CN104293769B - A kind of delta8 desaturase new gene deriving from pavlova viridis - Google Patents
A kind of delta8 desaturase new gene deriving from pavlova viridis Download PDFInfo
- Publication number
- CN104293769B CN104293769B CN201410577637.7A CN201410577637A CN104293769B CN 104293769 B CN104293769 B CN 104293769B CN 201410577637 A CN201410577637 A CN 201410577637A CN 104293769 B CN104293769 B CN 104293769B
- Authority
- CN
- China
- Prior art keywords
- delta8
- desaturase
- viridis
- gene
- pavlova
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
Polyunsaturated fatty acid, such as timnodonic acid EPA and docosahexenoic acid DHA, the important nutrient being needed by human and can not self synthesizing. Be directed to can naturally synthesize EPA and DHA a kind of micro-algae-pavlova viridis (<i>pavlova</i><i>viridis</i>), the method clone that the application employs conserved regions sequence amplification and RACE combines obtains the gene of a kind of new delta8 fatty acid desaturase. Obtaining of this gene is that further knowledge and utility pole has the biosynthetic process of EPA and DHA of realistic meaning to provide foundation.
Description
Technical field
The application belongs to the technical field of gene clone separation, relates in particular to delta 8 desaturase genes and the separation method thereof of a kind of relevant polyunsaturated fatty acid synthesis deriving from micro-algae.
Background technology
Polyunsaturated fatty acid is the important nutritive substance of needed by human, and micro-algae becomes important Biological resources because being rich in polyunsaturated fatty acid. Pavlova viridis (Pavlovaviridis) is containing abundant EPA(timnodonic acid) and DHA(docosahexenoic acid), it is the good experiment material carrying out the relevant synthetic gene identification of polyunsaturated fatty acid and clone.
RACE full name rapid-amplificationofcDNAends is a kind of conventional technology being carried out cDNA end quick clone by PCR. This experiment adopts RACE technology to obtain the full length sequence of object mRNA fragment.
In the body of EPA and DHA of micro-algae in route of synthesis, what play most critical effect is that polyunsaturated fatty acid desaturase and polyunsaturated fatty acid extend the big enzyme class of enzyme two. But owing to it is the membranin being combined with endoplasmic reticulum, the research on a molecular scale of above-mentioned enzyme class is very limited. Wherein, delta8 desaturase is the key enzyme that catalysis eicosatrienoic acid generates eicosatetraenoic acid, this enzyme and delta9 extend enzyme and together form the bypass generating EPA by linolenic acid, and the product that this path can be avoided in conventional path because of it checks effect and have bigger researching value. There are several the delta8 desaturases coming from different plant species obtain separation and identify at present in micro-algae, but the homology enzyme of different plant species obviously all exists in sequence and structural difference, and then caused the difference of its enzymic activity and function. Therefore, from pavlova viridis, separation obtains the homology enzyme of its delta8 desaturase is supplementing very well this part resources for research, and the application just attempts to launch relevant work from this angle.
Summary of the invention
Pavlova viridis (Pavlova.viridis) is conventional micro-algae, purchased from Qingdao Haiyang institute of the Chinese Academy of Sciences.
The sepn process of pavlova viridis delta-8 delta 8 desaturase genes is:
(1) utilize this area routine mRNA extraction and isolation means obtain pavlova viridis total mRNA, and use primer OligodT taking this area conventional means by it reverse transcription as cDNA;
(2) using cDNA as template, carry out the amplification of conserved region gene according to the conservative property of delta8 desaturase homologous gene design primer P8F, P8R, its primer sequence is: P8F:5 '-CGTACGGGAGCGAGGCGCTG-3 '; P8R:5 '-CCCTGGATAGCTTTAGACGTG-3 '; PCR reaction conditions is: 94oC3min; 94oC30s,58oC30s,72oC1min, 30 circulations; 72oC10min; Obtained PCR primer size and it is about 530bp;
The amplified reaction of (3) 3 ' ends taking cDNA be template, use SMARTRACEcDNA amplification kit carry out, it may also be useful to amplimer respectively: UPM (10 �� universalprimermix); Des8-3CATGCGATACATGCCCACG. Grads PCR response procedures is: 94oC3min;94oC30s,72oC3min, 5 circulations; 94oC30s,70oC30s,72oC3min, 5 circulations; 94oC30s, 68oC30s, 72oC3min, 30 circulations; 72oC10min. Obtained PCR primer size and it is about 650bp.
