CN104288188A - Application of himalayan teasel root total saponins in preparation of miscarriage prevention medicines - Google Patents
Application of himalayan teasel root total saponins in preparation of miscarriage prevention medicines Download PDFInfo
- Publication number
- CN104288188A CN104288188A CN201410482049.5A CN201410482049A CN104288188A CN 104288188 A CN104288188 A CN 104288188A CN 201410482049 A CN201410482049 A CN 201410482049A CN 104288188 A CN104288188 A CN 104288188A
- Authority
- CN
- China
- Prior art keywords
- well
- total
- group
- total saponin
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/30—Extraction of the material
- A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/50—Methods involving additional extraction steps
- A61K2236/55—Liquid-liquid separation; Phase separation
Abstract
The invention discloses application of himalayan teasel root total saponins in preparation of miscarriage prevention medicines. By adopting the himalayan teasel root total saponins, expression of estrogen and progestrone receptors in the uterus and ovary of an animal model can be promoted, vaginal bleeding of the animal model is obviously reduced, the live-birth number is obviously improved, the abortion number is reduced, and the abortion rate is lowered; animal pregnancy is protected from multiple levels and multiple factors, and the miscarriage prevention effect is very obvious.
Description
Technical field
The present invention relates to the purposes of Radix Dipsaci effective site, the especially application of on-off total saponin as well as in the antiabortive medicine of preparation.
Background technology
Radix Dipsaci, derive from the dry root of Dipsacaceae plant Radix Dipsaci Dipsacus asper Wall. Ex Henry, head is loaded in Shennong's Herbal, effects such as there is invigorating the liver and kidney, bone and muscle strengthening, continuous injured, stop metrorrhagia, be antiabortive, be widely used in clinical departments, the diseases such as treatment soreness of the waist and knees, rheumatic arthralgia, tumbling down damage, metrorrhagia, vaginal bleeding during pregnancy, frequent fetal movement.The chemical composition of Radix Dipsaci is mainly containing compositions such as triterpene saponin, iridoids, alkaloids, volatile oils.Modern pharmacology research finds, the effects such as inhibiting bacteria and diminishing inflammation, immunomodulating, antioxidation are anti-aging, Bone formation that it has.
Spontaneous abortion is common pregnancy disease, and sickness rate shows a rising trend in recent years, and its cause of disease is complicated, and definite pathogenesis is still not clear, and discussion of all times is various.From the Chinese point of view, the cause of disease of spontaneous abortion, be roughly summarized as suffer from a deficiency of the kidney, insufficiency of the spleen, insufficiency of vital energy and blood, heat in blood, blood stasis, wound etc., pathogenesis be mainly punching appoint a qi and blood disorder, liability to abortion.Though paathogenic factor is many, most doctor think kidney spleen two dirty be the key of pathogenesis.Because the kidney being the origin of congenital constitution, main reproduction, main store essential substances and be born of the same parents' tires.Tire is pregnant existing, then depend on the nourishing of congenital essential substance for reproduction and the consolidation of kidney qi, supplementing nutrition of the foodstuff essence day after tomorrow.If deficiency of kidney-QI, tire is become homeless and is, or insufficiency of the spleen insufficiency of blood, and tire is become homeless foster, all can cause liability to abortion and die to fall.Therefore kidney is not tire, spleen loses the key of conserving one's health as primary disease.The antiabortive mechanism of action of Chinese medicine may with following five mechanism of action about: on the excitatoty impact in uterus, on the effect of trimester of pregnancy endocrine adjustment, on gravidic immunoregulation effect, improve hemorheology effect, impact etc. on trophocyte.
From modern etiology, cause the cause of disease of spontaneous abortion, mainly contain inherited genetic factors, endocrine function exception, immune factor, infective agent, living environment factor and anatomical factors etc.
inherited genetic factors
Chromosomal abnormality: comprise numerical abnormality and textural anomaly, can also can be brought out by extraneous factor (physics, chemistry, biology) and inherited genetic factors in naturally-occurring.Chromosomal abnormality is abnormal common with quantity, and secondly common chromosome trisomy is 45, XO.Polyploid is abnormal rare, wherein common with triploid.Common with balance Shift carrier in the miscarriage of chromosomal structural abnormality, be secondly pericentric inversion and sex chromosomal abnormality.
Gene unconventionality: current agnogenic recurrent spontaneous abortion (recurrent spontaneous abortion; RSA) heredoimmunity research focuses mostly in HLA site; i.e. HLA tumor susceptibility gene and (or) HLA susceptible monomer; next is the aberrant gene relevant with coagulation function, and thalassemia homozygote also can be miscarried.HLA is positioned at the mankind's No. 6 the short arm of a chromosome (6p21,3), and total length 4000kh, is divided into
,
,
3 regions, its major function participates in immunne response regulation and control.Current research shows,
dQ subprovince in region is relevant with immune disease.Heritability thrombophilia is not only relevant with pregnant thromboembolism, and is the major reason of miscarriage.Labile factor sudden change and activated protein C resistance are the common causes causing miscarrying, while heat labile Methylene tetrahydrofolate reductase (MTHFR) the gene pleiomorphism miscarriage that causes at clotting defect in play a part certain.
endocrine function is abnormal
The most common is luteal phase defect, and due to follicular dysplasia, after ovulation, corpus luteum is formed unsound; Or First Trimester ovary is not good enough to HCG reaction, progesterone secretion is not enough; On the other hand, endometrial progesterone receptor (PR) is not enough, low to the effect of progesterone, all can affect decidua and placentation.
Studies have found that, the patient of Early recurrent spontaneous abortion, its blood serum E2 level follicular phase and luteal phase all remarkable in Normal group, follicule-stimulating hormone (FSH) (FSH), interstitialcellstimulating hormone (ICSH) (LH), prolactin antagonist (PRL) and progesterone (P) level then with matched group not statistically significant difference.But endometrial tissue estrogen receptor (ER), progesterone receptor (PR) content are remarkable in matched group.The prompting effect of endometrium to hormone is bad is the major reason of spontaneous abortion.
In recent years research also finds, patients blood plasma's beta-endorphin (β-EP) level of threatened abortion or incomplete abortion significantly rises, and gonadotropin releasing hormone (Gn-RH), human chorionic gonadotropin (HCG) and progesterone (P) level then decline (P<0.01).
In addition, abnormal thyroid function (hyperthyroidism or first low), diabetes or other endocrine disorder also can affect fetal development and miscarry.
(3) immune factor
Agnogenic recurrent spontaneous abortion, majority is caused by immune factor.The RSA morbidity of about 50% is relevant with immune factor, and miscarriage is that between female tire, immune state is unbalance, occurs caused by immunologic rejection.The RSA that immune factor causes can be divided into autoimmune type and alloimmunity type two class.
Autoimmune: usually can detect autoantibody in the body of patient, as anti-phospholipid antibody etc.Antiphospholipid antibody syndrome (the antiphospholipid syndrome, APS) is modal autoimmune disease type disease.In addition, anti-thyroid antibody, antiprothrombin antibody, antinuclear antibody etc. are all fallen ill closely related with recurrent abortion (recurrent miscarriage, RM).
Alloimmunity: may occur abnormal because of the Mechanism of immunotolerance at mother-tire interface by the sick type of alloimmunity, embryo is subject to the attack of maternal immunity response and makes embryo suffer to repel, miscarry.Mainly relevant with human leukocyte antigen (HLA), decidua T cell and natural killer cell (NK cell), cytokine, complement system, antiapoptotic factors abnormal expression.
Cytokine: research in recent years proves, Th1, Th2 cytokine balance is in close relations to pregnancy outcome.The cytokine in Th2 source is favourable to gestation, and the cytokine in Th1 source is then unfavorable for gestation.For pregnancy outcome, the importantly balance of Th1/Th2, instead of the absolute value of which kind of factor.Transforming growth factor-β (TGF-β 1) may be most important to maintenance gestation, but also may be a risk factor of recurrent abortion.
