CN103014053A - Synechocystis efficient double homologous recombinant vector as well as construction method and application thereof - Google Patents
Synechocystis efficient double homologous recombinant vector as well as construction method and application thereof Download PDFInfo
- Publication number
- CN103014053A CN103014053A CN2012105290444A CN201210529044A CN103014053A CN 103014053 A CN103014053 A CN 103014053A CN 2012105290444 A CN2012105290444 A CN 2012105290444A CN 201210529044 A CN201210529044 A CN 201210529044A CN 103014053 A CN103014053 A CN 103014053A
- Authority
- CN
- China
- Prior art keywords
- cytoalgae
- gene
- gene fragment
- fatty acid
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention particularly relates to synechocystis efficient double homologous recombinant vector as well as a construction method and the application thereof. The nucleotide sequence of the synechocystis efficient double homologous recombinant vector is shown as SEQ ID NO.8 or SEQ ID NO.9. The invention also discloses the construction method and the application of the synechocystis efficient double homologous recombinant vector. The synechocystis efficient double homologous recombinant vector expresses synechocystis PCC6803Delta 15, Delta 15 and Delta 6 fatty acid desaturase gene in synechocystis PCC6803, and can obviously increase the content of therapic acid in synechocystis.
Description
Technical field
The present invention relates to be specifically related to the efficient two homologous recombination vectors of cytoalgae and construction process and application, be particularly related to the efficient two homologous recombination vectors of a kind of cytoalgae PCC6803 genetic transformation and construction process and the application in cytoalgae PCC6803 lipid acid is synthetic, belong to gene engineering technology field.
Background technology
Blue-green algae (cyanobacteria) claim again cyanobacteria, is that a class can be carried out photosynthetic prokaryotic organism.Cells of Blue-green Algae can utilize simple inorganics synthesis of organic substance, and expressed exogenous genes products does not form occlusion body, and most blue-green algae and extract thereof are nontoxic to people and animals, are the good receptor of transgenic research.Cytoalgae PCC 6803 (Synechocystis sp.strainPCC6803) is as a kind of unicellular blue green algae, have that fast growth, culture condition simply, do not produce toxin, cellularstructure is simple, genetic background is clear, make things convenient for the characteristics such as molecule manipulation, being suitable for utilizing the scale operation of wide nuclear bio-reactor, is good blue-green algae genetically engineered acceptor.
The easy purifying of exogenous genes products of expressing in view of blue-green algae, do not contain toxin, frustule and cultivate the advantage that cost is low and be not easy to pollute etc., along with the engineered development of algae, make and utilize blue-green algae to become possibility as the exogenous gene expression carrier to produce the high value added products such as medicine.
The blue-green algae genetic modification is divided into three phases substantially: the first, and foreign DNA enters host cell by gene transfer system; The second, foreign DNA is stable in host cell to be copied and is expressed; The 3rd, foreign DNA and host cell chromosome or endogenous Plasmids conjugation perhaps carry out self-replicating in host cell.Foreign DNA enters Cells of Blue-green Algae can stable existence in following several situations: at first, foreign gene is recombinated into host chromosome; Secondly, foreign gene is recombinated into the endogenous plasmid of host; The 3rd, foreign gene exists with the plasmid form and can self-replicating.
Homologous recombination divides single cross to change two types of form and double exchanges.Wherein homologous recombination double exchange carrier is that one section fragment with the host cell chromosome homology is all arranged in the foreign gene both sides, after recombinant plasmid enters host cell, on the carrier homologous sequence at foreign gene two ends respectively with host cell in chromosomal corresponding site exchange.Like this, the foreign gene on the recombinant vectors is just along with homologous sequence and then be integrated on the host cell chromosome, and all the other fragments do not enter in the host cell chromosome on the carrier.So, express under the effect of the controlling element that foreign gene carries in the expression unit of foreign gene or under the host chromosome regulation and control, express.Because do not contain the initiation site that copies in the blue-green algae in the homologous recombination vector, so in host cell, can gradually lose because can't copy then.
Do not have on the homologous recombination integrative vector can be in frustule the replicon of self-replicating, can not be independently duplicated, but contain and the host chromosome homologous sequence, plasmid vector enters after the host cell, can be by changing or double exchange with the single cross of host cell chromosome homologous sequence generation homologous recombination, and then with exogenous origin gene integrator to host cell chromosome, exist and express with the low copy number gene.
At present cytoalgae PCC6803 genetic transforming method is very ripe, and its pair homologous recombination vector construction process is of a great variety, but both at home and abroad to the report of the double upstream arm of doing of homologous recombination vector promotor and efficiently expressing exogenous gene seldom.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, the efficient two homologous recombination vectors of a kind of cytoalgae PCC6803 genetic transformation and construction process and the application in cytoalgae PCC6803 lipid acid is synthetic are provided.
Technical solution of the present invention is as follows:
The efficient two homologous recombination vectors of cytoalgae, nucleotide sequence is shown in SEQ ID NO.8 or SEQ ID NO.9.
The construction process of the efficient two homologous recombination vectors of above-mentioned cytoalgae, step is as follows:
(1) the front 510bp gene fragment of the psbA2 Gene A TG of pcr amplification cytoalgae PCC 6803 is as psbA2 promoter gene fragment, the Genbank accession number is the psbA2ORF gene fragment of the cytoalgae PCC 6803 of X13547.1, the Genbank accession number is the intestinal bacteria terminator T1T2 gene fragment of U02439.1, the Genbank accession number is the cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene fragment of D13780.1 and the cytoalgae PCC6803Delta6 fatty acid dehydrogenase gene fragment that the Genbank accession number is L11421.1;
(2) the psbA2 promoter gene fragment that step (1) is obtained merges pcr amplification with cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene fragment and the cytoalgae PCC6803 Delta6 fatty acid dehydrogenase gene fragment that step (1) makes respectively, makes respectively gene fragment Promotor+Delta 15 and gene fragment Promotor+Delta 6;
(3) the intestinal bacteria terminator T1T2 gene fragment that step (1) is made is connected with the BamHI double digestion with PstI and is connected with the pBluescript SK that cuts through same enzyme, obtains plasmid pBluescript SK T1T2;
Then the psbA2ORF gene fragment that step (1) is made is connected with the SacI double digestion with SacII and is connected with the plasmid pBluescript SK T1T2 that cuts through same enzyme, obtains plasmid pBluescript SK T1T2-downstream;
Plasmid pBluescript SK T1T2-downstream and plasmid pUC4K are carried out the BamHI single endonuclease digestion, reclaim respectively the npt fragment among pBluescript SK T1T2-downstream carrier segments and the pUC4K behind the electrophoresis, to being connected with the npt fragment behind the carrier segments dephosphorylation, obtain plasmid pBluescript SK T1T2-npt-downstream;
(4) the gene fragment Promotor+Delta15 that step (2) is made, perhaps, among the plasmid pBluescript SKT1T2-npt-downstream that gene fragment Promotor+Delta15 and gene fragment Promotor+Delta6 inserting step (3) make, make recombinant vectors;
(5) recombinant vectors that step (4) is made is converted among the cytoalgae PCC6803, makes transgenic Synechocystis;
(6) transgenic Synechocystis that step (5) is made aerated culture 8～12 days under 20～30 ℃ of conditions makes the cytoalgae PCC6803 of high fatty acid content.