The amplified reaction of (4) 5 ' ends uses total mRNA for template and uses SMARTRACEcDNA amplification kit to carry out, it may also be useful to primer be respectively: UPM5 ' (10 �� universalprimermix); GSP1GCGTCTCGCTCGCGTCCCT; GSP2
TCCCCCGTCGTATCACTC. Response procedures is: add GSP1 in mRNA after with 94oC3min;94oC30s,60oC30s,72oC1min reacts 1 circulation; Add TdT subsequently in 37oC reacts 30min and obtains particular end product; Then in system, add UPM5 ' and GSP2, complete reaction with following program: 94oC3min;94oC30s,72oC3min, 5 circulations; 94oC30s,70oC30s,72oC3min, 5 circulations; 94oC30s, 68oC30s, 72oC3min, 30 circulations; 72oC10min. Obtained object fragment and it is about 260bp.
Fragments all above is spliced after checking order after being all connected into pMD18T carrier.
(5) amplification of open reading frame: after obtain the total length of expressing gene through splicing, design upstream and downstream primer ATGAGGACGACGGCGACGGCGAC and TCACGCCGCTTTCAGTGCATGA respectively, obtain complete delta8 open reading frame fragment through pcr amplification. PCR reaction conditions is: 94oC3min; 94oC30s,60oC30s,72oC1min, 30 circulations; 72oC10min; Clip size is 1349bp.
Final gained from the total length polynucleotide sequence of the polyunsaturated fatty acid delta8 desaturase of the presumption of pavlova viridis as shown in SEQIDNO.1. The aminoacid sequence of this coded by said gene has higher sequence similarity (as shown in Figure 1) with the active region of the delta8 desaturase coming from Ostreococcustauri, and through the heterogenous expression functional verification in pichia spp, it was demonstrated that it is a kind of polyunsaturated fatty acid delta8 desaturase.
The application first from the genome of pavlova viridis separation obtain polyunsaturated fatty acid delta8 delta 8 desaturase genes, enriched the important genetic resources of such enzyme, for studying in the body of this enzyme further and external mechanism of action is laid a good foundation.
Accompanying drawing explanation
The comparison result (only showing the comparison result of catalytic active center sequence) of the aminoacid sequence coded by Fig. 1 SEQIDNo.1 and the delta8 desaturase from Cunninghamellaechinulata
Embodiment
The sepn process of pavlova viridis delta-8 delta 8 desaturase genes is:
(1) utilize this area routine mRNA extraction and isolation means obtain pavlova viridis total mRNA, and use primer OligodT taking this area conventional means by it reverse transcription as cDNA;
(2) using cDNA as template, carry out the amplification of conserved region gene according to the conservative property of delta8 desaturase homologous gene design primer P8F, P8R, its primer sequence is: P8F:5 '-CGTACGGGAGCGAGGCGCTG-3 '; P8R:5 '-CCCTGGATAGCTTTAGACGTG-3 '; PCR reaction conditions is: 94oC3min; 94oC30s,58oC30s,72oC1min, 30 circulations; 72oC10min; Obtained PCR primer size and it is about 530bp;
The amplified reaction of (3) 3 ' ends taking cDNA be template, use SMARTRACEcDNA amplification kit carry out, it may also be useful to amplimer respectively: UPM (10 �� universalprimermix); Des8-3CATGCGATACATGCCCACG. Grads PCR response procedures is: 94oC3min;94oC30s,72oC3min, 5 circulations; 94oC30s,70oC30s,72oC3min, 5 circulations; 94oC30s, 68oC30s, 72oC3min, 30 circulations; 72oC10min. Obtained PCR primer size and it is about 650bp.