Complement system is abnormal: have scholar to infer, if Complement Regulatory Protein is expressed, and defect occurs, so the immunopathogenesis effect of complement-mediated may cause miscarriage.In serum such as the results show of Li Xia etc., soluble complement Function protein molecule may be relevant with habitual abortion, namely has the unrecognizing factor serum anticomplementary suppression ratio compared with normal of habitual abortion history low without the multipara of miscarriage.When thinking that the patient having habitual abortion history is pregnant accordingly, may be low due to the anticomplementary action of serum itself, be difficult to effectively suppress complement activation, thus inspire immunopathogenesis effect, cause habitual abortion.
Antiapoptotic factors abnormal expression: apoptosis increase may be the important pathological process that RSA occurs.There is antiapoptotic factors receptor FasL and Trai-lR in Maternal-fetal interface, the two antiapoptotic factors (Fas and Trail) existed with the lymphocytic cell surface activated respectively combines, and cell death inducing, makes embryo's escape from immune hit.Research shows, RSA patient's placental villi trophocyte surface FasL expresses and reduces, and causes the destruction of immunologic tolerance between female tire, causes abnormal immunoreation, thus cause the generation of RSA.
infective agent
Acute infectious disease, Gao Re can cause uterine contraction and miscarry; Bacteriotoxin or virus (as rubella virus, cytomegalovirus, herpes simplex virus etc.) enter fetal blood circulation by Placenta Hominis, can cause abnormal development of fetus or death.The dependency of torch infection and spontaneous abortion has obtained the extensive concern of clinician.In recent years, to abortion women and normal artificial women conventional sense rubella virus, cytomegalovirus, herpes simplex virus and toxoplasma antibody, Human parvovirus B19 (B19V) etc.
The dependency of the mycoplasma of reproductive tract, chlamydia infection and spontaneous abortion is also the focus of research in recent years.Research shows, spontaneous abortion cervix uteri CT, UU, MH infection rate is significantly higher than normal pregnancy group.Its mechanism may be inflammatory cell infiltration endometrium, affects the growth of embryo; Or affect embryo by vertical transmission, cause embryo's stasi.
anatomical factors
Uterus shape abnormal (as double uterus, uterus septus or uterine hypoplasia), pelvic cavity or Intrauterine Occupational Disease (as hysteromyoma etc.), affect embryo growth and development; Incompetence of internal orifice of uterus or cervix uteri severe laceration, cause incompetence,cervical, can cause late abortion.
living environment factor
The chemical substance that pregnancy period contact is harmful and physical factor, comprise heavy metal, benzene, formaldehyde, lonizing radiation, noise, high temperature etc. and active-passive smoking etc., can directly or indirectly cause damage to embryo or fetus.
At present, for the treatment of spontaneous abortion, doctor trained in Western medicine adopts expectant treatment more, hormonotherapy and immunotherapy, but these methods have all limitations and side effect, can not prevent and treat spontaneous abortion safely and effectively.And Chinese medicine is due to its few side effects, safe and reliable and there is late result, regulating menstruation, seed, antiabortive in tool characteristic and advantage.
Summary of the invention
The object of the present invention is to provide the purposes of on-off total saponin as well as, i.e. the application of on-off total saponin as well as in pharmacy.
In fact, the present invention relates to the application of on-off total saponin as well as in the antiabortive medicine of preparation.
The present invention relates to the application of on-off total saponin as well as in the medicine of preparation minimizing abortion ratio.
The present invention relates to on-off total saponin as well as improves the medicine of tire number of living application in preparation.
The present invention relates to the application of on-off total saponin as well as in the medicine of preparation minimizing vaginal hemorrhage.
The present invention relates to the application of on-off total saponin as well as in the pregnant endocrine medicine of preparation adjustment.Particularly, relate to on-off total saponin as well as and improve trimester of pregnancy ovary and the application of progesterone receptor level medicine in uterus as preparation; Trimester of pregnancy ovary and the application of Estrogen Receptor medicine in uterus is improved as preparation.
As one embodiment of the present of invention, the preparation method of described on-off total saponin as well as is:
(1) by dry for Radix Dipsaci, chop up, pulverize after, alcohol raises Radix Dipsaci ethanol extract;
(2) Radix Dipsaci ethanol extract is except after alcohol, upper macroporous resin, through water and ethanol elution first, collects ethanol elution, obtains on-off total saponin as well as crude extract after reclaiming ethanol;
(3) on-off total saponin as well as crude extract acidify, adjusted to ph to 1 ~ 2, chloroform extraction, aqueous fraction alkali adjusted to ph to 10 ~ 11, chloroform extraction, aqueous fraction concentrating under reduced pressure obtains on-off total saponin as well as.
In step of the present invention (1), Radix Dipsaci drying, chop up and pulverize after through 5 ~ 7 times of 75% alcohol reflux three times, extraction time is respectively 2 hours, 1.5hr and 1.5hr, filters, merges three filtrates, obtain Radix Dipsaci ethanol extract.
In described step (2), Radix Dipsaci ethanol extract is except after alcohol, and upper macroporous resin, is eluted to distilled water closely colourless, then uses 95% ethanol elution, and the volume ratio between 95% ethanol and Radix Dipsaci ethanol extract is 7:1 ~ 8:1.5.
Described macroporous resin is HP-20 macroporous resin.
In described step (3), the 1% dilute hydrochloric acid acidify of on-off total saponin as well as crude extract, adjusted to ph to 1 ~ 2, adopt equal-volume chloroform to extract; After chloroform extraction, aqueous fraction is with in the NaOH solution of 1% and adjusted to ph to 10 ~ 11, adopts equal-volume chloroform to extract.
The treatment effective dose of described on-off total saponin as well as is the dosage for producing antiabortive isoreactivity effect after individual administration.And when giving individual single dose or multiple dose, dosage is different according to many factors, comprises the effect of the pharmacokinetic property of on-off total saponin as well as, route of administration, what characteristic (sex, age, body weight, health condition, build) of patient profiles, symptom degree the treatment of depositing, therapeutic frequency and expectation.
Described on-off total saponin as well as can carry out individual administration by number of ways, and route of administration comprises oral, intravenous injection etc.Correspondingly, described on-off total saponin as well as can be prepared into oral formulations and injection with pharmaceutically suitable carrier.Wherein, oral formulations comprises tablet, capsule, microcapsule, soft capsule, granule, drop pill, oral liquid and powder.Injection comprises intravenous injection and injectable powder.Can also need to be equipped with different pharmaceutically suitable carrier according to dosage form, antioxidant, emulsifying agent, stabilizing agent and antifungus agent can be added simultaneously.
The present invention have studied the pharmacological action of on-off total saponin as well as, according to pharmaceutical research principle, devise relevant experimental animal model, carry out the miscarriage effectiveness study of animal model, the experiment proved that: on-off total saponin as well as can promote the expression of the uterus of animal membranous type, the estrogen of ovary and progesterone receptor, obviously reduce the vaginal hemorrhage of animal model, significantly improve tire number alive, reduce abortion number, reduce abortion ratio.Visible, the antiabortive effect highly significant of on-off total saponin as well as.
Accompanying drawing explanation
Fig. 1 is the HPLC-UV finger printing of on-off total saponin as well as of the present invention.
Detailed description of the invention
Below in conjunction with example and accompanying drawing the present invention is further elaborated the novelty teabag of on-off total saponin as well as in field of medicaments, the purposes of especially antiabortive medicine.But following embodiment only for illustration of object of the present invention, does not limit the scope of the invention.
On-off total saponin as well as to suffering from a deficiency of the kidney-luteal function suppresses drug effect and the study on mechanism of the antiabortive effect of abortion model rat
1 experiment material
1.1 Experimental agents and medical material merchandise resources:
Semen Cuscutae, Radix Dipsaci: purchased from the authentic medicinal herbs of Guangdong Kang Mei company limited buying.
Herba Taxilli: entrust South China Botanical Garden gather from change Herba Taxilli.