Preferred according to the present invention, in the described step (1), the primer of pcr amplification psbA2 promoter gene fragment is:
Promotor-F:5’-GATGTCGACGCTTTAGCGTTCCAGTG-3’；
Promotor-R：5’-CATTTGGTTATAATTCCTTATGTAT-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s, 72 ℃ are extended 30s, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
Preferred according to the present invention, in the described step (1), the psbA2ORF gene fragment of pcr amplification cytoalgae PCC6803 is introduced the SacII restriction enzyme site at its 5 ' end, introduces the SacI restriction enzyme site at its 3 ' end, and the primer is:
psbA2-F：5’-CTTCATATGCCGCGGATGACAACGACTCTCCAAC-3’；
psbA2-R：5’-AGTGAGCTCTTAACCGTTGACAGCAGG-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
Preferred according to the present invention, in the described step (1), the primer of pcr amplification cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene is:
Sy15-F：5’-TAAGGAATTATAACCAAATGCGTCTAGAAATTTCATCG-3’；
Sy15-R：5’-CGGCTGCAGTTACTTATCGTCGTCATCCTTGTAATCAGGTTTCTTTTGATATC-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
Preferred according to the present invention, in the described step (1), the primer of pcr amplification peanut thioester enzyme gene Delta6 is:
Sy6-F：5’-TAAGGAATTATAACCAAATGCTAACAGCGGAAAG-3’；
Sy6-R：5’-GTCCTGCAGTCAATGATGATGATGATGATGCGATGCTTTGCCCATGGCCT-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
Preferred according to the present invention, the front 510bp nucleotide sequencing of the psbA2 Gene A TG of cytoalgae PCC 6803 is shown in SEQ ID NO.1 in the described step (1), shown in the nucleotide sequence SEQ ID NO.2 of cytoalgae PCC6803psbA2ORF gene psbA2, the nucleotide sequence of cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene Sy15 is shown in SEQID NO.3, and the nucleotide sequence of cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene Sy6 is shown in SEQ ID NO.4.
Preferred according to the present invention, the preparation method of plasmid pBluescript SK T1T2 in the described step (3), specific as follows:
The plasmid pKK233-2(of amplification intestinal bacteria T1T2 terminator is available from Clontech company), introduce the PstI restriction enzyme site at its 5 ' end, introduce the BamHI restriction enzyme site at its 3 ' end, the primer is:
T1T2-F：5’—ATACTGCAGCCAAGCTTGGCTGTTTTGGC—3’；
T1T2-R：5’—TTAGGATCCCCCATTATTGAAGCATTTAT—3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 30s, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations; The fragment that obtains is connected with the BamHI double digestion through PstI and is connected with the pBluescript SK that cuts through same enzyme, obtains plasmid pBluescript SK T1T2.
The application of the efficient two homologous recombination vectors of above-mentioned cytoalgae in preparation timnodonic acid (EPA) and docosahexenoic acid (DHA).
The present invention by to 510bp fragment before the cytoalgae PCC6803psbA2 Gene A TG as the double upstream arm of doing of homologous recombination vector promotor, take psbA2 gene ORF fragment as downstream arm, gene Delta15 and Delta6 fatty acid dehydrogenase gene that cytoalgae PCC6803 fatty acid metabolism is relevant carry out overexpression, the expression of Delta15 and Delta6 fatty acid dehydrogenase gene among the enhancing cytoalgae PCC6803, turn that fatty acid content has considerable change among the cytoalgae PCC6803 of peanut thioester enzyme gene, and have stronger cold tolerance.
The inventor is according to the cytoalgae PCC6803 fatty acid dehydrogenase gene sequence (Delta15:D13780.1 that before logged in Genbank; DeltaDelta6:L11421.1), pass through PCR method, two class cytoalgae PCC6803 fatty acid dehydrogenase gene coding region full length sequences increase, wherein Delta15 full length gene sequence is 1080 bases, 359 amino acid of encoding, Delta6 full length gene sequence is 1080 bases, 359 amino acid of encoding.To clone respectively Delta15 fatty acid dehydrogenase gene (Delta15) and Delta 15 and Delta 6 fatty acid dehydrogenase genes is connected on the two homologous recombination expression vector pBluescript SK T1T2-npt-downstream that build, and be converted among the cytoalgae PCC6803, obtain transgenic Synechocystis.Oleic acid content is apparently higher than wild-type in transgenic Synechocystis.
The present invention be used for to make up the photoinduction promoter psbA2 gene order of cytoalgae PCC6803 fatty acid dehydrogenase gene of two homologous recombination expression vectors shown in SEQ ID NO:1; Downstream arm psbA2ORF sequence is shown in SEQ ID NO:2; Intestinal bacteria T1T2 terminator sequence is shown in SEQ ID NO:3; The cDNA sequence of Delta15 is shown in SEQ ID NO:4, and aminoacid sequence is shown in SEQ ID NO:6; The cDNA sequence of Delta6 is shown in SEQ ID NO:5, and aminoacid sequence is shown in SEQ ID NO:7.
Beneficial effect
(1) the invention provides the two homologous recombination vectors of a kind of cytoalgae PCC6803 and construction process and application, the 510bp fragment was as the double upstream arm of doing of promotor before this recombinant vectors utilized among the cytoalgae PCC6803 psbA2 Gene A TG, take psbA2 gene ORF fragment as downstream arm, gene Delta15 and Delta6 fatty acid dehydrogenase gene that cytoalgae PCC6803 fatty acid metabolism is relevant carry out overexpression, the result shows, crosses expression cytoalgae PCC6803Delta 15 in cytoalgae PCC6803, Delta15 and Delta 6 fatty acid desaturase genes can obviously improve the content of therapic acid in the cytoalgae;
(2) the present invention crosses expression Delta15 and Delta6 fatty acid dehydrogenase gene first in cytoalgae PCC6803, for improve cytoalgae PCC6803 total fatty acid content, to strengthen its biomass significant, for the research of polyunsaturated fatty acid among the cytoalgae PCC6803 provides theoretical support;
(3) gene of using among the present invention can provide support for the research of little algae and vegetable fatty acid, provides theoretical foundation and experimental program for carrying out scale operation EPA and DHA.
