrobacterium; suspending Crypthecodinium cohnii and Agrobacterium in the presence of osmotic pressure regulator, and co-culturing the complete Crypthecodinium cohnii cell and Agrobacterium; and obtaining the agrobacterium transformed crypthecodinium cohnii.

Description

Method for transforming Crypthecodinium cohnii

Technical Field

The present invention relates to the field of genetic engineering. In particular to a method for transforming Crypthecodinium cohnii by using agrobacterium.

Background

Crypthecodinium cohnii (Crypthecodinium cohnii) belongs to the genus Crypthecodinium of the family Crypthecodiniaceae of the order Gonya μ lacales (Diaphyceae) of the world of Euryota, classified according to the NCBI Taxolomy database. The alga is a relatively original eukaryote and has the characteristics of discontinuous nuclear membrane, high constant condensation of chromosomes, wall thickness of cells and the like [ Liuxiaoling and the like, the extraction of Crypthecodinium cohnii chromosomes and unique ultrastructure thereof, report of experimental biology, 2000, 33 (2): 189-1].

Crypthecodinium cohnii has good docosahexaenoic acid (DHA) synthesis ability. DHA accounts for more than 30% of the Cell lipids [ Wynn et al Production of Single Cell oils by dinoflagellates, in Single Cell Oil (ZVi Cohen & Colin Ratledge) pp.86-98, AOCS Press, Urbana ], especially with a low lipid content of the product. For example, the strain ATCC30772 has a biomass of 17.2g/L, DHA content of 59% of the total fatty acid composition, and a simple fatty acid composition [ Colin et al, Production of docosahexaenoic acid by Crypthecodinium cohnii growth a pH-auxstat c. mu. culture with acid as a primary carbon source.2001, Lipid, 36 (11): 1241-1246]. The fatty acid of the crypthecodinium cohnii generally contains DHA, palmitic acid, oleic acid, stearic acid and the like, and few components such as EPA, DPA and the like in fish oil or schizochytrium oil which are not suitable for infants or have uncertain functions are included, so that the crypthecodinium cohnii becomes the only DHA algae oil suitable for infant formula food at one time.

Currently, the optimization of the production performance of Crypthecodinium cohnii is mainly focused on fermentation improvement, typically, US7674609 by Colin et al, US7678931 by Martek company, and DHASCO which is a commercial product. The document by De Swaaf reports that fed-batch fermentation with a 19g/L DHA yield of 109g/L biomass [ De Swaaf ME. high-cell-dense fed-batch c. multiple of the docosahexanoic-acid-producing marine organism, applied Microbiology and Biotechnology, 2003, 61 (1): 40-43]. For Crypthecodinium cohniniferation and DHA production [ Da Silva TL. Effect of n-doc on Crypthecodinium cohniniferation and DHA production J Ind Microbiol Biotechnol, DOI10.1007/s 10295-006-. The influence of other factors such as temperature, pH, carbon source, and nitrogen source on DHA synthesis by Crypthecodinium cohnii has also been reported [ Wangjufang et al, Crypthecodinium cohnii suspension culture for DHA production, Stannless university of light industry, 2002, 21 (4): 344-346]. Individual patents mention engineering of crypthecodinium, such as mutagenesis by ion beam (CN 201110138270.5).

The molecular biology of Crypthecodinium cohnii has been less studied, and in 1998 Lohuis Michael R.ten and Millerday J. after transformation of whole cells of Crypthecodinium cohnii with carborundum (silicon carbide) (efficiency is 10 per cent per day)⁷5-24 transformants were obtained from each cell) [ Lohuis Michael R.ten and Miller David J.1998.genetic transformation of dinoflagellates (Amphiinium and Symbiodinium): expression of GUS in microbial using microbiological cultures constructs, the Plant Journal, 13 (3): 427-435]Later, no public report on genetic transformation of crypthecodinium cohnii is found; there has been no attempt to search for a mechanism of DHA synthesis in crypthecodinium cohnii, and the reason why DHA has an excellent fatty acid composition has not been explained. Two crypthecodinium cohnii delta-5 elongase gene sequences (such as SEQ47/49 in US 20080155705) are only mentioned in BASF corporation patent "Method For the Production of M mu multiple-inactivated Fatty Acids in transgenic organisms", but only show that the gene can be used For constructing transgenic organisms producing oil, and genetic engineering research of crypthecodinium cohnii is not involved. At present, molecular biological modification and research of Crypthecodinium cohnii disclose few literature data.

The crypthecodinium cohnii has high DHA yield, and the grease component is very simple, thus being a good DHA producing strain. However, there is no report on genetic engineering modification of Crypthecodinium cohnii.

Disclosure of Invention

The inventor unexpectedly finds that when agrobacterium is suspended with crypthecodinium cohnii, if substances for adjusting osmotic pressure are added, the successful transformation of the crypthecodinium cohnii complete cells by the agrobacterium can be realized, and the transformation efficiency is higher than that of the prior art.