Dydrogesterone sheet: Dutch Solvay pharmaceuticals B.V, specification: 20/box (10mg/ sheets) 339430
Mifepristone sheet: Hubei Gedian Renfu Pharmaceutical Limited Liability Company, specification: 6/box (25mg/ sheet), numbering: 101002,110302,110202
Hydroxyurea tablet: Qilu Pharmaceutical Co., Ltd., specification: 100/box (0.5g/ sheet), lot number: 005009LC, 103012LC
Sodium carboxymethyl cellulose (CMC-Na): Tianjin good fortune chemical reagent factory in morning, lot number: 20090320.
PCR related materials: Trizol, 5 × reverse transcription buffer, 5 × quantitatively buffer, dNTPs, MMLV, Taq enzyme
1.2 laboratory animal
SPF level SD rat, body weight: female 220 ~ 280g, male 300 ~ 350g, female-male proportion=2 ﹕ 1.Guangdong Medical Lab Animal Center provides.
The quality certification number: 0090923,0097324,0094245,0094568.
The animal facility quality certification: 0057219.
1.3 experimental apparatus
Superclean bench: Suzhou Jin Yan cleaning equipment company limited, model: JYB-1300.
Electronic analytical balance: Shanghai Yousheng Balance Co., Ltd., model: BS-3000A, sensibility reciprocal 0.1g.
Microscope: Japanese Olympus factory (OLYMPUS), model: CX21.
Electronic analytical balance: German Sartorius, model: BS224S3.
High-efficient liquid phase chromatogram discuss: Agilent 1100 series.
Rotary Evaporators: model: EYELA N1000 type Rotary Evaporators, Tokyo physics and chemistry.
The desk-top high flux DNA synthesizer of PCR:ABI 3900, University of Science and Technology innovation HC-3018R High speed refrigerated centrifuge, BIO-RAD qualitative PCR instrument, the full-automatic quantitative real time PCR Instrument of ABI-7500.
2 experimental techniques
The preparation of 2.1 Experimental agents
2.1.1 the preparation of Radix Dipsaci total extract, on-off total saponin as well as
By the drying of 3.5kg Radix Dipsaci, chop up, be processed into particle through pulverizer, through 6 times of 75% alcohol reflux three times (being respectively 2 hours, 1.5hr and 1.5hr).After filtration, merge three filtrates, through Rotary Evaporators concentrating under reduced pressure removing ethanol, be concentrated into about 1500 mL without alcohol taste Radix Dipsaci ethanol extract.Concentrating under reduced pressure condition: interval 55 DEG C-60 DEG C of thickening temperature, concentrated rotating speed 70 rpm/min, vacuum is less than 0.1 Mpa.
HP-20 macroporous resin column (Diaion HP-20 on Radix Dipsaci alcohol extract, Mitsubishi changes into company, diameter 100 mm, high 1 m), first carry out being eluted to distilled water closely colourless, then carry out eluting with 8L 95% ethanol, collect 95% ethanol elution, eluent, through Rotary Evaporators concentrating under reduced pressure removing ethanol, is concentrated into the on-off total saponin as well as crude extract that contain total alkaloids and total glycosides of 1000ml without alcohol taste.Concentrating under reduced pressure condition: interval 55 DEG C-60 DEG C of thickening temperature, concentrated rotating speed 70 rpm/min, vacuum is less than 0.1 Mpa.Thereafter, the 1% dilute hydrochloric acid acidify of on-off total saponin as well as crude extract, adjusted to ph is to 1-2.With equal-volume chloroform (1000ml) shaking out, obtain nonpolarity element 16.1g (extraction ratio is 0.46%) altogether.Leave standstill 30 min layerings complete, remove lower floor's extract, same operation extracts four times, aqueous fraction neutralizes with the NaOH solution of 1%, adjusted to ph 10 ~ 11, with equal-volume chloroform (1000ml) shaking out four times, aqueous fraction neutralizes with 1% hydrochloric acid, and concentrating under reduced pressure obtains on-off total saponin as well as 775g (extraction ratio 22.5%).4 DEG C, keep in Dark Place for subsequent use.The preparation of Radix Dipsaci water extract: by the drying of 3.35kg Radix Dipsaci, chop up, be then processed into particle through pulverizer, with 10 times of soak by water twice (being respectively 2 hours and 1.5hr).After filtration, under decompression, remove moisture, obtain water extract 1500g (extraction ratio 44.7%).Be kept at 4 DEG C, for subsequent use.
2.1.2 the preparation of taste SHOUTAI WAN total extract is subtracted
By dry medical material Semen Cuscutae 400g, Herba Taxilli 300g, Radix Dipsaci 300g, 20 ~ 30 order coarse powder are ground into respectively with Chinese medicine grinder, with 95% ethanol (i.e. 7L) reflux, extract, 2 times of seven times amount after mix homogeneously, each is half an hour, temperature 30 ~ 40 DEG C, under supersonic frequency 40KHz condition ultrasonic 30 minutes, filter, merge twice filtrate, solvent is volatilized with Rotary Evaporators, concentrating under reduced pressure becomes extractum, thickening temperature 50 DEG C, concentrated rotating speed 70rpm(rev/min), under concentrated vacuum 0.1Mpa, concentrated gained extractum is and subtracts taste SHOUTAI WAN ethanol extract sample.
By the filtering residue after alcohol extraction, at room temperature volatilize solvent to without alcohol taste, add after seven times amount distilled water (i.e. 7L) soak 30min, heat decoction 30min, water boils beginning timing.Four layers of filtered through gauze, filtering residue again adding distil water 7L soaks after 30min, heating decocts 30min, use four layers of filtered through gauze again, merge twice filtrate, filtrate uses Rotary Evaporators concentrating under reduced pressure, concentrated condition is as follows: temperature 60 C, rotating speed 70rpm(rev/min), under concentrated vacuum 0.1Mpa, concentrated gained extractum is and subtracts taste SHOUTAI WAN water extract sample.
To subtract taste SHOUTAI WAN ethanol extract and water extract merges, must subtract taste SHOUTAI WAN total extract sample, weigh 51.6 grams, extraction ratio is 25.8%, keeps in Dark Place at 4 DEG C, for subsequent use.
The qualification of 2.2 Experimental agents
2.2.1 the qualification of Radix Dipsaci
2.2.1.1 the Qualitative Identification of each effective site of Radix Dipsaci
Chloroform-strong sulfuric acid response (qualitative identification triterpene saponin)
Get Radix Dipsaci ethanol total extract, the purified of Radix Dipsaci ethanol total extract, the aqueous solution 1mL of position, total saponins position sample respectively, add chloroform 2mL, add concentrated sulphuric acid 3mL again to react, the each reactant liquor of result is divided into two-layer up and down, the purified of Radix Dipsaci ethanol total extract, Radix Dipsaci ethanol total extract, the reaction at total saponins position are comparatively large, and wherein the upper water solution at total saponins position becomes purple.Therefore, can determine that triterpene saponin is contained at this position, namely verify that this position is the total saponins position of Radix Dipsaci.
2.2.1.2. each effective site of Radix Dipsaci and Radix Dipsaci ethanol total extract composition Contrast analysis
hPLC-UV fingerprint chromatogram method
Get Radix Dipsaci ethanol total extract, the purified of Radix Dipsaci ethanol total extract and total saponins position sample respectively, use appropriate dissolve with methanol respectively, cross 0.45 μm of filter membrane, for subsequent use.Draw above sample respectively and inject high performance liquid chromatography, test.And contrast with reference substance on-off total saponin as well as VI.
Chromatographic condition: chromatographic column: Hyperisil ODS C18 post (4.6 mm × 250mm i.d., 5 μm); Mobile phase: 0.1% phosphate aqueous solution (A), acetonitrile (B), 0 ~ 24 min, 5% ~ 17% B; 24 ~ 60 min, 17% ~ 25% B; 60 ~ 80 min, 25% ~ 50% B, 80 ~ 81 min, 50%-5% B; Determined wavelength: 212nm, 254nm, 270nm, 360 nm; Column temperature: 30 DEG C; Flow velocity: 1 ml/min; Sample size: 5 μ L, 10 μ L.