Description of drawings
Fig. 1 is the two homologous recombination vector structure iron of cytoalgae PCC6803;
Fig. 2 is 30 ℃ and raises together with the Western blot electrophorogram of Delta15 fatty acid dehydrogenase gene in transgenic Synechocystis PCC6803 under the condition;
Wherein: 1, wild-type cytoalgae PCC6803; 2, transgenic alga pSDSy15;
Fig. 3 is 20 ℃ and raises together with the Western blot electrophorogram of Delta15 fatty acid dehydrogenase gene in transgenic Synechocystis PCC6803 under the condition;
Wherein: 1, wild-type cytoalgae PCC6803; 2, transgenic alga pSDSy15;
Fig. 4 is 30 ℃ and raises together with the Western blot electrophorogram that Delta15 fatty acid desaturase gene and Delta6 fatty acid dehydrogenase gene are expressed under the condition in transgenic Synechocystis PCC6803;
Wherein: 1: wild-type cytoalgae PCC6803; 2: transgenic alga pSDSy15Sy6;
Fig. 5 is 30 ℃ and raises together with the Western blot electrophorogram that Delta15 fatty acid desaturase gene and Delta6 fatty acid dehydrogenase gene are expressed under the condition in transgenic Synechocystis PCC6803;
Wherein: 1: wild-type cytoalgae PCC6803; 2: transgenic alga pSDSy15Sy6;
Fig. 6 is 30 ℃ and raises together with the expression analysis of Delta15 fatty acid dehydrogenase gene in turning Delta15 fatty acid dehydrogenase gene cytoalgae PCC6803 under the condition;
Fig. 7 is 20 ℃ and raises together with the expression analysis of Delta15 fatty acid dehydrogenase gene in turning Delta15 fatty acid dehydrogenase gene cytoalgae PCC6803 under the condition;
Fig. 8 is 30 ℃ and raises together with and turn cytoalgae PCC6803Delta15 fatty acid desaturase gene and the expression analysis of Delta6 fatty acid dehydrogenase gene in turning Delta15 and Delta6 fatty acid dehydrogenase gene cytoalgae PCC6803 under the condition;
Fig. 9 is 20 ℃ and raises together with and turn cytoalgae PCC6803Delta15 fatty acid desaturase gene and the expression analysis of Delta6 fatty acid dehydrogenase gene in turning Delta15 and Delta6 fatty acid dehydrogenase gene cytoalgae PCC6803 under the condition;
Figure 10 is 30 ℃ and raises together with and turn the gas chromatographic analysis of cytoalgae Delta15 fatty acid desaturase gene algae strain fatty acid component under the condition;
Figure 11 is 20 ℃ and raises together with and turn the gas chromatographic analysis of cytoalgae Delta15 fatty acid desaturase gene algae strain fatty acid component under the condition;
Figure 12 is 30 ℃ and raises together with and turn cytoalgae Delta15 fatty acid desaturase gene and the gas chromatographic analysis of Fad6 gene algae strain fatty acid component under the condition;
Figure 13 is 20 ℃ and raises together with and turn cytoalgae Delta15 fatty acid desaturase gene and the gas chromatographic analysis of Fad6 gene algae strain fatty acid component under the condition.
Embodiment
Below in conjunction with Figure of description and embodiment technical scheme of the present invention is described further, but institute of the present invention protection domain is not limited to this.
The experiment material source:
Coli strain (Escherichia coli) DH5 α and T3 carrier are available from the Beijing Quanshijin Biotechnology Co., Ltd;
Wild-type cytoalgae PCC6803 is available from typical case's culture collection council of Chinese Academy of Sciences algae kind storehouse;
Plasmid pKK233-2 is available from Clontech company;
Plasmid pSDpbluescript SK is available from Tianjin Bo Meike Bioisystech Co., Ltd;
Plasmid PUC4k is available from Chinese plasmid vector strain cell pnca gene preservation center;
Other employed enzyme, reagent and test kit etc. are the commercially available prod.
Separating clone is used for making up cytoalgae Delta15 fatty acid desaturase gene Delta15 and the cDNA fragment of Fad6 gene Delta6, two homologous recombination fragment psbA2 promotor, psbA2ORF cDNA fragment and the intestinal bacteria terminator T1T2cDNA fragment that turns cytoalgae PCC6803 expression vector.
The psbA2 promoter gene fragment clone of cytoalgae PCC 6803:
The cytoalgae PCC 6803(accession number that logs in according to GenBank: BA000022, AP012205) psbA2ORF front end primers in, with 500bp before the psbA2ORF as promoter sequence (sequence such as SEQ ID NO:1, shown in the Synchocystis sp.PCC6803), design PCR primer:
Promotor-F:5’-GATGTCGACGCTTTAGCGTTCCAGTG-3’，
Promotor-R：5’-CATTTGGTTATAATTCCTT?ATGTAT-3’，
Amplification program is as follows: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations; 72 ℃ are extended 10min, 4 ℃ of preservations.
Carry out electrophoresis after PCR reaction finishes and cut glue and reclaim, transform bacillus coli DH 5 alpha after being connected to the T3 carrier, screening positive clone and order-checking obtain the psbA2 promoter gene fragment of cytoalgae PCC 6803.
Cytoalgae PCC6803psbA2ORF gene fragment clone:
The cytoalgae PCC6803(accession number that logs in according to GenBank: BA000022, AP012205, sequence such as SEQ ID NO:2 are shown in the Synchocystis sp.PCC6803) in psbA2ORF cDNA primers:
psbA2-F：5’-CTTCATATGCCGCGGATGACAACGACTCTCCAAC-3’；
psbA2-R：5’-AGTGAGCTCTTAACCGTTGACAGCAGG-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 58 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations; 72 ℃ are extended 10min, 4 ℃ of preservations.
Carry out electrophoresis after PCR reaction finishes and cut glue and reclaim, transform bacillus coli DH 5 alpha, screening positive clone and order-checking after being connected to the T3 carrier.Obtain cytoalgae PCC6803psbA2ORF gene fragment.
Intestinal bacteria T1T2 terminator fragment clone:
The intestinal bacteria T1T2(U02439.1 that logs in according to GenBank) fragment sequence (sequence such as SEQ ID NO:3) design primer:
T1T2-F：5’-ATACTGCAGCCAAGCTTGGCTGTTTTGGC-3’；
T1T2-R：5’-TTAGGATCCCCCATTATTGAAGCATTTAT-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 30s, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations;
Gene fragment Promotor+Delta15 clone:
According to the cytoalgae PCC6803Delta15 sequence of announcing in the GenBank database (accession number is: D13780.1) design of amplification primers, the primer is:
Sy15-F：5’-TAAGGAATTATAACCAAATGCGTCTAGAAATTTCATCG-3’；
Sy15-R：5’-CGGCTGCAGTTACTTATCGTCGTCATCCTTGTAATCAGGTTTCTTTTGATATC-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations; 72 ℃ of 10min, 4 ℃ of preservations.
Carry out electrophoresis after the PCR reaction finishes and cut the glue recovery, obtain the Delta15 gene fragment of cytoalgae PCC6803.
Get respectively psbA 2 promoter gene fragments and Delta15 gene fragment 2 μ l are template, merge the PCR reaction, amplification program is: 94 ℃ of 5min; 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 5min, 2 circulations; Add each 0.5 μ l of primer Promotor-F and Delta15-R, carry out following amplification program: 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 3min, 25 circulations; 72 ℃ of 10min, 4 ℃ of preservations.Transform bacillus coli DH 5 alpha after being connected to T3 carrier cloning carrier, screening positive clone and order-checking.Obtain gene fragment Promotor+Delta15.
Gene fragment Promotor+Delta6 clone:
According to the cytoalgae PCC6803 that announces in the GenBank database contain the Delta6 sequence (accession number is: L11421.1) design of amplification primers, the primer is:
Sy6-F：5’-TAAGGAATTATAACCAAATGCTAACAGCGGAAAG-3’；
Sy6-R：5’-GTCCTGCAGTCAATGATGATGATGATGATGCGATGCTTTGCCCATGGCCT-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
Carry out electrophoresis after the PCR reaction finishes and cut the glue recovery, obtain the Delta6 gene fragment of cytoalgae PCC6803.
Get respectively psbA 2 promotors and Delta6 gene fragment 2 μ l are template, merge the PCR reaction, program thereby is: 94 ℃ of 5min; 94 ℃ of 1min, 55 ℃ of 1min, 72 ℃ of 5min, 2 circulations; Add each 0.5 μ l of primer Promotor-F and Delta15-R, carry out following amplification program: 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 3min, 25 circulations, 72 ℃ of 10min, 4 ℃ of preservations.Transform bacillus coli DH 5 alpha after being connected to T3 carrier cloning carrier, screening positive clone and order-checking.Obtain gene fragment Promotor+Delta6.
Turn structure and the conversion of the two homologous recombination expression vectors of cytoalgae PCC6803
Make Delta15 gene fragment and the Delta6 gene fragment of overexpression cytoalgae PCC6803 in cytoalgae PCC6803 by crossing expression technology, according to the phenotype of transgenic positive cytoalgae and the two homologies of lipid acid composition research cytoalgae PCC6803 from group Vector construction method and the application lipid acid is synthetic.
The preparation of plasmid pBluscript SK plus-T1T2:
The plasmid pKK233-2(of amplification intestinal bacteria T1T2 terminator is available from Clontech company), introduce the PstI restriction enzyme site at its 5 ' end, introduce the BamHI restriction enzyme site at its 3 ' end, the primer is:
T1T2-F：5’—ATACTGCAGCCAAGCTTGGCTGTTTTGGC—3’；
T1T2-R：5’—TTAGGATCCCCCATTATTGAAGCATTTAT—3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 30s, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations; Obtain gene fragment and be connected with the BamHI double digestion through PstI and be connected with the pBluescript SK that cuts through same enzyme, obtain plasmid pBluescript SK T1T2.
The construction process that turns cytoalgae PCC6803 expression vector is as follows:
PsbA2ORF positive colony (containing the psbA2ORF gene fragment) SacII and SacI double digestion with embodiment 1 makes reclaim the psbA2ORF gene fragment; The double digestion plasmid pBluescript SK T1T2 that uses the same method reclaims carrier segments 1.Do ligation with the psbA2ORF gene fragment and the carrier segments 1 that reclaim, transform bacillus coli DH 5 alpha.By screening positive clone, obtain the carrier in early stage, called after pBluescript SK T1T2-downstream.
With plasmid PUC4k BamHI single endonuclease digestion, reclaim kalamycin resistance npt fragment, plasmid pBluescript SKT1T2-downstream BamHI single endonuclease digestion reclaims carrier segments 2.Do ligation with the npt fragment and the carrier segments 2 that reclaim, transform bacillus coli DH 5 alpha, cut screening positive clone by enzyme, obtain the kalamycin resistance carrier, called after pBluescript SK T1T2-npt-downstream.
The positive colony Promotor+Delta15, the Promotor+Delta6 plasmid DNA that obtain among the embodiment 1 are cut with the SalI enzyme respectively, reclaim gene fragment Promotor+Delta15 and gene fragment Promotor+Delta6.Equally, the plasmid pBluescript SK T1T2-npt-downstream that contains the T1T2 terminator and have a kalamycin resistance is carried out Sal I single endonuclease digestion, reclaim carrier segments 3.Respectively gene fragment Promotor+Delta15 and gene fragment Promotor+Delta6 and carrier segments 3 are done ligation, transform bacillus coli DH 5 alpha.Cut screening positive clone by enzyme, obtain cytoalgae PCC6803 prokaryotic expression carrier, called after expression vector pSDSy15(sees Figure 1A respectively), expression vector pSDSy6.The pSDSy6 plasmid behind NdeI and SacII double digestion, is connected into respectively the plasmid through the pSDSy15 of identical double digestion, obtains the pSDSy15Sy6 plasmid (seeing Figure 1B) of tandem expression.
By Natural Transformation method (Williams, J.G.K. (1988) Construction of specific mutationsin photosystem II photosynthetic reaction center by genetic engineering methods inSynechocystis 6803.Methods Enzymol.167:766-778.) carrier that builds is imported among the cytoalgae PCC6803, through antibiotic-screening, identify to obtain the transgenic positive cytoalgae.
Concrete steps: the cytoalgae PCC680330ml of the incubation period of taking the logarithm (OD730=0.6) is in room temperature, and the centrifugal 8min of 4500g abandons supernatant; After adding fresh BG-11 liquid nutrient medium washing once, add fresh BG-11 liquid nutrient medium to final concentration OD730=4.8, and be used at once transforming; The algae liquid of collecting divided install to (every pipe 400 μ l) in the 1.5ml EP pipe, every pipe adds 5-10 μ g plasmid, and the illumination incubation is 6 hours under the low light condition, during rock once.Mixture is coated onto on the BG-11 plate culture medium that contains that microbiotic of card (12 μ g/ml).About 10 days visible transformants.Make the transgenic Synechocystis PCC6803 that contains expression vector pSDSy15, the transgenic Synechocystis PCC6803 that contains expression vector pSDSy15Sy6.