In particular, the present invention relates to a method for transforming Crypthecodinium cohnii (Crypthecodinium cohnii), comprising the steps of: suspending Crypthecodinium cohnii and Agrobacterium in the presence of osmotic pressure regulator, and co-culturing the complete Crypthecodinium cohnii cell and Agrobacterium; and obtaining the agrobacterium transformed crypthecodinium cohnii. The osmotic pressure regulator is added into IMN, and the IMN is prepared by regulating the osmotic pressure of IM by using an osmotic pressure regulator selected from sodium salt, magnesium salt, potassium salt, calcium salt and organic matters, wherein the osmotic pressure regulator is commonly used for agrobacterium transformation (IM). Specifically, the osmotic pressure regulator may be a sodium salt. Specifically, the osmotic pressure regulator may be sodium chloride, sodium sulfate, potassium chloride, calcium chloride, glucose, or sorbitol. The concentration of the above-mentioned osmotic pressure regulator may be 100mM-700mM, preferably 100mM-650mM, more preferably 200mM-400 mM. In the method of the present invention, Crypthecodinium cohnii cells and Agrobacterium may be co-cultured from pre-culturing Crypthecodinium cohnii to the early logarithmic phase. In the method of the present invention, crypthecodinium cohnii cells may be co-cultured with agrobacterium. Specifically, Crypthecodinium cohnii used in the present invention may be ATCC30772 and ATCC 40750.

In the preculture of Crypthecodinium cohnii, a conventional CA medium can be used. The components can be glucose 9-30g/L, yeast powder 1.5-7.5g/L, 50-75% seawater (or prepared from artificial sea salt), and pH 6.0-7.0. Sodium sulfate or sodium chloride can be additionally added to adjust the osmotic pressure.

In the co-culture of the crypthecodinium cohnii cells and the agrobacterium, the effect is not good by using the conventional IM culture medium. The inventors have surprisingly found that by adding an osmolyte regulating substance as described above to IM, good conversion results can be achieved.

Agrobacterium is a commonly used transformation tool by those skilled in the art. As is well known to workers in the art, the genes responsible for Agrobacterium virulence are present in plasmid form in wild-type Agrobacterium, known as Ti-plasmid in Agrobacterium tumefaciens (Agrobacterium tumefaciens) and Ri-plasmid in Agrobacterium rhizogenes (Agrobacterium rhizogenes). Both plasmids contain the Vir (Virulence) region of the virulence genes and the transfer DNA (T-DNA) region. After the genes of the Vir region are expressed, the regions between the T-DNA border sequences are transferred and integrated into the host genome. The Vir region contains many genes, and expression of some genes requires induction of phenolic compounds, usually from injured parts of plants or naturally secretes such compounds, and expression of the Vir genes is artificially promoted under laboratory conditions by, for example, acetosyringone. The effect of promoting the Vir gene to be induced and expressed by phenols is promoted by appropriate pH, saccharide concentration, phosphate concentration and temperature condition during induction in an Induction Medium (IM) [ Zhouzhi. Agrobacterium Vir gene induction factor research progress. China journal of bioengineering, 2011, 31 (7): 126-132], thereby improving the transformation efficiency of the agrobacterium. Agrobacterium transformation generally requires appropriate exposure or wounding of the host cell, such as wounding of plant tissue, first preparation of protoplasts from eukaryotes, and the like. The invention uses IM regulated by osmotic pressure regulator to suspend the pre-cultured cells, which can make the agrobacterium efficiently transform the complete crypthecodinium cohnii without troublesome protoplast preparation process. The crux of the invention lies in the addition of the osmolyte regulator to the preculture cell suspension, and the exemplified IM formulation can be modified appropriately by the person skilled in the art. Similarly, the concentration conditions of the salts and sugars or alcohols of the IMN of the present invention are mainly used for crypthecodinium cohnii, so the application of the present invention is not limited to the agrobacterium listed in the examples of the present invention, and the common agrobacterium tumefaciens and agrobacterium rhizogenes tool strains including but not limited to EHA105, LBA4404, AGL0, etc. can be used in the present invention. The embodiment of the invention uses a binary vector system mode to construct the recombinant agrobacterium by the K7 vector, but the key point of the invention is not the construction mode of the recombinant agrobacterium, so the application of the invention includes but is not limited to a binary vector system and a univariate vector system. The mode of transferring the foreign gene into Agrobacterium and the vector by which the foreign gene is transferred into Agrobacterium are not critical to the present invention, and those skilled in the art can select the foreign gene based on common knowledge. Examples of the present invention in order to identify positive transformants, zeocin resistance gene and GUS gene were introduced as marker genes using the k7 vector particularly in Agrobacterium, which are not essential for the transformation method because they do not determine the transformation efficiency but are only required for selection of positive transformants. Other elements, including but not limited to drug resistance genes, enzyme genes, gene expression regulatory elements, gene knock-out elements, gene site-directed mutagenesis elements, etc., can be introduced simply by established techniques by researchers in the field; the vector containing the T-DNA border sequence is taken as a starting vector and is not limited to pCAMBIA series vectors.

Drawings

FIG. 1: construction of recombinant Agrobacterium A K7 plasmid is shown. The vector contains a selection marker zeocin resistance gene which acts in the recombined crypthecodinium cohnii, a selection marker kanamycin resistance gene which acts in the recombined agrobacterium tumefaciens, a multiple cloning site region (MCS) which consists of a CaMV35S promoter, EcoR 1-Hind III restriction enzyme sites and the like, and two T-DNA boundary regions of a left boundary T-DNA repeat and a right boundary T-DNA repeat. The Agrobacterium transferred the left border T-DNA repeat, CaMV35S PolyA, zeocin, CaMV35S promoter, MCS, CaMV35S promoter, GUS, Nos PolyA, right border T-DNA repeat to Crypthecodinium cohnii and integrated into the genome.