Result: as shown in Figure 1, the HPLC-UV finger printing (212 nm) of the purified of Radix Dipsaci ethanol total extract, Radix Dipsaci ethanol total extract and total saponins position, total alkaloids position and reference substance on-off total saponin as well as VI has good similarity; The number of the chromatographic peak in the purified chromatogram of Radix Dipsaci ethanol total extract is obviously more than the chromatographic peak at total saponins position; Meanwhile, the chromatographic peak at on-off total saponin as well as position can find corresponding chromatographic peak from Radix Dipsaci ethanol total extract chromatogram, and retention time is basically identical; By the ultraviolet absorpting spectrum of retention time composition identical in above sample, found that the ultraviolet absorpting spectrum of the composition of each identical retention time is identical; These results suggest that total saponins position has identical chemical composition with Radix Dipsaci ethanol total extract, and total saponins position is a part (see Fig. 1) for Radix Dipsaci ethanol total extract composition.
2.3 Experimental agents dose design
2.3.1 Experimental agents Rapid Dose Calculation method
According to adult's common dose: Semen Cuscutae 20g, Herba Taxilli 15g, Radix Dipsaci 15g calculate.
Low dose group (dose,equivalent): rat kg body weight every day dosage (g/kg/d)=adult's common dose (g)/60kg × 6.25 × extraction ratio.
Middle dosage group: 2.5 times of dose,equivalents.
High dose group: 5 times of dose,equivalents.
2.3.2 Experimental agents Rapid Dose Calculation result
Radix Dipsaci total extract: clinical recommended dose is 15g every day (calculating by body weight 60kg), and extraction ratio 44.7%, is equivalent to 0.112g kg
-1d
-1.Being converted into rat dose,equivalent is 0.6984g kg
-1d
-1, 5 times of rat dose,equivalent is high dose group, i.e. 3.492g kg
-1d
-1, 2.5 times of rat dose,equivalent is middle dosage group, i.e. 1.746g kg
-1d
-1, 1 times of rat dose,equivalent is low dose group, i.e. 0.6984g kg
-1d
-1.Radix Dipsaci total extract high dose group is called for short continuous height overall group, and in Radix Dipsaci total extract, dosage group is called for short and continues group always, and Radix Dipsaci total extract low dose group is called for short continuous total low group.
On-off total saponin as well as: clinical recommended dose is 15g every day (calculating by body weight 60kg), and extraction ratio 22.5%, is equivalent to 0.056g kg
-1d
-1.Being converted into rat dose,equivalent is 0.352g kg
-1d
-1, 5 times of rat dose,equivalent is high dose group, i.e. 1.76g kg
-1d
-1, 2.5 times of rat dose,equivalent is middle dosage group, i.e. 0.879g kg
-1d
-1, 1 times of rat dose,equivalent is low dose group, i.e. 0.352g kg
-1d
-1.On-off total saponin as well as high dose group is called for short continuous total glycosides high group, and in on-off total saponin as well as, dosage group is called for short group in continuous total glycosides, and on-off total saponin as well as low dose group is called for short continuous low group of total glycosides.
SHOUTAI WAN total extract: clinical recommended dose is 50g every day (calculating by 60kg), according to previous experiments result, adopts 1g kg
-1d
-1dosage.
Hydroxyurea tablet (modeling medicine): dosage 0.45 g kg
-1d
-1.
Mifepristone sheet (modeling medicine): dosage 3.75mg kg
-1d
-1.
Dydrogesterone sheet (treatment reference substance): dosage 3.02mg kg
-1d
-1.
2.3.3 the preparation of experimental drug
SHOUTAI WAN total extract: liquid directly uses.Solid get 10g be impregnated ball total extract grinding, add normal saline to 50ml, concentration is 0.2g/ml, for the administration of SHOUTAI WAN total extract group.
Radix Dipsaci total extract: add dosage group medicinal liquid in normal saline to 100ml proportions by 34.9g Radix Dipsaci total extract, obtaining concentration is 0.349g/ml.Get 0.349g/ml concentration 30ml for high dose group administration (giving the amount of 2 times).Press 0.349g/ml concentration Radix Dipsaci total extract 20ml and be diluted to 50ml proportions low dose group medicinal liquid, concentration is 0.1396g/ml.
On-off total saponin as well as: add dosage group medicinal liquid in normal saline to 100ml proportions by 17.58g on-off total saponin as well as, obtaining concentration is 0.1758g/ml.Get 0.1758g/ml concentration 30ml for high dose group administration (giving the amount of 2 times).Press 0.1758g/ml concentration on-off total saponin as well as 20ml and be diluted to 50ml proportions low dose group medicinal liquid, concentration is 0.0703g/ml.
Hydroxyurea tablet is prepared: get 45 hydroxyurea tablets and be placed in mortar, adds the grinding of a small amount of distilled water, then is transferred in graduated cylinder by medicinal liquid gradually, add normal saline to 250ml, obtain 90mg/ml hydroxyurea tablet medicinal liquid, for modeling.
Mifepristone sheet is prepared: get 2 mifepristone sheets and be placed in mortar, adds the grinding of a small amount of distilled water, then is transferred in graduated cylinder by medicinal liquid gradually, add normal saline to 67ml, obtain 0.75mg/ml mifepristone sheet medicinal liquid, for modeling.
The preparation of dydrogesterone sheet: get 2 dydrogesterone sheets and be placed in mortar, adds the grinding of a small amount of distilled water, then is transferred in graduated cylinder by medicinal liquid gradually, add normal saline to 33.1ml, obtain 0.604mg/ml dydrogesterone sheet medicinal liquid.For the administration of dydrogesterone sheet group.
2.3.4 the preparation of medium is dissolved
0.5% CMC-Na preparation: get 2.5g adding distil water to 500ml, fully mix with vortex mixer and be uniformly dissolved.For Radix Dipsaci alkaloid cosolvent.
All the other Experimental agents all use 0.9% normal saline.
2.4 experimental technique
Breeding: SPF level SD rat, the female Mus of non-motherhood 160, male Mus 80, conventional raising one week, by female: male 2:1 mates breeding 12h.Look into female rats vaginal smear morning next day, occur that a large amount of sperm or vaginal suppository come off and meet rutting period cellular features as pregnant first day, sequence breeding 7 days using vaginal smear.
Grouping: pregnant Mus is divided into 13 groups by complete randomized, be respectively Normal group, model group, dydrogesterone group, subtract taste SHOUTAI WAN total extract group, Radix Dipsaci total extract group (high, medium and low dosage group), on-off total saponin as well as group (high, medium and low dosage group), often organize 10.
To suffer from a deficiency of the kidney the preparation of abortion-prone models: except Normal group, all the other respectively group pregnant rats from the 1st day to the 10th day every day hydroxyurea solution 450mg/kg dosage gavage, 5ml/kg, added during the 10th afternoon 3 and filled with mifepristone solution (RU486) 3.75mg/kg by 1 times/day every day.Normal group all gives the normal saline of equivalent.
Administration:
Normal group: give normal saline, 5ml/kg/ day, 1 times/day, gavage, continuous 10 days.
Model group (hydroxyurea+mifepristone), to normal saline, 1 times/day, gavage, continuous 10 days.
Western medicine group (dydrogesterone), modeling gives dydrogesterone simultaneously, 3.02mg/kg, 1 times/day, gavage, continuous 10 days.
Each treatment group: modeling gives each medicine simultaneously, 1 times/day, gavage, continuous 10 days.
2.5 Testing index
2.5.1 ordinary circumstance: the ordinary circumstance of observing animal every day, comprises form, hair color, activity, receives food, stool etc.
2.5.2 body weight: measure respectively and record the weight of animals for the 1st day, the 5th day, the 10th day after breeding.
3.5.3 take a blood sample: after mifepristone administration 20h, with etherization, the centrifugal 10min separation of serum of orbital vein/abdominal aortic blood 3-4ml, 1000 turns/min ,-20 DEG C of Refrigerator stores are for subsequent use, estradiol (E to be detected
2), progesterone (P).