Delta15 and Delta6 gene expression amount level detection in the transgenic Synechocystis positive plant
Take the transgenic Synechocystis PCC6803 that contains expression vector pSDSy15, the transgenic Synechocystis PCC6803 that contains expression vector pSDSy15Sy6 and wild-type cytoalgae PCC6803 as material, extract total RNA and carry out Real time quantitative pcr analysis.Concrete grammar is as follows:
Adopt TRIZOL reagent (available from Invitrogen company) and utilize the liquid nitrogen grinding method from the cytoalgae of Delta15 and Delta15+Delta6 gene and wild-type cytoalgae, to extract total RNA.Concrete operation step is as follows: get the blue-green algae of 50mlOD=1.8,4 ℃, the centrifugal 10min of 5000rpm collects frustule, be ground in the liquid nitrogen in the planar rear adding 1.5ml centrifuge tube of fine powder, add rapidly 1ml TRIZOL(available from Invitrogen company), put upside down mixing, room temperature leaves standstill 5min, and 4 ℃, the centrifugal 10min of 11900rpm, get supernatant liquor to new 1.5ml centrifuge tube, add 200 μ l trichloromethanes, with hand concuss 15s, leave standstill 3～5min, 4 ℃, the centrifugal 10～15min of 11900rpm.Get supernatant in new 1.5ml centrifuge tube, add the 500ml Virahol, put upside down mixing after room temperature leave standstill 10min.4 ℃, the centrifugal 10min of 11900rpm.Remove supernatant, add 1ml 75% ethanol (v/v), put upside down vibration several times, 4 ℃, the centrifugal 10min of 7500rpm.Abandon supernatant, the room temperature lower open mouth dries to precipitation transparent, adds an amount of DEPC-H
2The O dissolution precipitation makes cytoalgae and the total RNA of wild-type cytoalgae PCC6803 of Delta15 gene fragment and Delta15+Delta6 gene fragment.
Take the cytoalgae of the above-mentioned Delta15 gene fragment that makes and Delta15+Delta6 gene fragment and the total RNA of wild-type cytoalgae PCC6803 as template, the PrimeScriptTM RT-PCRKit reverse transcription of producing with TaKaRa company becomes cDNA.Concrete operation step is as follows:
Add successively 1 μ l Oligo dT Primers(2.5 μ M), 1 μ l dNTP Mixture(10mM), the total RNA of 2 μ g and DEPC-H
2O to 10 μ l.On the PCR instrument 65 ℃, 5min carries out the sex change annealing reaction, centrifugal 20s second, add successively 4 μ l, 5 * PrimeScript Buffer, 0.5 μ l RNase Inhibitor (40U/ μ l), 0.5 μ l PrimeScript RTase (for 2step) and 5 μ l RNase Free ddH
2O, 95 ℃ of 5min behind 42 ℃ of 30min namely obtain the first chain cDNA; Take the first chain cDNA of obtaining as template, take cytoalgae PCC6803rnpB gene as reference gene, with the PrimeScript RT reagent Kit(Perfect Real Time of TaKaTa company) carry out Real-time quantitative PCR and detect.Wherein cytoalgae PCC6803rnpB confidential reference items base primer sequence is:
Upstream P1:5 '-GTGAGGACAGTGCCACAGAA-3 ';
Downstream P2:5 '-TGCACCCTTACCCTTTTCAG-3 ';
The Real-time quantitative PCR primer sequence of Delta15 gene is:
Upstream P3:5 '-CGTACTCACCATGCCAACAC-3 ';
Downstream P4:5 '-AGGCGATCAGAGGCAAGTAA-3 ';
The Real-time quantitative PCR primer sequence of Delta6 gene is:
Upstream P5:5 '-CTGGGCATGACCTACGATTT-3 ';
Downstream P6:5 '-ATACGTACTGCGCCATCTCC-3 '.
Real-time quantitative PCR concrete operation step is as follows:
Add successively 12.5 μ l, 2 * SYBR premix Ex Taq
(TM), each 1.0 μ l, cDNA template 2.0 μ l and 8.5 μ l ddH of upstream and downstream primer
2O.95 ℃ of denaturation 1min; 95 ℃ of 10s, 60 ℃ of 30s, 72 ℃ of 30s, 42 circulations; 95 ℃ of 10s, 58 ℃ of 30s, 72 ℃ of 5min; 55 ℃ of 1s, 81 circulations detect once every 0.5s.
Delta15 and Delta6 protein level detect in the transgenic Synechocystis positive plant
Take the transgenic Synechocystis PCC6803 that contains expression vector pBluscrip-SD-Delta15, the transgenic Synechocystis PCC6803 that contains expression vector pBluscrip-SD-Delta15+Delta6 and wild-type cytoalgae PCC6803 as material, extract the algae total protein, utilize Western blot method to detect Delta15 and Delta6 protein level in the transgenic positive cytoalgae.Concrete grammar is as follows:
Get the Tris-Cl(pH8.0 that 5mL 40mM is used in the centrifugal collection of frustule afterwards) suspend, then add an amount of diameter and be granulated glass sphere (available from sigma company) about 0.17mm has 0.5mL to top, granulated glass sphere interface suspension.Shake 1min by the vortex vibrator with maximum rate, then place 1min on ice, so repeat 5 times.Collect supernatant at 4000rpm low-speed centrifugal 10min, more collected supernatant is carried out centrifugal 10min with higher rotation speed 6000rpm, collect supernatant.Namely obtain the frustule total protein.Get an amount of sample, add isopyknic 2 * BSA, boiled in the boiling water 10 minutes.Putting-20 ℃ after centrifugal deposits.The sample that takes a morsel, the dilution certain multiple (5 *, 10 *, 20 *), take 40mM Tris-Cl (pH8.0) for reference to blank, the survey protein concn.Utilize 10%SDS-PAGE to carry out protein electrophorese, each loading hole 50 μ g albumen.Electrophoresis is transferred to PVDF(Millipore, Billlerica, MA by marking method after finishing).Then carry out immunochemical analyses according to the people's such as He Qingfang method, and detection Delta15 and Delta6 protein level (Qingfang He etc., Eur.J.Bilchem., 1999,263,561-570).The result shows, in the transgenic Synechocystis, all detects Delta15 and Delta6 protein level, does not then have signal in the wild-type, sees Fig. 2,3,4,5.
Analysis of Fatty Acids Composition in the transgenic Synechocystis positive plant
At 30 ℃, 30 μ E.m
-2.s
-1Under the continuous light, get the transgenic Synechocystis PCC6803 that contains expression vector pSDSy15, the transgenic Synechocystis PCC6803 that contains expression vector pSDSy15Sy6 and wild-type cytoalgae, centrifugal rear collection thalline, 40 ℃ of dryings resemble stratographic analysis through the laggard promoting the circulation of qi of esterification; Concrete steps are as follows:
(1) takes by weighing an amount of sample in the anaerobism culture tube.