FIG. 2: results of colony PCR assay of zeocin-resistant obtained by transforming Crypthecodinium cohnii with CA-1 system. The 1 lane sample is PCR positive control using recombinant Agrobacterium colony as template, the 2 lane is PCR positive control using K7 plasmid as template for constructing recombinant Agrobacterium, and the 4-11 lanes are PCR amplification products using randomly selected zeocin-resistant recombinant Crypthecodinium cohnii colony as template. The dotted line box indicates that the recombinant Crypthecodinium cohnii colony has a PCR detection band consistent with the positive control.

FIG. 3: and (3) PCR test results of the resistant colonies obtained by the CA-2 system. 1. Lane 2 is the PCR positive control with recombinant Agrobacterium and K7 plasmid as template. Lanes 3-6 show the PCR assay results of four randomly selected zeocin-resistant Crypthecodinium cohnii colonies. The dashed box indicates that the recombinant Crypthecodinium cohnii colony obtained a PCR detection band consistent with the positive control, and M is DL5000 nucleic acid marker of Takara.

FIG. 4: and optimizing the PCR detection result of the resistant colony obtained in the experiment. The M lane is Takara 1kb DNAladder, 1-12 randomly selected zeocin-resistant Crypthecodinium cohnii colonies. 8. Lanes 9 and 11 show PCR products with no specificity, which are negative samples for PCR detection.

FIG. 5: influence of the Crypthecodinium cohnii culture end-point stage on Agrobacterium-mediated transformation efficiency. The result shows that the Crypthecodinium cohnii cultured has better transformation effect to the initial logarithmic phase than to the final logarithmic phase.

FIG. 6: effect of sodium chloride concentration in IMN solution on conversion efficiency. 51mM is the concentration of Na ions in the normal IM induction liquid, and 200-700mM are optional Na ion concentration conditions.

FIG. 7A: at the same concentration (350mM), the efficiency of Agrobacterium transformation was compared to that of sodium chloride after treatment of Crypthecodinium cohnii with IMN solutions prepared from organic solvents, sugars (represented by glucose) and alcohols (represented by sorbitol).

FIG. 7B: 350mM cation concentration and IMN solution prepared by different inorganic salts are used for processing Crypthecodinium cohnii, and then an agrobacterium transformation efficiency chart is obtained.

FIG. 8: comparison of the conversion efficiencies of Crypthecodinium cohnii ATCC40750 with Crypthecodinium cohnii ATCC30772 under the conditions of the present invention.

Detailed Description

Unless otherwise specified, various starting materials of the present invention are commercially available; or prepared according to conventional methods in the art. Unless defined or stated otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental methods of the following examples, which are not specified under specific conditions, are generally determined according to national standards. If there is no corresponding national standard, it is carried out according to the usual international standards, to the conventional conditions or to the conditions recommended by the manufacturer. Unless otherwise indicated, all parts are parts by weight and all percentages are percentages by weight.

Unless defined or stated otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention.

As used herein, "comprising," having, "or" including "includes" comprising, "" consisting essentially of, "and" consisting of,. once; "consists essentially of," and "consists of" belong to the subordinate concepts of "containing," having, "or" including.

The features mentioned with reference to the invention or the features mentioned with reference to the embodiments can be combined. All the features disclosed in this specification may be combined in any combination, and each feature disclosed in this specification may be replaced by alternative features serving the same, equivalent or similar purpose. Thus, unless expressly stated otherwise, the features disclosed are merely generic examples of equivalent or similar features.

Crypthecodinium cohnii (Crypthecodinium cohnii) that can be transformed using the methods of the invention include, but are not limited to: ATCC40750, TEX L1649, ATCC30556, ATCC50051, UTEX L1649, RJH, ATCC30772, CCMP316, ATCC50297, ATCC30556 and the like.

The Agrobacterium that can be used in the method of the present invention can be any of a variety of Agrobacterium used for gene transformation known in the art, including but not limited to Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, EHA101, LBA4404, AGL-0, AGL-1, NT1, C58-Z707, GV3101:: pMP90, etc.

In the method of the invention, agrobacterium is used to transform the complete crypthecodinium cohnii cells. "intact Crypthecodinium cohnii cell" refers to a cell with intact structure, including cell wall, cell membrane, etc. More specifically, intact crypthecodinium cohnii cells are not crypthecodinium cohnii protoplasts that have been treated to be free of cell walls.

In the present invention, the Agrobacterium contains a target gene of interest. The target gene may be any deoxyribonucleic acid. The target gene may be foreign with respect to the crypthecodinium cohnii to be transformed, i.e. the crypthecodinium cohnii itself is not present; or may be endogenous, i.e.nucleic acids which correspond to the genetic information of Crypthecodinium cohnii itself. The target gene includes but is not limited to nucleic acids having biological activity, such as protein-encoding genes, nucleic acids for regulating gene transcription, and the like; and nucleic acids that are not biologically active, such as nucleic acid fragments that are used for gene integration, knock-outs. In certain embodiments, the target gene encodes an enzyme of interest and various functional proteins.

In the present invention, the medium used in the co-cultivation may include, but is not limited to, Agrobacterium transformation induction medium.

Crypthecodinium cohnii may be cultured using conventional conditions, such as culturing time, inoculum size, temperature, etc., preferably, crypthecodinium cohnii is pre-cultured to early log phase.

Conventional conditions can be used to culture Agrobacterium to log phase. The foreign gene can be transferred into Agrobacterium using methods known in the art, for example, including but not limited to heat shock method, electric shock transformation method, etc.

The pre-cultured crypthecodinium cohnii cells and agrobacterium may be washed, resuspended, etc. separately using a medium containing an osmolality adjusting agent. Specifically, it can be washed with a medium containing an osmolyte and then resuspended with a medium containing an osmolyte. The volume after resuspension is generally determined by the amount of inoculum used for collection, and is generally about 1/20 times the volume of the original inoculum. Can be washed with a medium containing an osmotic pressure regulator and then resuspended in a range of 0.8-1.2X 10¹⁰One/ml (resuspended to 1.5-2.5 ml). Equal volumes of the two suspensions are typically taken and mixed. But may also take different volumesThe two suspensions were mixed well.

In the present invention, the osmotic pressure regulator is preferably one or more of sodium salt, magnesium salt, potassium salt, calcium salt, sugar and alcohol organic matter, and more preferably the osmotic pressure regulator is selected from sodium chloride, sodium sulfate, potassium chloride, magnesium sulfate, calcium chloride, glucose and sorbitol. The concentration of the tonicity adjusting agent in the medium is 100mM-700mM, preferably, the concentration of the tonicity adjusting agent is 100mM-650mM, more preferably 200mM-400 mM.

In one embodiment of the invention, the concentration of the osmolality adjusting agent is: 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, 200mM, 210mM, 220mM, 230mM, 240mM, 250mM, 260mM, 270mM, 280mM, 290mM, 300mM, 310mM, 320mM, 330mM, 340mM, 350mM, 360mM, 370mM, 380mM, 390mM, 400mM, 410mM, 420mM, 430mM, 440mM, 450mM, 460mM, 470mM, 480mM, 490mM, 500mM, 510mM, 520mM, 530mM, 540mM, 550mM, 560mM, 570mM, 580mM, 590mM, 600mM, 610mM, 620mM, 630mM, 640mM, 650mM, 660mM, 670mM, 680mM, 690mM, or 700 mM.

In the present invention, the medium containing the osmo-regulator is an Agrobacterium induction medium consisting of MES (2-morpholinoethanesulfonic acid), a buffer system (typically phosphate), a carbon source, a nitrogen source, and a salt, and is generally controlled under a suitable pH condition (e.g., pH5.3) to enhance the Agrobacterium transformation effect.

In one embodiment, the medium used for washing and resuspension is IM medium containing 100mM-700mM osmoregulator.

The Crypthecodinium cohnii suspension and the Agrobacterium suspension can be mixed by conventional method, and the mixed bacteria solution (e.g. 10-200 μ l, such as 50 μ l) is applied onto the culture plate. The culture plate can be prepared using a conventional plate preparation method. In the present invention, the culture plate may include, but is not limited to, the culture medium disclosed to support the growth of crypthecodinium cohnii, for example, the carbon source may be selected from saccharides such as glucose, galactose, etc., short chain acids such as acetic acid, propionic acid, lactic acid or salts thereof, alcohols such as ethanol, glycerol, syrup such as carob syrup; the nitrogen source can be selected from yeast powder, peptone, meat extract, glutamic acid or its salt, potassium nitrate, ammonium chloride, corn steep liquor, etc.; sea salt or seawater provides the osmotic pressure.

It should be understood that although the components and contents of the culture medium are described above, the components and contents can be modified by those skilled in the art according to the actual needs. The present invention will be described below by way of specific examples. Reagents, reaction conditions, and the like used in the examples are those conventional in the art unless otherwise specified.

The media and solution formulations used in the examples are as follows:

YEB Medium: 5g/L beef extract, 1g/L yeast powder, 5g/L peptone and 7.0-7.5 pHs.

CA culture medium: 9g/L glucose, 1.5g/L yeast powder, 25g/L sea salt, pH6.5

CS medium: except that the carbon source is changed from glucose to sodium acetate, the other components and contents of CS are the same as those of the CA culture medium

IM medium and IM broth: 7.8 g/L2-morpholine ethanesulfonic acid, 2g/L glucose, 0.6g/L glycerol, 0.15g/L sodium chloride, 0.5g/L ammonium sulfate, 0.0025g/L ferrous sulfate, 0.08g/L calcium chloride, 0.25g/L magnesium sulfate, 2.28g/L dipotassium hydrogen phosphate, 1.36g/L potassium dihydrogen phosphate and pH5.3. IM is used as a culture medium when the agrobacterium and the crypthecodinium coculture are carried out, so the culture medium is called as the culture medium; IM is called IM fluid because it does not support cell growth, but acts as a solution when suspending and eluting cells. The two components are consistent.

IM solid medium: and supplementing 1.8% of agar powder into the IM to obtain the product.

Example one

The desired recombinant Agrobacterium was constructed from the starting Agrobacterium strain, Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (said strain was purchased from proetin Biotechnology (Beijing) Ltd.). The EHA105 strain is a commonly used tool strain well known to researchers in the field. In this experiment, a drug resistance gene was introduced to identify whether transformation was successful or not, thereby facilitating detection.

The specific steps are that hygromycin in ① pCAMBIA1301 vectorThe resistance gene had XhoI restriction enzyme recognition sites at both ends, so that the vector was completely excised from the hygromycin resistance gene by digestion with XhoI endonuclease (available from Cambia corporation) pCAMBIA1301 (available from Cambia corporation) and the hygromycin resistance gene in the vector was cut out, ② was PCR-amplified using pGAPZ α A vector (available from Putin Biotechnology (Beijing) Ltd.) as a template using primers ZEOU (AAAACTCGAGATGGCCAAGTTGACCAGTGGC) and ZEOD (AACTCGAGTCAGTCCTGCCTGCCTCCGCCGCCA) with the procedures of pre-denaturation at 95 ℃ for 5 minutes, pre-denaturation at 32 cycles of 95 ℃ for 50s at 95 ℃, amplification at 55 ℃ for 50s at 72 ℃ for 30s, and finally extension at 72 ℃ for 10 minutes to obtain a fragment of zeocin resistance gene containing XhoI cleavage sites at both ends, and purification of the fragment of zeocin resistance gene by restriction enzyme digestion with plasmid DNA ligase DNA polymerase PCR-ligase PCR-cut out, and purification of the fragment obtained fragment by PCR-digested fragment containing XhoI restriction enzyme ligation of PCR-digested fragment at 2500-DNA fragment, and recovery of PCR-digested fragment, and purification of plasmid DNA fragment by restriction enzyme ligation of PCR-digested fragment DNA obtained by Cycle fragment DNA-digested fragment, recovery Kit of PCR-digested fragment, purification of plasmid DNA, recovery of plasmid DNA, purification by Gel DNA-digested fragment containing XhoI DNA, purification by restriction enzyme ligation of plasmid DNA, purification of plasmid DNA₂DH5 α competent cells (purchased from Takara) prepared by the method are pre-cultured and then coated on Kanna resistant LB plate for screening, ⑤ resistant clone is screened by colony PCR and plasmid sequencing to obtain a new vector with zeocin resistance gene replacing hygromycin resistance gene in pCAMBIA1301 vector, named K7, the vector schematic diagram is shown in figure 1, ⑥ is based on [ Hamming Steel, plant gene operation principle and technology [ M]Tianjin scientific and technical Press 2000, pp181]The method of (3) preparing competent Agrobacterium cells comprises: culturing agrobacterium EHA105 colony overnight on a shaking table at 28 ℃ by using YEB culture solution, then transferring the colony to 50ml of new YEB culture solution according to the volume ratio of 1%, and carrying out shaking culture at 28 ℃ until OD600 is 0.5; after ice-bath of the bacterial liquid for 30 minutes, centrifuging at 5000rpm for 5 minutes to collect cells, precipitating the suspended bacteria into 10ml of precooled 0.5M sterile NaCl solution, centrifuging at 5000rpm again for 5 minutes to collect cells, and precipitating the suspended bacteria into 20ml of precooled 0.02M sterile CaCl₂Adding into solution, packaging at a volume of 200 μ l/piece, and quick freezing with liquid nitrogen⑦ adding K7 plasmid solution 20 μ l (0.5-1.0 μ g) into ice bath melted 200 μ l Agrobacterium tumefaciens competent cell liquid, mixing, ice bath for 30 min, liquid nitrogen quick freezing for 5 min, transferring into 37 deg.C water bath for 5 min, adding 1ml YEB culture solution, shake culturing at 28 deg.C for 2h, coating on kanamycin-resistant LB plate, and culturing at 28 deg.C until obvious colony appears.

Inoculating the recombinant agrobacterium tumefaciens single colony obtained by the steps into 5ml of YEB culture solution, adding kanamycin and streptomycin, and culturing overnight at 28 ℃; transferring to 50ml YEB culture solution at 0.1%, adding kanamycin and streptomycin, shaking at 28 deg.C and 200rpm overnight until OD is 0.4-0.8, centrifuging, collecting thallus, and suspending to 2ml with IM solution.

Crypthecodinium cohnii ATCC30772 (purchased from Guangdong province culture Collection) was inoculated from glycerol tubes into CA medium. Shaking and culturing at 21 ℃ with a shaking table at 150rpm for 1 week to obtain a seed solution. Then inoculating 10% of the extract into CA and CS culture medium, performing shaking culture at 21 deg.C and 28 deg.C for 3 days, respectively, detecting Optical Density (OD) and microscopic examination of thallus activity.

The culture is carried out for the same time, and the bacterial body quantity CA is found_28℃＝CA_21℃＞CS_21℃＞CS_28℃Wherein, CA_28℃Indicates a culture at 28 ℃ in a CA medium, similarly, CA_21℃Represents a culture at 21 ℃ in a CA medium, CS_21℃、CS_28℃Respectively, the results were obtained in CS medium at 21 ℃ and 28 ℃. Therefore, the CA culture medium is adopted in the stage of pre-culturing the Crypthecodinium cohnii, so that whether the Crypthecodinium cohnii grows normally can be conveniently observed; screening media used CS to form clearer colonies.

Transferring the thallus from the seed liquid to CA-1 and CA-2 culture mediums with different osmotic pressures according to the proportion of 10 percent for pre-culture. As the CA-1 and CA-2 media used herein, glucose, yeast powder, sea salt and pH conditions were the same as those of the CA media described above, but the salt content in the media was adjusted by sodium sulfate. Two media, CA-1 and CA-2, were supplemented with 0 and 6.6g/L, respectively, of anhydrous sodium sulfate so that the Na + concentration was 240 and 333mM, respectively, to design different pre-culture osmotic pressures. Shaking at 21 deg.C with shaking table 150rpm until OD1.0, centrifuging at 3000rpm for 10 min to collect Crypthecodinium cohnii thallus, and suspending to 2ml with IM solution.

The agrobacterium and crypthecodinium bacteria liquid are prepared in situ. Respectively taking fresh 1ml Crypthecodinium cohnii and 1ml recombinant agrobacterium, mixing uniformly, coating 50 mul/plate on IM solid culture medium, and culturing for 16h in an incubator at 28 ℃. Scraping off lawn on the co-culture plate by using a common glass triangular coating rod under the action of 2ml IM rinsing to obtain bacterial liquid, sucking out the bacterial liquid, supplementing the bacterial liquid to 2ml by using the IM liquid, uniformly mixing, coating 50 mu l of the bacterial liquid on a CS selection plate (containing 50 mu g/ml zeocin), drying the surface of the plate on an ultra-clean bench by sterile air, and then placing the plate in an incubator at 28 ℃. As a result, it was found that resistant colonies did not appear at 1 week of culture. The above pre-culture, mixed co-culture and screening experiments of agrobacterium and crypthecodinium were repeated and examined, and it was found that crypthecodinium seemed to be thin in cell wall, not like the 'thick' description in the literature, and sensitive to osmotic pressure. Microscopic examination of the IM fluid-treated Crypthecodinium cohnii revealed that a small number of cells disintegrated in the visual field, and therefore the osmotic pressure of conventional IM fluid was not suitable for suspending Crypthecodinium cohnii.

The operations of pre-culturing, mixing, co-culturing and screening resistant colonies of the agrobacterium and the crypthecodinium were repeated, but the IM solution was changed into IMN solution (7.8 g/L2-morpholine ethanesulfonic acid, 2g/L glucose, 0.6g/L glycerol, 0.5g/L ammonium sulfate, 0.0025g/L ferrous sulfate, 0.08g/L calcium chloride, 0.25g/L magnesium sulfate, 41g/L sodium chloride, 2.28g/L dipotassium hydrogen phosphate, 1.36g/L potassium dihydrogen phosphate, pH5.3) as a solution for suspending crypthecodinium, agrobacterium cells and scraping the co-culture plate (the solution was still spread on the IM solid medium plate during co-culturing, which was not modified), the co-culturing time was 20h, and the molar concentration of NaCl in the IMN solution was 0.7M. The transformation results are shown in table one, where transformation efficiency is the number of resistant colonies x the positive rate of PCR assay ÷ the number of crypthecodinium cells spread per plate.

Results of transforming Crypthecodinium cohnii with Agrobacterium

	CA-1	CA-2
			Na + (mM) concentration for preculture of Crypthecodinium cohnii	240	333
Number of resistant colonies	42	14
			Positive rate of PCR	100％	100％
Efficiency (one/million cells)	73	36

Note: the method for detecting the PCR positivity in the Table is described in example II

In both experiments, transformation efficiencies were obtained that were already higher than in the prior art corundum method (0.5-2.4 transformants per million cells). The concentration of sodium ions (osmotic pressure) in the CA medium had no significant effect on the results of the experiment.

Optimization is necessary to obtain higher conversion efficiency. Pre-culturing Crypthecodinium cohnii to logarithmic phase by using CA-1 and CA-2 pre-culture conditions; agrobacterium was grown to OD as described above₆₀₀0.4-0.8, followed by agrobacterium transformation. The IMN used was modified from containing 0.7M NaCl to containing 0.35M NaCl. In addition, in another groupIn the experiment, acetosyringone is added into the IM solid culture medium, and the rest conditions are the same. The conversion results obtained in the experiment are shown in table two:

crypthecodinium cohnii transformation result after optimization of Table II

	CA-1	CA-1	CA-2	CA-2
					Na+(mM)	240	240	333	333
Acetosyringone	-	+	-	+
					Number of resistant colonies	274	408	312	330
Positive rate of PCR	100％	100％	33％	66％
					Efficiency (one/million cells)	500	700	180	390

Comparing the second table with the first table, it can be seen that the conversion efficiency after optimization is greatly improved compared with that before optimization, and obviously, the proper reduction of the osmotic pressure of the IMN (the concentration of Nacl is reduced from 0.7M to 0.35M) has an obvious effect on improving the conversion efficiency. In addition, in the two systems of CA-1 and CA-2, the efficiency of the transformation induced by using acetosyringone is higher than that of the experimental group without using acetosyringone.

Example two:

resistant colonies obtained by screening the plates need to be verified, and the present invention uses colony PCR to test the recombined colonies.