2.5.4 gross anatomy
Uterus embryo observes: after blood sampling, animal is dissected, and observes vaginal hemorrhage and uterus blood stasis situation; Sterilization equipment cuts uterus and ovary tissue and the culture dish being placed in freezing normal saline washes away blood stains, wipes out fatty tissue and peplos, labelling group; Record total tire number, tire number alive, abortion number, calculate abortion ratio.
The criterion of fetal tissues number, Aborted fetus number:
Fetal tissues: normal uterus is thick as beading, pinkiness or pale red, be shown in after dissection that embryo is intact, has no blood stasis;
Part is miscarried uterus: see blood stasis in uterine cavity, embryo is imperfect.In early days-only there are maternal placenta and fetal placenta to exist; Mid-term-except above-mentioned tissue, also have some fetal tissues;
Artificial abortion uterus: female Mus body weight significantly declines, uterus is that ring sample changes, and without obvious blood stasis or downright bad embryo or only see embryo nidation point in uterine cavity, have no embryo, or embryo is pitchy or once occurred vaginal hemorrhage.
Abortion ratio calculates: abortion ratio=
2.5.5 draw materials
(1) HE dyeing and SABC detect: get left uterine, ovary is weighed respectively, then longitudinally cut uterus open, carefully peel off blastocyst and decidua and weigh, and implantation blastocyst and decidua are placed in 4% paraformaldehyde solution is fixing to be preserved.Carry out HE dyeing and SABC detection ER, PR protein expression respectively.
(2) PCR detects: right ovary is wrapped with sterilizing masking foil, right uterine is longitudinally cut open, careful stripping implantation blastocyst and decidua tissue, and wrap that to be placed in cryopreservation tube labelling good respectively with sterilizing masking foil, be placed in rapidly-80 DEG C of Refrigerator stores for subsequent use, treat that PCR detects estrogen receptor (ER mRNA), progesterone receptor (PR mRNA) expression.
2.5.6 detect
Estradiol (E
2), progesterone (P): adopt radioimmunology detect, completed by Traditional Chinese Medicine University Of Guangzhou nuclear medicine teaching and research room Fang Mian center.Radioimmunological kit: purchased from Beijing Kemei Biological Technology Co., Ltd., lot number: 20111225.
Estrogen receptor (ER), progesterone receptor (PR): quantitative fluorescent PCR (sonde method) detects the expression of mRNA of estrogen receptor (ER) in Rats With Unilateral uterine decidua, ovary, progesterone receptor (PR).
design of primers is synthesized
GenBank searches genes of interest Mrna sequence, at CDS district design Auele Specific Primer, design primer dbase used: Primer express 2.0 software, and adopt the desk-top high flux DNA synthesizer synthesis of ABI 3900, sequence is as follows:
(1) sequence names: R-ER(expanding fragment length 69bp)
Forward primer: 5 '-CCA CCG AGT CCT GGA CAA GA-3 '
Reverse primer: 5 '-TGC AGA GTC AGG CCA GCT T-3 '
Probe: 5 '-FAM-CAA CGA CAC TTT GAT CCA CTT GAT GGC C-TAMRA-3 '
(2) sequence names: R-PGR(expanding fragment length 62bp)
Forward primer: 5 '-CTC CAG AAG GCG ACC CTA AA-3 '
Reverse primer: 5 '-GCC GGG AGG CTG GAA TT-3 '
Probe: 5’-FAM-AGG ACG GGT TCC CAG TTT ACG G-TAMRA-3’
(3) sequence names: R-GAPDH(expanding fragment length 110bp) reference gene
Forward primer: 5 '-AGG GCT GCC TTC TCT TGT GA-3 '
Reverse primer: 5 '-AAC TTG CCG TGG GTA GAG TCA-3 '
Probe: 5 '-FAM-CCA TCA ACG ACC CCT TCA TTG ACC TC-TAMRA-3 '
the extraction of total tissue RNA
(1) getting appropriate tissue puts in 1.5mlEP pipe, shreds and with Glass rod grinding tissue, add Trizol 1 ml, fully vibrate with shears.
(2) add chloroform 0.2ml, cover tightly lid, firmly shake 15s, hatch 2-3min for 15-30 DEG C, 4 DEG C of centrifugal 15min of 12000r/min, get supernatant and manage to 1.5 new ml Eppendorf
(3) add with supernatant isopyknic isopropyl alcohol, hatch sample 10min for 15-30 DEG C, 4 DEG C of centrifugal 10min of 12000r/min, abandon supernatant
Once, 4 DEG C of centrifugal 5min of 7500r/min, abandon ethanol in (4) 75% ethanol (containing DEPC water) 800ul washing precipitation.
(5) air or vacuum drying 5-10min(do not want bone dry), add DEPC process water dissolution RNA ,-80 DEG C save backup.If preserve for a long time, add 2.5 times of volume ethanol, put-80 DEG C of preservations.
reverse transcription reaction
Get 3 μ l RNA templates and do reverse transcription reaction, instrument is BIO-RAD qualitative PCR instrument (U.S.), and reaction system is as follows:
5 × reverse transcription buffer 4 μ l
Downstream primer (10pmol/ μ l) 0.5 μ l
dNTPs（10mM） 0.5μl
MMLV （200U/μl） 0.5μl
DEPC.H2O 11.5μl
RNA model 3 μ l
Cumulative volume: 20 μ l
Reverse transcription buffer composition: 50 mM Tris-HCl(pH8.0), 50 mM KCl, 4 mM MgCl
2, 10 mM DTT
Reaction condition: 37 DEG C of 1h, then 95 DEG C 3 minutes.
quantitative fluorescent PCR reacts
1. the preparation of positive criteria product and gradient thereof: (standard curve quantitative method)
The preparation of 1.1 positive criteria product: the positive products of trial test pcr amplification, through 2% low melting-point agarose gel electrophoresis (containing Ethidium Bromide, using TAE buffer), under long wave ultraviolet, cuts off object band.Purification is reclaimed with recovery test kit (QIAquick Gel Extraction Kit).Measure OD 260/280> 1.8, show that purity is qualified.Go out concentration (copy/ μ l) with OD260 measured value and fragment length data reduction, be positive criteria product.
The preparation of 1.2 positive criteria product gradients: get positive criteria product 5 μ l by 10 times of dilutions (the 45 μ l that add water are fully mixing also), dilution is gone down successively, and be prepared into positive plasmid standards for quantitation gradient, doubling dilution must be accurate, otherwise affect quantitative result.Each upper machine must the positive plasmid standards for quantitation gradient of Fresh, with machine in four gradients comprising all samples during formal upper machine.
1.3 negative quality control standard product adopt sterilizing distilled water
2. sample to be tested and positive criteria product are undertaken by following reaction system:
5 × quantitative PCR buffer 10 μ l
Forward primer F(10pmol/ μ l) 1 μ l
Downstream primer R(10pmol/ μ l) 1 μ l
Probe (5pmol/ μ l) 1 μ l
dNTPs（10mM） 1μl
Taq enzyme (3U/ μ l) 1 μ l
cDNA 5μl
ddH
2O 30μl
Cumulative volume: 50 μ l
PCR buffer composition: 10 mM Tris-HCl(pH8.0), 50 mM KCl, 2 mM MgCl
2
3. reaction condition is: 93 DEG C 2 minutes, then 93 DEG C 15 seconds, 55 DEG C 25 seconds, 72 DEG C 25 seconds, totally 40 circulation.
statistics
The numerical value (i.e. copy number) that result is pressed in form under Quantity row is analyzed, and represents, i.e. B=copy number/μ l cDNA with B.If the difference of each sample total rna concentration is considered in the expression of comparing between each sample, final calculation result is by following formula scales:
A=B
1(genes of interest) ÷ B
2(reference gene)
The numerical value that A value finally needs when being only statistics.
3 statistical methods
Rat body weight and each Testing index are carried out statistical disposition and tabulated, each group of data represents () with mean plus-minus standard deviation, and the statistical significance adopting the method for SPSS13.0 statistical software one factor analysis of variance, Repeated Measurement Data statistics to carry out matched group and each administration group difference is checked.If variance is neat, between two groups, mean compares and checks with LSD-t.Enumeration data adopts X 2 test (x
2).With P<0.05 for there being statistical significance.