(2) add chloracetyl methyl alcohol 4mL.Chloracetyl: methyl alcohol=1:10(volume ratio).
(3) accurately add 1mL and contain target hexane solution in the C19:0.Interior mark concentration is 1mg/mL.
(4) cover tightly pipe lid, 80 ℃ of water-baths two hours.Taking-up is cooled to room temperature.
(5) the solution of potassium carbonate 5mL of adding 7%, vibration is evenly left standstill 10min, the centrifugal 5min layering of 1,000rpm.
(6) draw upper phase, carry out gas chromatographic analysis by the Ministry of Agriculture of Chinese agricultural university feed research centre.
PCC6803 compares with contrast wild-type cytoalgae, changes seeing Table 1 and table 2 at 30 ℃ and the 20 ℃ transgenic Synechocystis PCC6803 fatty acid content of raising together with the transgenic Synechocystis PCC6803 that contains expression vector pSDSy15 under the condition, containing expression vector pSDSy15Sy6.
Table 1
Table 2
Interpretation of result
In cytoalgae PCC6803, cross and express the total fatty acid content that Delta15 fatty acid desaturase gene among the cytoalgae PCC6803 has reduced cytoalgae.Raise together with under the condition for 30 ℃, wild-type cytoalgae PCC6803 total fatty acids output is the 75.201mg/g(dry weight, and is lower same), transgenosis bacterial strain pSDSy15 total fatty acid content 50.755mg/g, PCC6803 has reduced by 32.5% than the wild-type cytoalgae.And 20 ℃ raised together with under the condition, transgenosis bacterial strain pSDSy15 total fatty acid content 60.760mg/g, and PCC6803 has increased by 19.1% than the wild-type cytoalgae.
Raise together with under the condition for 30 ℃, C18:1 content 7.07% among the wild-type cytoalgae PCC6803, C18:2 content are that 13.59%, C18:3n6 is that 16.26%, C18:3n3 content is that 1.45%, C18:4 content is 1.20%.And 20 ℃ raised together with under the condition, and its content then is respectively 3.94%, 16.75%, 14.72%, 2.23% and 1.54%.These several fatty effect of acids of overexpression cytoalgae Delta15 fatty acid desaturase gene pairs are completely different in cytoalgae PCC6803.
In cytoalgae PCC6803, cross and express the content (table 1) that cytoalgae PCC6803Delta15 fatty acid desaturase gene has significantly reduced C18:1, C18:2 and C18:3n6.Raise together with under the condition at 30 ℃, C18:1, C18:2 and C18:3n6 content are reduced to respectively 2.73%, 2.80% and 0.30% among the pSDSy15-11.And 20 ℃ raised together with under the condition, and C18:1, C18:2 and C18:3n6 content then are reduced to respectively 3.27%, 1.94% and 0.23%.
Delta15 lipid acid supersaturation enzyme gene has significantly improved the content (table 1, Figure 10, Figure 11) of C18:3n3 and C18:4 among the overexpression cytoalgae PCC6803 in cytoalgae PCC6803.Raise together with under the condition at 30 ℃, C18:3n3 and C18:4 content increase to respectively 17.52% and 9.11% among the pSDSy15, and comparing with wild-type has increased respectively nearly 11 times and 7 times.And 20 ℃ raised together with under the condition, increases to respectively 23.05% and 10.77%, increased nearly 8 times and 6 times.
Tandem expression cytoalgae PCC6803Delta15 and Fad6 gene have reduced the total fatty acid content of cytoalgae equally in cytoalgae PCC6803.Raise together with under the condition for 30 ℃, total fatty acid content is 63.071mg/g among the transgenosis bacterial strain pSDSy15Sy6, and PCC6803 has reduced by 16.1% than the wild-type cytoalgae.And 20 ℃ raised together with under the condition, transgenosis bacterial strain pSDSy15Sy6 total fatty acid content 57.130mg/g, and PCC6803 has reduced by 6.0% than the wild-type cytoalgae.
Tandem expression cytoalgae PCC6803Delta15 and Fad6 gene have significantly reduced the content (table 2) of C18:1, C18:2 and C18:3n6 in cytoalgae PCC6803.Raise together with under the condition at 30 ℃, C18:1, C18:2 and C18:3n6 content are reduced to respectively 4.10%, 2.57% and 0.21% among the pSDSy15Sy6.And 20 ℃ raised together with under the condition, and C18:1, C18:2 and C18:3n6 content then are reduced to respectively 2.28%, 1.30% and 0.19%.
Tandem expression cytoalgae PCC6803Delta15 and Fad6 gene have significantly improved the content (table 2, Figure 12, Figure 13) of C18:3n3 and C18:4 in cytoalgae PCC6803.Raise together with under the condition at 30 ℃, C18:3n3 and C18:4 content increase to respectively 23.64% and 7.76% among the pSDSy15Sy6, and comparing with wild-type has increased respectively nearly 15 times and 6 times.And 20 ℃ raised together with under the condition, increases to respectively 16.35% and 13.12%, increased nearly 6 times and 8 times.
Can find out from table 1 and 2, pSDSy15 compares with transgenic Synechocystis, the major part that affects of expressing Delta15 fatty acid desaturase gene and tandem expression cytoalgae PCC6803Delta15 and Fad6 gene pairs algae strain fatty acid component in cytoalgae PCC6803 is identical, but different.Something in common is and the person can both improve the content of C18:3n3 and C18:4, can both reduce C18:1, C18:2 and C18:3n6 content.Difference is different on the impact of C18:3n3 and C18:4, and it is higher by 34.9% than pSDSy15 to raise together with under the condition among the transgenic alga pSDSy15Sy6 C18:3n3 content at 30 ℃, but C18:4 content is then than pSDSy15 low 17.4%; And it is lower by 41.0% than pSDSy15 to raise together with under the condition among the transgenic alga pSDSy15Sy6 C18:3n3 content at 20 ℃, but C18:4 content is then high by 21.8% than pSDSy15.
Claims (9)
1. efficient two homologous recombination vectors of cytoalgae, nucleotide sequence is shown in SEQ ID NO.8 or SEQ ID NO.9.
2. the construction process of the efficient two homologous recombination vectors of the described cytoalgae of claim 1 is characterized in that step is as follows:
(1) the front 510bp gene fragment of the psbA2 Gene A TG of pcr amplification cytoalgae PCC 6803 is as psbA2 promoter gene fragment, the Genbank accession number is the psbA2ORF gene fragment of the cytoalgae PCC 6803 of X13547.1, the Genbank accession number is the intestinal bacteria terminator T1T2 gene fragment of U02439.1, the Genbank accession number is the cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene fragment of D13780.1 and the cytoalgae PCC6803Delta6 fatty acid dehydrogenase gene fragment that the Genbank accession number is L11421.1;
(2) the psbA2 promoter gene fragment that step (1) is obtained merges pcr amplification with cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene fragment and the cytoalgae PCC6803Delta6 fatty acid dehydrogenase gene fragment that step (1) makes respectively, makes respectively gene fragment Promotor+Delta 15 and gene fragment Promotor+Delta 6;
(3) the intestinal bacteria terminator T1T2 gene fragment that step (1) is made is connected with the BamHI double digestion with PstI and is connected with the pBluescript SK that cuts through same enzyme, obtains plasmid pBluescript SK T1T2;
Then the psbA2ORF gene fragment that step (1) is made is connected with the SacI double digestion with SacII and is connected with the plasmid pBluescript SK T1T2 that cuts through same enzyme, obtains plasmid pBluescript SK T1T2-downstream;
Plasmid pBluescript SK T1T2-downstream and plasmid pUC4K are carried out the BamHI single endonuclease digestion, reclaim respectively the npt fragment among pBluescript SK T1T2-downstream carrier segments and the pUC4K behind the electrophoresis, to being connected with the npt fragment behind the carrier segments dephosphorylation, obtain plasmid pBluescript SK T1T2-npt-downstream;
(4) the gene fragment Promotor+Delta15 that step (2) is made, perhaps, among the plasmid pBluescript SKT1T2-npt-downstream that gene fragment Promotor+Delta15 and gene fragment Promotor+Delta6 inserting step (3) make, make recombinant vectors;
(5) recombinant vectors that step (4) is made is converted among the cytoalgae PCC6803, makes transgenic Synechocystis;
(6) transgenic Synechocystis that step (5) is made aerated culture 8～12 days under 20～30 ℃ of conditions makes the cytoalgae PCC6803 of high fatty acid content.
3. construction process as claimed in claim 2 is characterized in that, in the described step (1), the primer of pcr amplification psbA2 promoter gene fragment is:
Promotor-F:5’-GATGTCGACGCTTTAGCGTTCCAGTG-3’；
Promotor-R：5’-CATTTGGTTATAATTCCTTATGTAT-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 55 ℃ of renaturation 30s, 72 ℃ are extended 30s, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
4. construction process as claimed in claim 2 is characterized in that, in the described step (1), the psbA2ORF gene fragment of pcr amplification cytoalgae PCC6803 is introduced the SacII restriction enzyme site at its 5 ' end, introduces the SacI restriction enzyme site at its 3 ' end, and the primer is:
psbA2-F：5’-CTTCATATGCCGCGGATGACAACGACTCTCCAAC-3’；
psbA2-R：5’-AGTGAGCTCTTAACCGTTGACAGCAGG-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
5. construction process as claimed in claim 2 is characterized in that, in the described step (1), the primer of pcr amplification cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene is:
Sy15-F：5’-TAAGGAATTATAACCAAATGCGTCTAGAAATTTCATCG-3’；
Sy15-R：5’-CGGCTGCAGTTACTTATCGTCGTCATCCTTGTAATCAGGTTTCTTTTGATATC-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
6. construction process as claimed in claim 2 is characterized in that, in the described step (1), the primer of pcr amplification peanut thioester enzyme gene Delta6 is:
Sy6-F：5’-TAAGGAATTATAACCAAATGCTAACAGCGGAAAG-3’；
Sy6-R：5’-GTCCTGCAGTCAATGATGATGATGATGATGCGATGCTTTGCCCATGGCCT-3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 1min, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations.
7. construction process as claimed in claim 2, it is characterized in that, the front 510bp nucleotide sequencing of the psbA2 Gene A TG of cytoalgae PCC 6803 is shown in SEQ ID NO.1 in the described step (1), shown in the nucleotide sequence SEQ ID NO.2 of cytoalgae PCC6803psbA2ORF gene psbA2, the nucleotide sequence of cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene Sy15 is shown in SEQ ID NO.3, and the nucleotide sequence of cytoalgae PCC6803Delta15 fatty acid dehydrogenase gene Sy6 is shown in SEQ ID NO.4.
8. construction process as claimed in claim 2 is characterized in that, the preparation method of plasmid pBluescript SKT1T2 in the described step (3) is specific as follows:
The plasmid pKK233-2 of amplification intestinal bacteria T1T2 terminator introduces the PstI restriction enzyme site at its 5 ' end, introduces the BamHI restriction enzyme site at its 3 ' end, and the primer is:
T1T2-F：5’—ATACTGCAGCCAAGCTTGGCTGTTTTGGC—3’；
T1T2-R：5’—TTAGGATCCCCCATTATTGAAGCATTTAT—3’；
Amplification program is as follows: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 30s, 60 ℃ of renaturation 30s, 72 ℃ are extended 30s, after 35 circulations, 72 ℃ of 10min, 4 ℃ of preservations; The fragment that obtains is connected with the BamHI double digestion through PstI and is connected with the pBluescript SK that cuts through same enzyme, obtains plasmid pBluescript SK T1T2.
9. the application of the efficient two homologous recombination vectors of the described cytoalgae of claim 1 in preparation timnodonic acid and docosahexenoic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210529044.4A CN103014053B (en) | 2012-12-10 | 2012-12-10 | Synechocystis efficient double homologous recombinant vector as well as construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210529044.4A CN103014053B (en) | 2012-12-10 | 2012-12-10 | Synechocystis efficient double homologous recombinant vector as well as construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103014053A true CN103014053A (en) | 2013-04-03 |
| CN103014053B CN103014053B (en) | 2014-01-22 |
Family
ID=47963168
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210529044.4A Expired - Fee Related CN103014053B (en) | 2012-12-10 | 2012-12-10 | Synechocystis efficient double homologous recombinant vector as well as construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103014053B (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243124A (en) * | 2013-05-31 | 2013-08-14 | 山东省农业科学院高新技术研究中心 | Method for producing caffeic acid by using blue algae |
| CN106399114A (en) * | 2016-06-23 | 2017-02-15 | 华南理工大学 | Method for improving ethanol tolerance of synechocystis PCC6803 and application |
| CN107779462A (en) * | 2016-08-29 | 2018-03-09 | 中国科学院上海生命科学研究院 | Double homologous recombination pedigree tracer techniques |
| CN109022285A (en) * | 2018-07-25 | 2018-12-18 | 华南理工大学 | A kind of method and application improving DNC wireless ammonium salt tolerance |
| CN109197781A (en) * | 2018-09-14 | 2019-01-15 | 徐州医科大学 | The construction method of AURKA-CKO1-N conditional gene knockout mouse model |
| CN110684704A (en) * | 2019-10-11 | 2020-01-14 | 天津科技大学 | Gene engineering strain of synechocystis PCC6803 for producing cellulase and construction method thereof |
| CN110950941A (en) * | 2019-12-31 | 2020-04-03 | 山东省农业科学院生物技术研究中心 | Application of ssl2084 gene in synthesis of medium-long chain fatty acid |
| CN112048460A (en) * | 2020-08-07 | 2020-12-08 | 中国科学院水生生物研究所 | Engineered sphingomyelina gracilis and application thereof in production of GLA |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127563A (en) * | 2010-01-15 | 2011-07-20 | 中国科学院青岛生物能源与过程研究所 | Method for expressing exogenous gene by using synechocystis pevalekii PCC6803 |
-
2012
- 2012-12-10 CN CN201210529044.4A patent/CN103014053B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127563A (en) * | 2010-01-15 | 2011-07-20 | 中国科学院青岛生物能源与过程研究所 | Method for expressing exogenous gene by using synechocystis pevalekii PCC6803 |
Non-Patent Citations (2)
| Title |
|---|
| CHAUVAT ET AL: "A host-vestor system for gene cloning in the cyanobacterium Synechocystis PCC6803", 《MOL.GEN.GENET》, vol. 204, no. 1, 31 December 1986 (1986-12-31), pages 185 - 191 * |
| XINYAO LIU, ET AL: "Fatty acid production in genetically modified cyanobacteria", 《PNAS》, vol. 108, no. 17, 26 April 2011 (2011-04-26), pages 1 - 6, XP055104582, DOI: doi:10.1073/pnas.1103014108 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243124B (en) * | 2013-05-31 | 2015-06-17 | 山东省农业科学院高新技术研究中心 | Method for producing caffeic acid by using blue algae |
| CN103243124A (en) * | 2013-05-31 | 2013-08-14 | 山东省农业科学院高新技术研究中心 | Method for producing caffeic acid by using blue algae |
| CN106399114B (en) * | 2016-06-23 | 2019-06-18 | 华南理工大学 | A kind of method and application improving DNC wireless ethanol tolerance ability |
| CN106399114A (en) * | 2016-06-23 | 2017-02-15 | 华南理工大学 | Method for improving ethanol tolerance of synechocystis PCC6803 and application |
| CN107779462A (en) * | 2016-08-29 | 2018-03-09 | 中国科学院上海生命科学研究院 | Double homologous recombination pedigree tracer techniques |
| CN107779462B (en) * | 2016-08-29 | 2021-06-04 | 中国科学院分子细胞科学卓越创新中心 | Double homologous recombination pedigree tracing technology |
| CN109022285A (en) * | 2018-07-25 | 2018-12-18 | 华南理工大学 | A kind of method and application improving DNC wireless ammonium salt tolerance |
| CN109197781A (en) * | 2018-09-14 | 2019-01-15 | 徐州医科大学 | The construction method of AURKA-CKO1-N conditional gene knockout mouse model |
| CN109197781B (en) * | 2018-09-14 | 2021-04-06 | 徐州医科大学 | Construction method of AURKA-CKO1-N conditional gene knockout mouse model |
| CN110684704A (en) * | 2019-10-11 | 2020-01-14 | 天津科技大学 | Gene engineering strain of synechocystis PCC6803 for producing cellulase and construction method thereof |
| CN110950941A (en) * | 2019-12-31 | 2020-04-03 | 山东省农业科学院生物技术研究中心 | Application of ssl2084 gene in synthesis of medium-long chain fatty acid |
| CN112048460A (en) * | 2020-08-07 | 2020-12-08 | 中国科学院水生生物研究所 | Engineered sphingomyelina gracilis and application thereof in production of GLA |
| CN112048460B (en) * | 2020-08-07 | 2023-06-16 | 中国科学院水生生物研究所 | Engineering Sphingomonas and application thereof in production of GLA |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103014053B (en) | 2014-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103014053B (en) | Synechocystis efficient double homologous recombinant vector as well as construction method and application thereof | |
| Niu et al. | A new inducible expression system in a transformed green alga, Chlorella vulgaris | |
| CN103014037B (en) | Method for improving content of fatty acid in synechocystis PCC6803 | |
| CN116286900B (en) | Acetic acid permease A gene RkAcpa and application thereof | |
| CN111527101A (en) | Photosynthetic organism gene regulation for improved growth | |
| CN105647822B (en) | Recombinant mortierella alpina for overexpression of omega-3 desaturase from phytophthora parasitica as well as construction method and application thereof | |
| CN102268432B (en) | Orotate phosphoribosyltransferase promoter, application, construct and vector | |
| Wang et al. | The chloroplast genetic engineering of a unicellular green alga Chlorella vulgaris with two foreign peptides co-expression | |
| CN102220359B (en) | Method for performing gene transformation of Schizochytrium aggregatum by medication by Agrobacterium tumefaciens | |
| CN110591993A (en) | Vibrio harveyi homologous recombination gene knockout method based on hydrochloric acid stimulation | |
| JP4221476B2 (en) | Plasmid cloned icosapentaenoic acid biosynthesis genes and cyanobacteria producing icosapentaenoic acid | |
| CN102776202A (en) | Cultivation method of male sterile plant | |
| CN102690836B (en) | Construction of transgenic flocculation microalgae and application of transgenic flocculation microalgae in microalgae recovery | |
| Cui et al. | Plastid Engineering of a Marine Alga, Nannochloropsis gaditana, for Co‐Expression of Two Recombinant Peptides | |
| WO2019113463A1 (en) | Improving algal lipid productivity via genetic modification of a tpr domain containing protein | |
| CN113736806A (en) | Gene for improving oil synthesis of marine nannochloropsis and application thereof | |
| CN103589737B (en) | A kind of microalgae triacylglycerol synthesis regulation gene and application thereof | |
| CN108753810B (en) | Application of transcriptional regulatory protein gene ORF2 | |
| EP4077346A1 (en) | Recombinant algae having high lipid productivity | |
| CN110029092B (en) | 3-glyceraldehyde phosphate dehydrogenase and application thereof | |
| CN113061541B (en) | Recombinant saccharomyces cerevisiae and application thereof in production of conjugated linoleic acid | |
| CN110499300B (en) | Beta-isopropylmalate dehydrogenase and application thereof in lipid synthesis | |
| CN102373189A (en) | Fatty acid synthesis-related protein and encoding gene and application thereof | |
| EP2441828B1 (en) | Algal bio-flocculation by inactivation of photoreceptors | |
| US10533232B2 (en) | Parasitic phytophthora-derived omega-3 fatty acid desaturase for synthesizing polyunsaturated fatty acids, carrier containing fatty acid desaturase, recombinant microorganisms, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140122 Termination date: 20171210 |