The target gene of colony PCR test should be any part between two T-DNA regions on pCAMBIA vector, and the nucleic acid can be transferred into Crypthecodinium genome by Agrobacterium. Nucleic acid between the left boundary and the right boundary of the T-DNA repeat on the K7 vector used by the invention mainly comprises CaMV35S PolyA, zeocin resistance gene, CaMV35S promoter, multiple cloning site region, CaMV35S promoter, GUS gene, artificial intron and Nos polyA region, and all of the nucleic acid can be used as the target of PCR detection. The invention can detect zeocin resistance gene carried by recombinant agrobacterium, and uses primer zeoU: AAAACTCGAGATGGCCAAGTTGACCAGTGC and zeoD: AAAACTCGAGTCAGTCCTGCTCCTCGGCCA are provided. The PCR amplification method is as follows: adding 10 mul of sterile water into a PCR tube, dipping a small amount of resistant bacterial colony thalli (about 0.5 mul) by using a10 mul pipette tip, uniformly mixing the bacterial colony thalli with the sterile water, performing heat treatment at 95 ℃ for 10 minutes, and adding the rest of reagents of PCR; the reaction system was 25. mu.l, composed of 2.5. mu.l of 10 XPCR buffer, 2. mu.l of dNTP, 1. mu.l of each 20uM primer, 0.3. mu.l of rTaq enzyme, and water was added to the system of 25. mu.l. The PCR procedure was: pre-denaturation at 95 ℃ for 5 min; 30 cycles of 95 ℃ for 30 seconds, 55 ℃ for 30 seconds, and 72 ℃ for 30 seconds; extension at 72 ℃ for 10 min. The PCR products were checked using 1% agarose gel electrophoresis. As a target of colony PCR assay, it is also possible to assay GUS gene region (as long as a region between two T-DNAs is used, specifically, on the vector used in the present invention, zeocin resistance gene, GUS gene, 35S promoter, and multiple cloning site region are included in the part between two T-DNAs, and they are all used for assay), and primers used are GUSU: ATGGTAGATCTGAGGGTAAATTTCTAGT and GUSD: GAAACTTTATTGCCAAATGTTTGAA are provided. The PCR reaction system and zeocin detection PCR, the PCR program is pre-denaturation at 95 ℃ for 5 minutes; 33 cycles of 95 ℃ for 30 seconds, 53 ℃ for 30 seconds, and 72 ℃ for 120 seconds; extension at 72 ℃ for 10 min. The PCR products were detected using 1% agarose gel electrophoresis.

The results of PCR testing of corresponding colonies are shown in FIGS. 2 and 3. Carrying out PCR on 8 random colonies in the CA-1 system, wherein the results are positive; 4 colonies obtained by CA-1 were randomly selected for PCR, and the results were all positive.

The results of the PCR test for the corresponding colonies are shown in FIG. 4. The PCR positive rates are respectively: 100% CA-1 (lanes 1-3), 100% CA-1As (lanes 4-6); CA-2 (lanes 7-9) 33%; CA-2As (lane 10-12) 66%. As represents addition of acetosyringone. The conversion efficiency is calculated and shown in the second table.

EXAMPLE III

Crypthecodinium cohnii and Agrobacterium were cultured according to the procedure described in example one, using CA-1as the medium for pre-culturing Crypthecodinium cohnii.

Taking ATCC30772 strain as an example, the difference of Agrobacterium transformation effect in the growth stage of the strain was analyzed in example one. Namely, ATCC30772 was cultured to early log and late log, respectively. As shown in FIG. 5, the initial logarithmic phase of Crypthecodinium cohnii was more affected by the transformation conditions, and better transformation efficiency was obtained.

The effect of different concentrations of treatment solutions on the transformation efficiency was also investigated, using ATCC30772 strain as an example. Commonly used by researchersThe induced culture broth (IM) was used as a solution for suspending Crypthecodinium cohnii, but our experiments again found that the transformation efficiency of Crypthecodinium cohnii was very low under this osmotic pressure condition. Microscopic examination shows that crypthecodinium cohnii can disintegrate cells in IM, the disintegration degree is related to the method for pre-culturing crypthecodinium cohnii, the disintegration of crypthecodinium cohnii obtained by static culture is not obvious, the disintegration rate of crypthecodinium cohnii obtained by shaking culture in a shaker is much higher, but the relationship between the transformation efficiency calculated from the complete cell concentration and the culture mode is not large, and the transformation efficiency is only related to the cell stage and the treatment solution. Therefore, osmolytes were added to the IMN. This example comparatively analyzes the effect of a treatment with Na + as osmoregulator, added at several optional concentrations between 100 and 700 mM. The method of example one was used, but Na in IMN solution⁺The concentration is designed as follows: 100mM, 200mM, 350mM, 400mM, 600mM and 700mM, with a 51mM concentration control. The results show that the conversion efficiency at 700mM is relatively low, but is about 10 times higher than that reported by the emery method, wherein the results are shown in FIG. 6 for 51mM, 100mM, 200mM, 350mM and 700 mM.

Since the above results show that 350mM Na has the highest efficiency as the treatment method, this example also compares the conversion efficiency after the treatment of the common organic osmo-regulators glucose and sorbitol and the common inorganic osmo-potassium, calcium and magnesium solutions at 350mM concentration. The experimental materials and procedures were the same as in example one except that the osmolality adjusting agent added to the IMN was changed from sodium chloride to conversion efficiency after treatment with glucose, sorbitol and potassium, calcium and magnesium solutions. The results are shown in FIGS. 7A and 7B. After the Crypthecodinium cohnii is treated by the solutions provided by the substances, higher agrobacterium transformation efficiency can be obtained.

Example four

The experimental procedure of example one was repeated using another Crypthecodinium cohnii (ATCC40750, available from Guangdong provincial collection of microorganisms). In which Crypthecodinium cohnii was cultured to early logarithmic phase with 350mM NaCl in IMN. The conversion efficiency is slightly lower than that of the first example, but is far higher than that of the prior art carborundum method. See fig. 8. It will be seen that the method of the present invention is not limited to a particular crypthecodinium cohnii.

Claims (20)

1. A method of transforming Crypthecodinium cohnii (Crypthecodinium cohnii), said method comprising the steps of:

suspending Crypthecodinium cohnii and Agrobacterium tumefaciens (Agrobacterium tumefaciens) in the presence of an osmotic pressure regulator;

co-culturing the complete crypthecodinium cohnii cell and the recombinant agrobacterium tumefaciens; and

obtaining Crypthecodinium cohnii transformed by the agrobacterium tumefaciens,

wherein the osmotic pressure caused by the osmotic pressure regulator is equivalent to the osmotic pressure caused by sodium chloride with the concentration of 100mM-700mM, and the osmotic pressure regulator is selected from sodium salt, magnesium salt, potassium salt, calcium salt or sugar and alcohol organic matters.

2. A method for producing transgenic Crypthecodinium cohnii (Crypthecodinium cohnii), comprising transforming whole Crypthecodinium cohnii with a recombinant agrobacterium tumefaciens containing a target gene in the presence of an osmolality adjusting agent, wherein the osmolality adjusting agent causes an osmolality corresponding to an osmolality caused by sodium chloride at a concentration of 100mM to 700mM, and the osmolality adjusting agent is selected from sodium salt, magnesium salt, potassium salt, calcium salt or sugar, alcohol organic matter.

3. The method of claim 1, wherein the osmolality adjusting agent is selected from the group consisting of sodium chloride, sodium sulfate, potassium chloride, magnesium sulfate, calcium chloride, glucose, and sorbitol.

4. The method of claim 2, wherein the osmolality adjusting agent is selected from the group consisting of sodium chloride, sodium sulfate, potassium chloride, magnesium sulfate, calcium chloride, glucose, and sorbitol.

5. The method according to claim 3, characterized in that the osmolality regulator results in an osmolality which corresponds to the osmolality caused by sodium chloride in a concentration of 200mM to 400 mM.

6. The method according to claim 4, characterized in that the osmolality regulator results in an osmolality which corresponds to the osmolality caused by sodium chloride in a concentration of 200mM to 400 mM.

7. The method of claim 1, wherein said crypthecodinium cohnii and/or said agrobacterium tumefaciens are pre-cultured.

8. The method of claim 2, wherein said crypthecodinium cohnii and/or said agrobacterium tumefaciens are pre-cultured.

9. The method of claim 7, wherein said crypthecodinium cohnii and said agrobacterium tumefaciens are pre-cultured to log phase.

10. The method of claim 8, wherein said crypthecodinium cohnii and said agrobacterium tumefaciens are pre-cultured to log phase.

11. The method of claim 9, wherein the crypthecodinium cohnii is crypthecodinium cohnii pre-cultured to the log-initial stage.

12. The method of claim 10, wherein the crypthecodinium cohnii is crypthecodinium cohnii pre-cultured to the log-initial stage.

13. The method of any one of claims 1 to 12, wherein acetosyringone is added during co-cultivation of crypthecodinium cohnii cells with agrobacterium tumefaciens.

14. The method of any one of claims 1-12, wherein said crypthecodinium cohnii is selected from the group consisting of ATCC30772, ATCC40750, TEX L1649, ATCC30556, ATCC50051, UTEX L1649, RJH, CCMP316, ATCC50297, ATCC 30556; the agrobacterium tumefaciens is selected from: agrobacterium tumefaciens EHA105, EHA101, LBA4404, AGL-0, AGL-1, NT1, C58-Z707 and GV3101 pMP 90.

15. The method of any one of claims 1 to 12, further comprising the step of obtaining an agrobacterium tumefaciens transformed crypthecodinium cohnii.

16. The method of claim 13, further comprising the step of obtaining an agrobacterium tumefaciens transformed crypthecodinium cohnii.

17. The method of claim 14, further comprising the step of obtaining a transformed crypthecodinium cohnii transformed with agrobacterium tumefaciens.

18. Use of a medium for transforming crypthecodinium cohnii with agrobacterium tumefaciens, characterized in that the medium comprises an osmolality adjusting agent, wherein the osmolality adjusting agent causes an osmolality corresponding to an osmolality caused by sodium chloride with a concentration of 100mM to 700mM, and the osmolality adjusting agent is selected from sodium salt, magnesium salt, potassium salt, calcium salt or sugar, alcohol organic substances.

19. The use of claim 18, wherein the osmotic pressure regulator is selected from the group consisting of sodium chloride, sodium sulfate, potassium chloride, magnesium sulfate, calcium chloride, glucose, and sorbitol.

20. Use according to claim 18 or 19, characterized in that the osmolality regulator causes an osmolality that corresponds to the osmolality caused by sodium chloride at a concentration of 200mM to 400 mM.

Images