4 experimental results
4.1 Radix Dipsaci total extracts, on-off total saponin as well as are on the impact of abortion model rat general state of suffering from a deficiency of the kidney
Rats in normal control group general state is good, and hair color is smooth, and flexibly, food-intake is normal, body weight steady-state growth in reaction, and stool is normal.From modeling, model group rats occurs on the 3rd day that chaeta is loose and owes gloss, bradykinesia, food-intake reduces, hogback, tiredly reduces the phenomenons such as dynamic, muscular flaccidity, shows the state of similar insufficiency of kidney-YANG.Dydrogesterone group, the taste SHOUTAI WAN group that subtracts, Radix Dipsaci group, on-off total saponin as well as, the indivedual rat of Radix Dipsaci total alkaloids group occur hogback, tired reduce dynamic, the phenomenons such as muscular flaccidity comparatively model group are light, time of occurrence is comparatively slow, and preliminary display Radix Dipsaci and each composition thereof have the effect that the improvement aborting rat similar to SHOUTAI WAN is suffered from a deficiency of the kidney.
4.2 Radix Dipsaci total extracts, on-off total saponin as well as are on the impact of abortion model rat body weight of suffering from a deficiency of the kidney
Above result display:
First day: each experimental group and matched group bodyweight difference not statistically significant (P > 0.05), show each treated animal and have comparability.
5th day: in Radix Dipsaci total extract, dosage group, continuous low group of total glycosides are compared with Normal group, and lose weight (P<0.05).Each group is compared difference not statistically significant (P > 0.05) with model group.
Tenth day: subtract taste SHOUTAI WAN group, continue height overall group, continue total middle group, continue total low group, continue group in total glycosides, continue low group of total glycosides compared with Normal group, lose weight (P<0.05).Each group is compared difference not statistically significant (P > 0.05) with model group.
5.3 Radix Dipsaci total extracts, on-off total saponin as well as are on the impact of suffer from a deficiency of the kidney abortion model rat embryo number and abortion ratio
Average tire number: each medication group compares with Normal group and model group, no significant difference (P>0.05).Show between each group and there is comparability.
Tire number alive: model group, the taste SHOUTAI WAN group that subtracts, continuous low group of total glycosides compare with Normal group, and tire number of living obviously reduces, and difference has pole statistical significance (P<0.01).Continuous total low group is compared with Normal group, and tire number of living reduces, and difference has statistical significance (P<0.05).Continuous total middle group compares tire number of living to be increased with model group, and difference has statistical significance (P<0.05).
Abortion number: model group, the taste SHOUTAI WAN group that subtracts, continuous low group of total glycosides compare with Normal group, abortion number significantly increases, difference has pole statistical significance (P<0.01), continuous height overall group, continuous total low group compare with Normal group, abortion number increases, and difference has statistical significance (P<0.05).Continuous total middle group compares with model group, and abortion number reduces, and difference has statistical significance (P<0.05).
Abortion ratio: organize in dydrogesterone group, continuous total middle group, continuous total glycosides and compare with Normal group, no significant difference (P>0.05).Organize in continuous total middle group, continuous total glycosides and compare with model group, abortion ratio reduces, and difference has statistical significance (P<0.05).Model group, the taste SHOUTAI WAN group that subtracts, continuous low group of total glycosides compare with Normal group, abortion ratio significantly increases, difference has pole statistical significance (P<0.01), continuous height overall group, continuous total low group compare abortion ratio with Normal group and increase, difference has statistical significance (P<0.05).
The impact of 5.4 Radix Dipsaci total extracts, on-off total saponin as well as and uterus blood stasis hemorrhage on abortion model rat vagina of suffering from a deficiency of the kidney
Above result shows: each group vaginal hemorrhage rate has statistical significance, vaginal hemorrhage rate is ascending be arranged in order for: in continuous total glycosides, group=dydrogesterone group=normal group < continues in total glycosides and organizes < and subtract taste SHOUTAI WAN group < and continue total glycosides low group of < and continue total glycosides high group < and continue height overall group=continuous total low group of < model
Above result shows: each group uterus blood stasis rate not statistically significant.
5.5 Radix Dipsaci total extracts, on-off total saponin as well as are on the impact of aborting rat genitals weight in wet base of suffering from a deficiency of the kidney
One-sided uterine wet weight: organize in model group, dydrogesterone group, continuous total glycosides and alleviate with the more one-sided uterine wet weight of Normal group, have statistical significance (P<0.05).Each treatment group compares with model group, one-sided uterine wet weight difference not statistically significant (P>0.05).
One ovary weight in wet base: each medication group compares with Normal group and model group, the equal not statistically significant of difference (P>0.05).
Single embryo's weight in wet base: model group, continuous total low group compare with Normal group, single embryo's weight in wet base alleviates, there is statistical significance (P<0.05), continuous high, the middle dosage group of total glycosides compares with model group, single embryo's weight in wet base increases, and difference has statistical significance (P<0.05).
5.6 Radix Dipsaci total extracts, on-off total saponin as well as are on the endocrine impact of aborting rat of suffering from a deficiency of the kidney
E
2: continue height overall group, continue always and compare with Normal group, E
2difference not statistically significant (P>0.05), all the other are respectively organized difference and compare with Normal group, E
2reduce, difference has statistical significance (P<0.01).
Continuous height overall, middle group compare with model group, E
2increase, difference has statistical significance (P<0.05).
Can think E after continuous always low, continuous total glycosides high, normal, basic group of modeling
2horizontal compared with normal group decreases, and continuous height overall, continuous total in group can improve the estradiol level of model group and reach the level of Normal group.
P: model group, continuous total, the continuous each dosage group of total glycosides compare with Normal group, and P reduces, and difference has statistical significance (P<0.01).Each group is compared with model group, P difference not statistically significant (P>0.05).
After each group of modeling, P level decreases, and Radix Dipsaci respectively organizes the progesterone level that all can not significantly improve aborting rat model of suffering from a deficiency of the kidney.
5.7 Radix Dipsaci total extracts, on-off total saponin as well as are on the impact of suffer from a deficiency of the kidney aborting rat uterus and ovary progesterone expression
Uterine decidua PR mRNA: organize in continuous total middle group, continuous total glycosides and compare with Normal group and with model group, uterine decidua PR mRNA increases, and difference has statistical significance (P<0.05).
Ovary PR mRNA: continuous total middle group compares with Normal group, and ovary PR mRNA increases, and difference has statistical significance (P<0.01).Organize in continuous total middle group, continuous total glycosides and compare with model group, ovary PR mRNA increases, and difference has statistical significance (P<0.01).
Result shows: in continuous total middle group, continuous total glycosides, group can improve the progesterone receptor level of suffer from a deficiency of the kidney abortion model rat uterus and ovary.
5.8 Radix Dipsaci total extracts, on-off total saponin as well as are on the impact of suffer from a deficiency of the kidney aborting rat uterus and ovarioestrogen expression of receptor
Uterine decidua ER mRNA: continuous total middle group compares with Normal group, uterine decidua ER mRNA increases, difference has in the continuous total glycosides of statistical significance (P<0.01) to organize and compares with Normal group, uterine decidua ER mRNA increases, and difference has statistical significance (P<0.05).Organize in continuous total middle group, continuous total glycosides and compare with model group, uterine decidua ER mRNA increases, and difference has statistical significance (P<0.01).
Ovary ER mRNA: continuous total middle group difference compares with Normal group and model group, ovary ER mRNA all increases, difference has statistical significance (P<0.01), organize difference in continuous total glycosides to compare with Normal group and model group, ovary ER mRNA all increases, and difference has statistical significance (P<0.05).
Result shows: in continuous total middle group, continuous total glycosides, group can significantly improve the expression of the estrogen receptor of suffer from a deficiency of the kidney abortion model rat uterus and ovary.