The amplified reaction of (4) 5 ' ends uses total mRNA for template and uses SMARTRACEcDNA amplification kit to carry out, it may also be useful to primer be respectively: UPM5 ' (10 �� universalprimermix); GSP1GCGTCTCGCTCGCGTCCCT; GSP2
TCCCCCGTCGTATCACTC. Response procedures is: add GSP1 in mRNA after with 94oC3min;94oC30s,60oC30s,72oC1min reacts 1 circulation; Add TdT subsequently in 37oC reacts 30min and obtains particular end product; Then in system, add UPM5 ' and GSP2, complete reaction with following program: 94oC3min;94oC30s,72oC3min, 5 circulations; 94oC30s,70oC30s,72oC3min, 5 circulations; 94oC30s, 68oC30s, 72oC3min, 30 circulations; 72oC10min. Obtained object fragment and it is about 260bp.
Fragments all above is spliced after checking order after being all connected into pMD18T carrier.
(5) amplification of open reading frame: after obtain the total length of expressing gene through splicing, design upstream and downstream primer ATGAGGACGACGGCGACGGCGAC and TCACGCCGCTTTCAGTGCATGA respectively, obtain complete delta8 open reading frame fragment through pcr amplification. PCR reaction conditions is: 94oC3min; 94oC30s,60oC30s,72oC1min, 30 circulations; 72oC10min; Clip size is 1349bp.
(6) checking of delta8 desaturase function
After obtaining expressing gene fragment, by the subclone means that this area is conventional, this fragment is connected to carrier pPIC3.5k subsequently, obtain Pichia anomala expression plasmid pPIC3.5k-delta-8, subsequently by this plasmid and empty carrier respectively electricity be transformed in pichia spp to obtain GS115-8 and GS115-pPIC3.5K. Choose and get positive transformant and be inoculated in the test tube that 5mlBMGY liquid nutrient medium is housed, 29oC, 180rpm shaking table overnight incubation. Then the bacterium liquid drawing 500 �� l incubated overnight is seeded in the triangular flask of 50mlBMGY liquid nutrient medium, and normal CMC model reaches 4-6 to OD600. Centrifugal collection thalline, thalline is doubly transferred in BMMY liquid nutrient medium by dilution 4-6, makes initial nectar angle value reach 1.0. Adding final concentration in substratum is that the methyl alcohol of 0.5% and the substrate eicosatrienoic acid (n3 race) of 100 ��Ms start induction. The induced concentration that methyl alcohol maintains 0.5% is added every half a day. Centrifugal collection thalline after cultivation 96h, ultrasonic method is extracted lipid acid and is also carried out esterification, the composition change of gas chromatographic analysis lipid acid. The result of lipid acid change is as shown in table 1. By the result of table 1 it may be seen that restructuring bacterium has possessed the ability that eicosatrienoic acid (n3 race) synthesizes eicosatetraenoic acid (n3 race), show that the gene that we are cloned obtains is the encoding gene of a kind of new lipid acid delta8 desaturase.
Longer chain fatty acid composition (numerical value is content per-cent) of table 1 recombinant yeast pichia pastoris
ND represent measure less than
The above BMGY substratum consist of 1% yeast powder, 2% peptone, 1% glycerine, the 13.4%YNB of additional 1/10th volumes, 4*10-5The phosphate buffered saline buffer of the pH6.0 of % vitamin H and 1/10 volume.
The above BMMY substratum consist of 1% yeast powder, 2% peptone, the 13.4%YNB of additional 1/10th volumes, 4*10-5The phosphate buffered saline buffer of the pH6.0 of % vitamin H and 1/10 volume.
Specification sheets amino acid and nucleotides sequence list
SEQIDNO.1:
The gene order of the polyunsaturated fatty acid delta8 desaturase of P.viridis
ATGAGGACGACGGCGACGGCGACGCGGTTCGGATTTAGCGACGCCGCGGTACGAGGATGGACCACGGTGAAGATGGCAGACGGTTCGCTTGCAGTTCGCACGTTGAGCGTGCGGACGACGGGCGCGGACTATATTTCCGGCGAGGCCGACGTACGACGACGTGCCGGAGGGACGCGAGCGAGACGCGAAGGAACCGATCCGATTGAAGTGGTGACGAGTGATACGACGGGGGAGAGCTAGGCCCGTGGGGCCACGGCGCACTCGGGCGGTGGGCTGGTTCCTACTTCTTCGCTACGGGCGCGATGGGACGGATATTCTACGCGATGCCCTCGTACGGCCCGTACGGGAGCGAGGCGCTGCGGCGTGTGAGAAAGCCACTTGCTCGGAGCGATCCGCCCAAGGATGTGAGCCGAACACCGAGCAAACTGTCATACGGTGATCAAGGGTTCGGTGAGCTCCGCTTGACACCGTTCGGATTCTTTAAGCGGAACCCCGTGAAGGATCGACTTTGCACGGAACATTATGCCCGTCATTGTGCTCTGCGTTGTCGGAACGTACCTGATCTACTCGCGCCTTATTCTGGCCACCTATTCTGGDCATTTACTGGGCAGCGCGGCTGGACTGGGCCACGACTACCTCCACGGAGGGGACCGAGGTGCGACTCCATGCGATACATGCCCACGTTGGCTAACGCGCCTCGGTGGAGTGGTGATGCAATTGCACAGGATGCCAATCACACGTTCTCCAACGAGGAGCACCTCGATGGCGATATGGATGATGGATCCGTTGATACTACCGTACGCGTCGGGCACGTCCTAGACCACCCGATGCAGAAAGTATCACCACGTCTAAAGCTATCCAGGGCTTTCCATCATGTTATCGCTCTGGTCGATTCGACTCGTACATCACCACGGCGTGGGGAAGAAAAGATGTCGGTGAGCTCGCATCTTCGGAATGAATTGCCGTGAAGGAGAGAGTCGGCAGCGTGCTAGCTGGTGGTTTTTTTGTGGCCGTGGTGGTGACGGTGAACCACCAGACAGAGGAGATGATCGAATTTGGCGAGAGTGCGGAGTTCCTAGGGGGCCAACGCTCGACGTAACGCGACCAGAACGCGTCTTTGGGGGGCTCTTTACTTGCCTATGGCCTGGTATCGACACAGTATTGAGGAACATCATCTGTTCCCGACGATTGCGGCGGTACGTCTACCACACATCTTCGTCCCGCTCATAAAGTCTTGGGCCAAGGCGAAAGGGATCGAGTACCGCTCCTCGCCGAGCACGACCAGATCACCAAATATTTGACGTCTTGTGCACCGTTCCACTACGCCTCATGCACTGAAAGCGGCGTGA
SEQIDNO.1:
The gene order of the polyunsaturated fatty acid delta8 desaturase of P.viridis
ATGAGGACGACGGCGACGGCGACGCGGTTCGGATTTAGCGACGCCGCGGTACGAGGATGGACCACGGTGAAGATGGCAGACGGTTCGCTTGCAGTTCGCACGTTGAGCGTGCGGACGACGGGCGCGGACTATATTTCCGGCGAGGCCGACGTACGACGACGTGCCGGAGGGACGCGAGCGAGACGCGAAGGAACCGATCCGATTGAAGTGGTGACGAGTGATACGACGGGGGAGAGCTAGGCCCGTGGGGCCACGGCGCACTCGGGCGGTGGGCTGGTTCCTACTTCTTCGCTACGGGCGCGATGGGACGGATATTCTACGCGATGCCCTCGTACGGCCCGTACGGGAGCGAGGCGCTGCGGCGTGTGAGAAAGCCACTTGCTCGGAGCGATCCGCCCAAGGATGTGAGCCGAACACCGAGCAAACTGTCATACGGTGATCAAGGGTTCGGTGAGCTCCGCTTGACACCGTTCGGATTCTTTAAGCGGAACCCCGTGAAGGATCGACTTTGCACGGAACATTATGCCCGTCATTGTGCTCTGCGTTGTCGGAACGTACCTGATCTACTCGCGCCTTATTCTGGCCACCTATTCTGGDCATTTACTGGGCAGCGCGGCTGGACTGGGCCACGACTACCTCCACGGAGGGGACCGAGGTGCGACTCCATGCGATACATGCCCACGTTGGCTAACGCGCCTCGGTGGAGTGGTGATGCAATTGCACAGGATGCCAATCACACGTTCTCCAACGAGGAGCACCTCGATGGCGATATGGATGATGGATCCGTTGATACTACCGTACGCGTCGGGCACGTCCTAGACCACCCGATGCAGAAAGTATCACCACGTCTAAAGCTATCCAGGGCTTTCCATCATGTTATCGCTCTGGTCGATTCGACTCGTACATCACCACGGCGTGGGGAAGAAAAGATGTCGGTGAGCTCGCATCTTCGGAATGAATTGCCGTGAAGGAGAGAGTCGGCAGCGTGCTAGCTGGTGGTTTTTTTGTGGCCGTGGTGGTGACGGTGAACCACCAGACAGAGGAGATGATCGAATTTGGCGAGAGTGCGGAGTTCCTAGGGGGCCAACGCTCGACGTAACGCGACCAGAACGCGTCTTTGGGGGGCTCTTTACTTGCCTATGGCCTGGTATCGACACAGTATTGAGGAACATCATCTGTTCCCGACGATTGCGGCGGTACGTCTACCACACATCTTCGTCCCGCTCATAAAGTCTTGGGCCAAGGCGAAAGGGATCGAGTACCGCTCCTCGCCGAGCACGACCAGATCACCAAATATTTGACGTCTTGTGCACCGTTCCACTACGCCTCATGCACTGAAAGCGGCGTGA
Claims (1)
1. one kind comes from the open reading frame sequence of the delta-8 delta 8 desaturase genes of pavlova viridis, it is characterised in that, its sequence is as shown in SEQID.No.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410577637.7A CN104293769B (en) | 2014-10-27 | 2014-10-27 | A kind of delta8 desaturase new gene deriving from pavlova viridis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410577637.7A CN104293769B (en) | 2014-10-27 | 2014-10-27 | A kind of delta8 desaturase new gene deriving from pavlova viridis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104293769A CN104293769A (en) | 2015-01-21 |
| CN104293769B true CN104293769B (en) | 2016-06-01 |
Family
ID=52313724
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410577637.7A Expired - Fee Related CN104293769B (en) | 2014-10-27 | 2014-10-27 | A kind of delta8 desaturase new gene deriving from pavlova viridis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104293769B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274091A (en) * | 2015-11-24 | 2016-01-27 | 徐毅 | Novel ribulose diphosphate carboxylase large-subunit gene derived from pavloca viridis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101210234B (en) * | 2006-12-27 | 2011-09-07 | 中国海洋大学 | Ocean micro-alga delta5 aliphatic acid desaturase and application thereof |
| WO2014141098A1 (en) * | 2013-03-13 | 2014-09-18 | Dsm Nutritional Products Ag | Engineering microorganisms |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0229578D0 (en) * | 2002-12-19 | 2003-01-22 | Univ Bristol | Novel method for the production of polyunsaturated fatty acids |
| US7709239B2 (en) * | 2006-12-07 | 2010-05-04 | E.I. Du Pont De Nemours And Company | Mutant Δ8 desaturase genes engineered by targeted mutagenesis and their use in making polyunsaturated fatty acids |
| CN101724638A (en) * | 2009-12-23 | 2010-06-09 | 南开大学 | Nucleotide sequence of euglenagracilis coded delta 8 dehydrogenase and application thereof |
-
2014
- 2014-10-27 CN CN201410577637.7A patent/CN104293769B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101210234B (en) * | 2006-12-27 | 2011-09-07 | 中国海洋大学 | Ocean micro-alga delta5 aliphatic acid desaturase and application thereof |
| WO2014141098A1 (en) * | 2013-03-13 | 2014-09-18 | Dsm Nutritional Products Ag | Engineering microorganisms |
Non-Patent Citations (1)
| Title |
|---|
| 乳酸菌高效膜蛋白表达系统的构建及其自溶性质的研究;徐毅;《中国博士学位论文全文数据库 基础科学辑》;20130115;第二章第26-31页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104293769A (en) | 2015-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103361327B (en) | The recombinant yeast pichia pastoris of allos high expression lipase | |
| CN105368851B (en) | It is a kind of from ω -3 desaturase of phytophthora parasitica, the carrier containing the desaturase, recombinant microorganism and its application | |
| CN109652392A (en) | A kind of feruloyl esterase and its preparation method and application | |
| CN100368524C (en) | High density fermentation method for GS115/PFK-K5 | |
| CN104293769B (en) | A kind of delta8 desaturase new gene deriving from pavlova viridis | |
| CN104178479B (en) | A kind of delta-6 desaturase new gene deriving from pavlova viridis | |
| CN104388442B (en) | A kind of delta12 desaturase new gene deriving from pavlova viridis | |
| CN103087998B (en) | Enzyme for synthesizing cetyl-coenzyme A through cordyceps sinensis, gene and application thereof | |
| CN105924512B (en) | One kind GhLPAAT5-like albumen relevant to fat content and its encoding gene and application | |
| CN103525842B (en) | Delta<12>-fatty acid desaturases gene and recombinant expression vector thereof | |
| CN108531491B (en) | Incise edge green alga lysophosphatidate acyltransferase gene and its application | |
| CN105255913A (en) | Delta9 elongase novel gene sourced from green pavlova viridis | |
| CN114214219B (en) | Genetically engineered bacterium produced by formic acid-assisted free fatty acid | |
| Lu et al. | Screening and molecular identification of overproducing γ‐linolenic acid fungi and cloning the delta 6‐desaturase gene | |
| CN103834672B (en) | A kind of Δ 12-fatty acid dehydrogenase gene and application thereof | |
| CN103525841B (en) | Delta<12>-fatty acid desaturases gene and recombinant expression vector thereof | |
| CN105802989A (en) | Vector, gene and method for expressing recombinant protein in pichia pastoris and application of recombinant protein | |
| CN101434951A (en) | Method for obtaining wire-worm microsome amino peptidase gene and use thereof | |
| CN104099261A (en) | Pichia yeast engineering bacteria producing aspergillus-niger glucose oxidase and application thereof | |
| CN101509004B (en) | Clone and expression of 7,8-desaturase gene | |
| CN104250650A (en) | Delta-6 fatty acid dehydrogenase gene and application thereof | |
| CN104212756B (en) | The construction method of one plant of overexpression fusA genetic engineering bacterium and its application | |
| CN104195148A (en) | Green pavlova viridis delta-5 desaturase gene for EPA (Eicosapentaenoic Acid) synthesis and preparation method of green pavlova viridis delta-5 desaturase gene | |
| CN114634946B (en) | Construction of Pichia pastoris genetically engineered bacteria and application of pichia pastoris genetically engineered bacteria in improving methanol assimilation rate and fixing carbon dioxide | |
| Li et al. | Overexpression of an inulinase gene in an oleaginous yeast, Aureobasidium melanogenum P10, for efficient lipid production from inulin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180515 Address after: 266000 east end of Century Avenue, Huangdao District, Qingdao, Shandong Patentee after: Qingdao Oriental Business Travel Co., Ltd. Address before: 230009 HeFei University of Technology, 193 Tunxi Road, Baohe District, Hefei, Anhui Patentee before: Xu Yi |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160601 Termination date: 20181027 |