Above experimental result display, in the mechanism of action, on-off total saponin as well as significantly improves the suffer from a deficiency of the kidney ovary of abortion model rat and the progesterone receptor level in uterus and Estrogen Receptor, thus significantly improve the tire number alive of abortion model rat of suffering from a deficiency of the kidney, abortion number is reduced, abortion ratio reduces, and can reduce the vaginal hemorrhage of abortion model rat of suffering from a deficiency of the kidney, and illustrates that on-off total saponin as well as has antiabortive effect.
embodiment one: the preparation of on-off total saponin as well as
By the drying of 3.5kg Radix Dipsaci, chop up, be processed into particle through pulverizer, through 6 times (weight/volume) 75% alcohol reflux three times (being respectively 2 hours, 1.5hr and 1.5hr).After filtration, merge three filtrates, through Rotary Evaporators concentrating under reduced pressure removing ethanol, be concentrated into about 1500 mL without alcohol taste Radix Dipsaci ethanol extract.Concentrating under reduced pressure condition: interval 55 DEG C-60 DEG C of thickening temperature, concentrated rotating speed 70 rpm(turns/per minute), vacuum is less than 0.1 Mpa.
HP-20 macroporous resin column (Diaion HP-20 on Radix Dipsaci alcohol extract, Mitsubishi changes into company, diameter 100 mm, high 1 m), first carry out being eluted to distilled water closely colourless, then carry out eluting with 8L 95% ethanol, collect 95% ethanol elution, eluent, through Rotary Evaporators concentrating under reduced pressure removing ethanol, is concentrated into the on-off total saponin as well as crude extract that contain total alkaloids and total glycosides of 1000ml without alcohol taste.Concentrating under reduced pressure condition: interval 60 DEG C of thickening temperature, concentrated rotating speed 70 rpm/min, vacuum is less than 0.1 Mpa.Thereafter, the 1% dilute hydrochloric acid acidify of on-off total saponin as well as crude extract, adjusted to ph is to 1-2.With equal-volume chloroform (1000ml) shaking out, obtain nonpolarity element 16.1g (extraction ratio is 0.46%) altogether.Leave standstill 30 min layerings complete, remove lower floor's extract, same operation extraction four times, aqueous fraction neutralizes with the NaOH solution of 1%, and adjusted to ph 10 ~ 11, with equal-volume chloroform (1000ml) shaking out four times, aqueous fraction neutralizes with 1% hydrochloric acid, and concentrating under reduced pressure obtains on-off total saponin as well as.
Above concentrating under reduced pressure condition is: thickening temperature 60 DEG C, and concentrated rotating speed 70rpm(turns/per minute), concentrated vacuum 0.1Mpa.
embodiment two: the preparation of on-off total saponin as well as
By the drying of 3.5kg Radix Dipsaci, chop up, be processed into particle through pulverizer, through 5 times (weight/volume) 75% alcohol reflux three times (being respectively 2 hours, 1.5hr and 1.5hr).After filtration, merge three filtrates, through Rotary Evaporators concentrating under reduced pressure removing ethanol, be concentrated into about 1500 mL without alcohol taste Radix Dipsaci ethanol extract.Concentrating under reduced pressure condition: interval 55 DEG C of thickening temperature, concentrated rotating speed 70 rpm(turns/per minute), vacuum is less than 0.1 Mpa.
HP-20 macroporous resin column (Diaion HP-20 on Radix Dipsaci alcohol extract, Mitsubishi changes into company, diameter 100 mm, high 1 m), first carry out being eluted to distilled water closely colourless, then carry out eluting with 8L 95% ethanol, collect 95% ethanol elution, eluent, through Rotary Evaporators concentrating under reduced pressure removing ethanol, is concentrated into the on-off total saponin as well as crude extract that contain total alkaloids and total glycosides of 1000ml without alcohol taste.Concentrating under reduced pressure condition: interval 55 DEG C of thickening temperature, concentrated rotating speed 70 rpm/min, vacuum is less than 0.1 Mpa.Thereafter, the 1% dilute hydrochloric acid acidify of on-off total saponin as well as crude extract, adjusted to ph to 1 ~ 2.With equal-volume chloroform (1000ml) shaking out, leave standstill 30 min layerings complete, remove lower floor's extract, same operation extracts four times, aqueous fraction neutralizes with the NaOH solution of 1%, and adjusted to ph 10 ~ 11, with equal-volume chloroform (1000ml) shaking out four times, aqueous fraction neutralizes with 1% hydrochloric acid, and concentrating under reduced pressure obtains on-off total saponin as well as.
Above concentrating under reduced pressure condition is: thickening temperature 55 DEG C, and concentrated rotating speed 70rpm(turns/per minute), concentrated vacuum 0.1Mpa.
embodiment three: the preparation of on-off total saponin as well as
By the drying of 3.5kg Radix Dipsaci, chop up, be processed into particle through pulverizer, through 7 times (weight/volume) 75% alcohol reflux three times (being respectively 2 hours, 1.5hr and 1.5hr).After filtration, merge three filtrates, through Rotary Evaporators concentrating under reduced pressure removing ethanol, be concentrated into about 1500 mL without alcohol taste Radix Dipsaci ethanol extract.Concentrating under reduced pressure condition: interval 58 DEG C of thickening temperature, concentrated rotating speed 70 rpm(turns/per minute), vacuum is less than 0.1 Mpa.
HP-20 macroporous resin column (Diaion HP-20 on Radix Dipsaci alcohol extract, Mitsubishi changes into company, diameter 100 mm, high 1 m), first carry out being eluted to distilled water closely colourless, then carry out eluting with 8L 95% ethanol, collect 95% ethanol elution, eluent, through Rotary Evaporators concentrating under reduced pressure removing ethanol, is concentrated into the on-off total saponin as well as crude extract that contain total alkaloids and total glycosides of 1000ml without alcohol taste.Concentrating under reduced pressure condition: interval 58 DEG C of thickening temperature, concentrated rotating speed 70 rpm/min, vacuum is less than 0.1Mpa.Thereafter, the 1% dilute hydrochloric acid acidify of on-off total saponin as well as crude extract, adjusted to ph to 1 ~ 2.With equal-volume chloroform (1000ml) shaking out, leave standstill 30 min layerings complete, remove lower floor's extract, same operation extracts four times, aqueous fraction neutralizes with the NaOH solution of 1%, and adjusted to ph 10 ~ 11, with equal-volume chloroform (1000ml) shaking out four times, aqueous fraction neutralizes with 1% hydrochloric acid, and concentrating under reduced pressure obtains on-off total saponin as well as.
Above concentrating under reduced pressure condition is: thickening temperature 58 DEG C, and concentrated rotating speed 70rpm(turns/per minute), concentrated vacuum 0.1Mpa.
Sequence table
<110> Luo Song puts down
The application of <120> on-off total saponin as well as in the antiabortive medicine of preparation
<160> 9
<210> 1
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223> forward primer
<400> 1
CCACCGAGTCCTGGACAA GA 20
<210> 2
<211> 19
<212> DNA
<213> artificial sequence
<220>
<223> reverse primer
<400> 2
TGCAGAGTCAGGCCAGCTT 19
<210> 3
<211> 28
<212>
<213> artificial sequence
<220>
<223> probe
<400> 3
FAM-CAACGACACTTTGATCCACTTGATGGCC-TAMRA 28
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223> forward primer
<400> 4
CTCCAGAAGGCGACCCTA AA 20
<210> 5
<211> 17
<212> DNA
<213> artificial sequence
<220>
<223> reverse primer
<400> 5
GCCGGGAGGCTGGAA TT 17
<210> 6
<211> 22
<212>
<213> artificial sequence
<220>
<223> probe
<400> 6
FAM-AGGACGGGTTCCCAGTTTACGG-TAMRA 22
<210> 7
<211> 20
<212> DNA
<213> artificial sequence
<220>
<223> forward primer
<400> 7
AGGGCTGCCTTCTCTTGT GA 20
<210> 8
<211> 21
<212> DNA
<213> artificial sequence
<220>
<223> reverse primer
<400> 8
AACTTGCCGTGGGTAGAGTCA 21
<210> 9
<211> 26
<212>
<213> artificial sequence
<220>
<223> probe
<400> 9
FAM-CCATCAACGACCCCTTCATTGACCTC-TAMRA 26
Claims (10)
1. on-off total saponin as well as is as the application in the antiabortive medicine of preparation.
2. on-off total saponin as well as reduces the application in the medicine of abortion ratio as preparation.
3. on-off total saponin as well as improves the application of living in the medicine of tire number as preparation.
4. on-off total saponin as well as reduces the application in the medicine of vaginal hemorrhage as preparation.
5. on-off total saponin as well as regulates the application in pregnant endocrine medicine as preparation.
6. on-off total saponin as well as improves trimester of pregnancy ovary and the application of progesterone receptor level medicine in uterus as preparation.
7. on-off total saponin as well as improves trimester of pregnancy ovary and the application of Estrogen Receptor medicine in uterus as preparation.
8. a preparation method for on-off total saponin as well as, is characterized in that, comprises the following steps:
(1) by dry for Radix Dipsaci, chop up, pulverize after, alcohol raises Radix Dipsaci ethanol extract;
(2) Radix Dipsaci ethanol extract is except after alcohol, upper macroporous resin, through water and ethanol elution first, collects ethanol elution, obtains on-off total saponin as well as crude extract after reclaiming ethanol;
(3) on-off total saponin as well as crude extract acidify, adjusted to ph to 1 ~ 2, chloroform extraction, aqueous fraction alkali adjusted to ph to 10 ~ 11, chloroform extraction, aqueous fraction concentrating under reduced pressure obtains on-off total saponin as well as.
9. the preparation method of on-off total saponin as well as described in claim 8, it is characterized in that, in described step (1), Radix Dipsaci drying, chop up and pulverize after through 5 ~ 7 times of 75% alcohol reflux three times, extraction time is respectively 2 hours, 1.5hr and 1.5hr, filters, merge three filtrates, obtain Radix Dipsaci ethanol extract; In described step (2), Radix Dipsaci ethanol extract is except after alcohol, and upper macroporous resin, is eluted to distilled water closely colourless, then uses 95% ethanol elution, and the volume ratio between 95% ethanol and Radix Dipsaci ethanol extract is 7:1 ~ 8:1.5; Described macroporous resin is HP-20 macroporous resin; In described step (3), the 1% dilute hydrochloric acid acidify of on-off total saponin as well as crude extract, adjusted to ph to 1 ~ 2, adopt equal-volume chloroform to extract; After extraction, aqueous fraction is with in the NaOH solution of 1% and adjusted to ph to 10 ~ 11, adopts equal-volume chloroform to extract.
10. the on-off total saponin as well as that described in a claim 8 or 9 prepared by preparation method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410482049.5A CN104288188B (en) | 2014-09-19 | 2014-09-19 | Application of the dipsacus total saponin in antiabortive medicine is prepared |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410482049.5A CN104288188B (en) | 2014-09-19 | 2014-09-19 | Application of the dipsacus total saponin in antiabortive medicine is prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104288188A true CN104288188A (en) | 2015-01-21 |
| CN104288188B CN104288188B (en) | 2017-06-09 |
Family
ID=52308302
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410482049.5A Active CN104288188B (en) | 2014-09-19 | 2014-09-19 | Application of the dipsacus total saponin in antiabortive medicine is prepared |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104288188B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018035095A1 (en) * | 2016-08-16 | 2018-02-22 | Janssen Pharmaceutica Nv | Neurosteroid compositions and methods of use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1384110A (en) * | 2002-05-20 | 2002-12-11 | 吉林天药科技股份有限公司 | Prepn of hederagenin |
| KR20060008022A (en) * | 2004-07-23 | 2006-01-26 | 유형근 | Bone tissue regeneration promoter comprising oleanane compounds |
| CN101161251A (en) * | 2007-11-22 | 2008-04-16 | 广州博济医药生物技术有限公司 | On-off total saponin as well as its extracting method and application |
-
2014
- 2014-09-19 CN CN201410482049.5A patent/CN104288188B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1384110A (en) * | 2002-05-20 | 2002-12-11 | 吉林天药科技股份有限公司 | Prepn of hederagenin |
| KR20060008022A (en) * | 2004-07-23 | 2006-01-26 | 유형근 | Bone tissue regeneration promoter comprising oleanane compounds |
| CN101161251A (en) * | 2007-11-22 | 2008-04-16 | 广州博济医药生物技术有限公司 | On-off total saponin as well as its extracting method and application |
Non-Patent Citations (2)
| Title |
|---|
| 刘京晶: "续断生药学研究", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
| 赵丽等: "大孔吸附树脂分离纯化五鹤续断总皂苷的工艺研究", 《医药导报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018035095A1 (en) * | 2016-08-16 | 2018-02-22 | Janssen Pharmaceutica Nv | Neurosteroid compositions and methods of use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104288188B (en) | 2017-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Huang et al. | Immunomodulatory mechanism of Bushen Huoxue Recipe alleviates cyclophosphamide-induced diminished ovarian reserve in mouse model | |
| Zhang et al. | Study on prevention effect of Zishen Yutai pill combined with progesterone for threatened abortion in rats | |
| Liu et al. | Kuntai capsule plus hormone therapy vs. hormone therapy alone in patients with premature ovarian failure: a systematic review and meta-analysis | |
| AU2021102869A4 (en) | A traditional chinese medicine preparation and its application for treating infertility | |
| Hu et al. | Study on the mechanism of sarsasapogenin in treating precocious puberty by regulating the HPG Axis | |
| WO2021253742A1 (en) | Application of wubi chinese yam pills in preparation of drug for treatment of premature ovarian insufficiency | |
| CN109125458B (en) | Application of tangerine leaf extract in preparation of medicine for treating/preventing autoimmune orchitis | |
| CN107982269B (en) | Application of crocetin in preparation of medicine for preventing and treating polycystic ovarian syndrome | |
| CN103330721B (en) | Holothurian flower extract for treatment of female POF and its preparation method | |
| CN104288188B (en) | Application of the dipsacus total saponin in antiabortive medicine is prepared | |
| CN100562323C (en) | A kind of pharmaceutical composition for the treatment of hysteromyoma and preparation method thereof | |
| Li et al. | A novel therapeutic approach for IPF: Based on the “Autophagy-Apoptosis” balance regulation of Zukamu Granules in alveolar macrophages | |
| CN114869952A (en) | Application of cortex lycii radicis extract in preparation of product for repairing reproductive system injury | |
| Sun et al. | The modified bushen antai recipe upregulates estrogen and progesterone receptors at the maternal-fetal interface in pregnant rats with mifepristone-induced pregnancy loss | |
| CN105079244B (en) | A kind of pharmaceutical composition and its application for treating premature ovarian failure | |
| CN105920221A (en) | Pharmaceutical composition for treating anovulatory infertility and its preparation method and use | |
| CN101966254A (en) | Application of raw rehmannia aqueous extract in preparing medicines for treating woman climacteric syndrome caused by hyposecretion of in-vivo female hormones | |
| CN102048913A (en) | Traditional Chinese medicine preparation for treating climacteric syndrome and preparation method thereof | |
| CN105853664B (en) | Traditional Chinese medicine formula for treating male infertility | |
| CN104288171B (en) | Application of the Ramulus Taxilli total starches in antiabortive medicine is prepared | |
| Wang et al. | Leonurine hydrochloride-a new drug for the treatment of menopausal syndrome: Synthesis, estrogen-like effects and pharmacokinetics | |
| Aftab et al. | Effect of Phytoestrogens in the Treatment of Polycystic Ovary Syndrome in Rat Model | |
| CN114748490B (en) | Pharmaceutical composition for treating premature ovarian failure, application and preparation method thereof | |
| CN103285283A (en) | Chinese medicine dispersible tablet for treating breast hyperplasia disease and preparation method as well as quality detection method thereof | |
| CN115779035B (en) | Traditional Chinese medicine composition for treating or improving ovarian reserve function decline and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |