CN104288188B - Application of the dipsacus total saponin in antiabortive medicine is prepared - Google Patents

Application of the dipsacus total saponin in antiabortive medicine is prepared Download PDF

Info

Publication number
CN104288188B
CN104288188B CN201410482049.5A CN201410482049A CN104288188B CN 104288188 B CN104288188 B CN 104288188B CN 201410482049 A CN201410482049 A CN 201410482049A CN 104288188 B CN104288188 B CN 104288188B
Authority
CN
China
Prior art keywords
group
total
dipsacus
total saponin
abortion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410482049.5A
Other languages
Chinese (zh)
Other versions
CN104288188A (en
Inventor
罗颂平
郜洁
缪江霞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201410482049.5A priority Critical patent/CN104288188B/en
Publication of CN104288188A publication Critical patent/CN104288188A/en
Application granted granted Critical
Publication of CN104288188B publication Critical patent/CN104288188B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/50—Methods involving additional extraction steps
    • A61K2236/55—Liquid-liquid separation; Phase separation

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Medical Informatics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The invention discloses application of the dipsacus total saponin in antiabortive medicine is prepared.Dipsacus total saponin can promote the expression in the uterus of animal membranous type, the estrogen of ovary and progesterone receptor, hence it is evident that reduce the colporrhagia of animal model, significantly improve live births; reduce abortion number; abortion ratio is reduced, from multi-level, multifactor protection animal pregnancy, its antiabortive effect highly significant.

Description

Application of the dipsacus total saponin in antiabortive medicine is prepared
Technical field
The present invention relates to the application of the purposes of teasel root active component, especially dipsacus total saponin in antiabortive medicine is prepared.
Background technology
Teasel root, from the dry root of Dipsacaceae plant teasel Dipsacus asper Wall. Ex Henry, First recorded in《Sheng Nong's herbal classic》, with filling liver kidney, strengthening the bones and muscles, continuous injured, only uterine bleeding, it is antiabortive the effects such as, be widely used in clinic The diseases such as each section, treatment soreness and weakness of waist and knees, arthralgia pain due to rheumatism, traumatic injury, uterine bleeding, threatened abortion, fetal irritability.The chemical composition of teasel root is main Contain the compositions such as triterpene saponin, iridoids, alkaloids, volatile oil.Modern pharmacology research finds that it has suppression Bacterium anti-inflammatory, immunological regulation, anti-oxidant anti-aging, Bone formation etc. are acted on.
Spontaneous abortion is common pregnancy disease, and the incidence of disease shows a rising trend in recent years, and its cause of disease is complicated, and definite pathogenesis is still Indefinite, discussion of all times is various.From the Chinese point of view, the cause of disease of spontaneous abortion, be substantially summarized as kidney deficiency, it is insufficiency of the spleen, Insufficiency of vital energy and blood, blood-head, blood stasis, wound etc., the interpretation of the cause, onset and process of an illness are mainly punching and appoint qi and blood disorder, liability to be abortion.Though paathogenic factor is more, many Number doctors think kidney spleen two it is dirty be the interpretation of the cause, onset and process of an illness key.Because the kidney being the origin of congenital constitution, main reproduction, main store essential substances and be born of the same parents' tire.Tire is pregnant both Into, then depending on the nourishing of congenital essential substance for reproduction and the consolidation of kidney qi, the foodstuff essence day after tomorrow is supplemented nutrition.If deficiency of kidney-QI, tire loses Direct bearing, or insufficiency of the spleen blood is few, loses the fetus, and can cause liability to be abortion and die and fall.Therefore kidney is not tire, spleen loses the pass conserved one's health as this disease Key.The antiabortive mechanism of action of Chinese medicine may be relevant with following five mechanism of action：On the excitatoty influence in uterus, in the gestational period points The effect of the regulation secreted, to gravidic immunoregulation effect, improve Hemorheology effect, influence to trophocyte etc..
From in terms of modern teiology, cause the cause of disease of spontaneous abortion, mainly have inherent cause, endocrine function abnormal, immune Factor, infective agent, living environment factor and anatomical factors etc..
Inherent cause
Chromosome abnormality：Including numerical abnormality and textural anomaly, can naturally-occurring also by extraneous factor (physics, chemistry, It is biological) and inherent cause induction.Chromosome abnormality is extremely common with quantity, common chromosome trisomy, next to that 45, XO.It is many Times body is extremely rare, wherein common with triploid.It is common with balance Shift carrier in the miscarriage of chromosomal structural abnormality, its Secondary is pericentric inversion and sex chromosomal abnormality.
Gene unconventionality：The not clear recurrent spontaneous abortion of current reason (recurrent spontaneous abortion, RSA) genetics immunology research focuses mostly in HLA sites, i.e. HLA tumor susceptibility genes and (or) the susceptible monomers of HLA, next to that with The relevant aberrant gene of coagulation function, thalassemia homozygote can also miscarry.HLA is located at No. 6 the short arm of a chromosome of the mankind (6p21,3), total length 4000kh is divided into、、3 regions, its major function is to participate in immune response regulation and control.Grind at present Study carefully and show,DQ subprovinces in region are relevant with immunity disease.Heredity thrombophilia not only with pregnant thromboembolism It is relevant, and be also the major reason of miscarriage.Labile factor is mutated and activated protein C resistance is the common cause for causing miscarriage, Heat labile MTHFR (MTHFR) gene pleiomorphism plays one in the miscarriage caused by clotting defect simultaneously Fixed effect.
Endocrine function exception
Most commonly luteal phase defect, due to follicular dysplasia, corpus luteum forms unsound after ovulation；Or First Trimester Ovary reacts not good enough to HCG, and progesterone secretion is not enough；On the other hand, the progesterone receptor of endometrium（PR）Deficiency, to progesterone Effect is low, can influence decidua and placentation.
Studies have found that, the patient of Early recurrent spontaneous abortion, its blood serum E2 level is notable in follicular phase and luteal phase Less than Normal group, and follicular stimulating hormone (FSH), interstitialcellstimulating hormone (ICSH) (LH), prolactin (PRL) and progesterone (P) level are then With the not statistically significant difference of control group.But endometrial tissue ERs (ER), progesterone receptor (PR) content Substantially less than control group.It is the major reason of spontaneous abortion that prompting endometrium is bad to the effect of hormone.
In recent years research also found, patients blood plasma's beta-endorphin of threatened abortion or incomplete abortion（β-EP）On level is notable Rise, and gonadotropin-releasing hormone (GRH) (Gn-RH), human chorionic gonadotrophin (HCG) and progesterone (P) level then decline（P< 0.01）.
Additionally, abnormal thyroid function（Hyperthyroidism or first are low）, diabetes or other endocrine disorders can also influence embryo to send out Educate and miscarry.
(3) immune factor
The not clear recurrent spontaneous abortion of reason, caused by majority is immune factor.About 50% RSA morbidities have with immune factor Close, miscarriage is that immune state is unbalance between female tire, caused by there is immunological rejection.The RSA that immune factor causes can be divided into and itself exempt from Epidemic disease type and the class of isoimmunization type two.
Autoimmunity：Generally can be in the internal detection autoantibody of patient, such as anti-phospholipid antibody.Anti-phospholipid antibody synthesis It is most common autoimmunity disease type disease to levy (the antiphospholipid syndrome, APS).In addition, anti-first Shape gland antibody, antiprothrombin antibody, antinuclear antibodies etc. are and recurrent miscarriage（Recurrent miscarriage, RM）Hair Disease is closely related.
Isoimmunization：By isoimmunization disease type probably due to the Mechanism of immunotolerance at mother-tire interface occurs abnormal, embryo Embryo is set to be repelled, miscarry by the attack of maternal immunity response.It is mainly thin with HLA (HLA), decidua T Born of the same parents are relevant with NK (NK cells), cell factor, complement system, antiapoptotic factors abnormal expression.
Cell factor：Research in recent years proves that Th1, Th2 cytokine balance are in close relations to pregnancy outcome.Th2 sources Cell factor is favourable to gestation, and the cell factor in Th1 sources is then unfavorable for gestation.For pregnancy outcome, it is important that Th1 The balance of/Th2, rather than the absolute value of which kind of factor.Transforming growth factor-β (TGF-β 1) may be to maintaining gestation to pass It is important, it is also possible to being a risk factor of recurrent miscarriage.
Complement system exception：There is scholar to speculate, if Complement Regulatory Protein expression occurs defect, then complement-mediated Immunopathogenesis effect may cause miscarriage.Soluble complement regulatory protein molecule can in the results show of Li Xia etc. serum Can be relevant with habitual abortion, that is, there is the unrecognizing factor serum anticomplement inhibiting rate of habitual abortion history more normally without miscarriage Multipara is low.When thinking the patient's gestation for having habitual abortion history accordingly, may be low due to serum anticomplementary action in itself, It is difficult to effectively suppress complement activation, so as to inspire immunopathogenesis effect, causes habitual abortion.
Antiapoptotic factors abnormal expression：Apoptosis increase is probably the important pathologic process that RSA occurs.Maternal-fetal interface There is antiapoptotic factors acceptor FasL and Trai-lR, the two antiapoptotic factors (Fas for existing with the lymphocytic cell surface of activation respectively And Trail) combine, inducing cell apoptosis, embryo is escaped immune strike.Research shows that RSA patient's placental villi is nourished thin Cellular surface FasL expression is reduced, and causes the destruction of immune tolerance between female tire, causes abnormal immune response, so as to cause RSA Generation.
Infective agent
Acute infectious disease, hyperpyrexia can cause uterine contractile and miscarry；Bacteriotoxin or virus（Such as rubella virus, giant cell Virus, herpes simplex virus etc.）Fetal blood circulation can be entered by placenta, abnormal development of fetus or death can be caused.TORCH feels Dye has obtained the extensive concern of clinician with the correlation of spontaneous abortion.In recent years, to abortion women and normal artificial women Conventional detection rubella virus, cytomegalovirus, herpes simplex virus and toxoplasm antibody, Human parvovirus B19（B19V）Deng.
The mycoplasma of genital tract, choamydiae infection and the focus that the correlation of spontaneous abortion is also research in recent years.Research table Bright, spontaneous abortion uterine neck CT, UU, MH infection rate is significantly higher than normal pregnancy group.Its mechanism is probably inflammatory cell infiltration Endometrium, influences the growth of embryo；Or embryo is influenceed by vertical transmission, cause embryo to stop development.
Anatomical factors
Uterus shape exception（Such as uterus duplex, uterus septus or hypoplasia of uterus）, pelvic cavity or Intrauterine Occupational Disease （Such as fibroid）, influence embryo growth and development；Incompetence of internal orifice of uterus or uterine neck severe lacerated wound, cause incompetence,cervical, Late abortion can be caused.
Living environment factor
Pregnancy period contact harmful chemical substance and physical factor, including heavy metal, benzene, formaldehyde, radioactive ray, noise, high temperature Deng and active-passive smoking etc., directly or indirectly embryo or fetus can be caused damage.
At present, for the treatment of spontaneous abortion, adopted expectant treatment doctor trained in Western medicine, hormonotherapy and immunotherapy more, but this A little methods have a variety of limitations and side effect, can not safely and effectively prevent and treat spontaneous abortion.And traditional Chinese medicine is due to its few side effects, It is safe and reliable and with late result, in menstruation regulating, seed, antiabortive aspect tool characteristic and advantage.
The content of the invention
It is an object of the invention to provide the application of the purposes of dipsacus total saponin, i.e. dipsacus total saponin in pharmacy.
In fact, the application the present invention relates to dipsacus total saponin in antiabortive medicine is prepared.
The present invention relates to application of the dipsacus total saponin in the medicine for reducing abortion ratio is prepared.
The application of the medicine for improving live births is being prepared the present invention relates to dipsacus total saponin.
The present invention relates to application of the dipsacus total saponin in the medicine for reducing colporrhagia is prepared.
The present invention relates to application of the dipsacus total saponin in the pregnant endocrine medicine of regulation is prepared.In particular it relates to continuous Disconnected total saposins are used as the application for preparing the progesterone receptor level medicine for improving gestational period ovary and uterus；Improve pregnant as preparing Be pregnent phase ovary and uterus Estrogen Receptor medicine application.
Used as one embodiment of the present of invention, the preparation method of the dipsacus total saponin is：
(1) after drying teasel root, chop up, crushing, alcohol raises radix dipsaci alcohol extract；
(2) after radix dipsaci alcohol extract is except alcohol, upper macroreticular resin, through water and ethanol elution after elder generation, collects ethanol eluate, returns Dipsacus total saponin crude extract is obtained after receiving ethanol；
(3) dipsacus total saponin crude extract acidifying, adjustment pH value to 1 ~ 2, chloroform extraction, aqueous fraction adjusts pH value with alkali To 10 ~ 11, chloroform is extracted, and aqueous fraction is concentrated under reduced pressure to obtain dipsacus total saponin.
In step (1) of the present invention, teasel root through drying, chop up and crush after extract three through 5 ~ 7 times of 75% alcohol reflux Secondary, extraction time is respectively 2 hours, 1.5hr and 1.5hr, filtering, merges three filtrates, obtains radix dipsaci alcohol extract.
In the step (2), after radix dipsaci alcohol extract is except alcohol, upper macroreticular resin is eluted to nearly colourless, Ran Houyong with distilled water 95% ethanol elution, the volume ratio between 95% ethanol and radix dipsaci alcohol extract is 7:1~8:1.5.
The macroreticular resin is HP-20 macroreticular resins.
In the step (3), dipsacus total saponin crude extract is acidified with 1% watery hydrochloric acid, adjustment pH value to 1 ~ 2, using etc. body Product chloroform is extracted；Aqueous fraction is with 1% NaOH solution and adjustment pH value is to 10 ~ 11 after chloroform extraction, using etc. body Product chloroform is extracted.
The therapeutically effective amount of described dipsacus total saponin is to produce the dosage of antiabortive isoreactivity effect after individuality administration.And When giving individual single dose or multiple dose, dosage is different according to many factors, including dipsacus total saponin pharmacokinetics Property, method of administration, patient profiles what characteristic (sex, age, body weight, health condition, build), symptom degree and controlling of depositing Treatment, therapeutic frequency and intended effect.
Described dipsacus total saponin can carry out individual administration by number of ways, and method of administration includes oral, intravenous injection etc.. Correspondingly, described dipsacus total saponin can be prepared into oral formulations and injection with pharmaceutical acceptable carrier.Wherein, oral formulations bag Include tablet, capsule, microcapsule formulations, soft capsule, granule, dripping pill, oral liquid and powder.Injection includes intravenous injection And powder-injection.Can also according to formulation need can be equipped with different pharmaceutical acceptable carrier, while can add antioxidant, emulsifying agent, Stabilizer and mould inhibitor.
The present invention have studied the pharmacological action of dipsacus total saponin, according to pharmaceutical research principle, devise the experiment of correlation Animal model, has carried out the miscarriage effectiveness study of animal model, the experiment proved that：Dipsacus total saponin can promote the son of animal membranous type The expression in palace, the estrogen of ovary and progesterone receptor, hence it is evident that reduce the colporrhagia of animal model, significantly improve tire living Number, reduces abortion number, reduces abortion ratio.It can be seen that, the antiabortive effect highly significant of dipsacus total saponin.
Brief description of the drawings
Fig. 1 is the HPLC-UV finger-prints of dipsacus total saponin of the present invention.
Specific embodiment
With reference to example and accompanying drawing the present invention is further elaborated dipsacus total saponin in field of medicaments The purposes of new application, especially antiabortive medicine.But implementation below is merely to illustrate the purpose of the present invention, this is not intended to limit The protection domain of invention.
Dipsacus total saponin suppresses the drug effect and study on mechanism of the antiabortive effect of abortion model rat to kidney deficiency-luteal function
1 experiment material
1.1 Experimental agents and medicinal material merchandise resources：
Semen Cuscutae, teasel root：Purchased from the authentic medicinal herbs that Guangdong Kang Mei Co., Ltds purchase.
Ramulus Taxilli：Commission South China Botanical Garden collection from change Ramulus Taxilli.
Dydrogesterone piece：Dutch Solvay pharmaceuticals B.V, specification：20/box（10mg/ pieces） 339430
Mifepristone piece：Hubei Gedian Renfu Pharmaceutical Limited Liability Company, specification：6/box（25mg/ pieces）, numbering： 101002、110302、110202
Hydroxyurea tablet：Qilu Pharmaceutical Co., Ltd., specification：100/box（0.5g/ pieces）, lot number：005009LC、 103012LC
Sodium carboxymethylcellulose (CMC-Na)：Tianjin good fortune morning chemical reagent factory, lot number：20090320.
The relevant materials of PCR：Trizol, 5 × reverse transcription buffer, 5 × quantitative buffer, dNTPs, MMLV, Taq enzyme
1.2 experimental animals
SPF grades of SD rat, body weight：Female 220~280g, hero 300 ~ 350g, female-male proportion=2 ﹕ 1.Guangdong Province's medical experiment Animal center is provided.
Quality certification number：0090923、0097324、0094245、0094568.
The animal facility quality certification：0057219.
1.3 laboratory apparatus
Superclean bench：Suzhou Jin Yan cleaning equipments Co., Ltd, model：JYB-1300.
Electronic analytical balance：Shanghai Yousheng Balance Co., Ltd., model：BS-3000A, sensibility reciprocal 0.1g.
Microscope：Japanese Olympus factory（OLYMPUS）, model：CX21.
Electronic analytical balance：German Sartorius, model：BS224S3.
High performance liquid chromatography is discussed：Agilent 1100 series.
Rotary Evaporators：Model：EYELA N1000 type Rotary Evaporators, Tokyo physics and chemistry.
PCR：The desk-top high flux DNA synthesizers of ABI 3900, University of Science and Technology's innovation HC-3018R high speed freezing centrifuges, BIO- RAD qualitative PCR instrument, the full-automatic quantitative real time PCR Instruments of ABI-7500.
2 experimental techniques
The preparation of 2.1 Experimental agents
2.1.1 the preparation of teasel root total extract, dipsacus total saponin
3.5kg teasel roots are dried, is chopped up, be processed by the crusher into particle, extracted three times through 6 times of 75% alcohol reflux（Point Wei not 2 hours, 1.5hr and 1.5hr）.After filtering, merge three filtrates, rotated evaporation under reduced pressure concentration removes ethanol, dense About 1500 mL are reduced to without alcohol taste radix dipsaci alcohol extract.Condition concentrated under reduced pressure：Thickening temperature is interval 55 DEG C -60 DEG C, concentrates rotating speed 70 Rpm/min, vacuum is less than 0.1 Mpa.
HP-20 macroporous resin columns in sequential alcohol extract（Diaion HP-20, Mitsubishi Chemical Industries Company, diameter 100 Mm, 1 m high）, first carried out being eluted to distilled water near colourless, then eluted with the ethanol of 8L 95%, collect 95% ethanol elution Liquid, eluent rotated evaporation under reduced pressure concentration removes ethanol, be concentrated into 1000ml without alcohol taste containing TA and total glycosides Dipsacus total saponin crude extract.Condition concentrated under reduced pressure：Thickening temperature is interval 55 DEG C -60 DEG C, concentrates the rpm/min of rotating speed 70, vacuum Degree is less than 0.1 Mpa.Thereafter, dipsacus total saponin crude extract is acidified with 1% watery hydrochloric acid, adjustment pH value to 1-2.Use isometric chlorine Imitative (1000ml) shaking out, obtains the common 16.1g of nonpolarity element (recovery rate is 0.46%).Stand 30 min layerings complete, Removal lower floor extract, same operation extraction four times, aqueous fraction is neutralized with 1% NaOH solution, adjusts pH value 10 ~ 11, is used Isometric chloroform (1000ml) shaking out four times, aqueous fraction is neutralized with 1% hydrochloric acid, and be concentrated under reduced pressure to obtain dipsacus total saponin 775g (recovery rate 22.5%）.4 DEG C, keep in dark place standby.The preparation of teasel root water extract：3.35kg teasel roots are dried, is chopped up, then Particle is processed by the crusher into, is boiled twice with 10 times of decoctings（Respectively 2 hours and 1.5hr）.After filtering, decompression is lower to remove water Point, obtain water extract 1500g (recovery rates 44.7%）.It is stored in 4 DEG C, it is standby.
2.1.2 the preparation of taste SHOUTAI WAN total extract is subtracted
Medicinal material Semen Cuscutae 400g, Ramulus Taxilli 300g, teasel root 300g will be dried, 20 will be ground into medicinal herb grinder respectively ~30 mesh meal, are every time half an hour, temperature 30 with seven times of 95% ethanol (i.e. 7L) refluxing extractions 2 times of amount after being well mixed ~40 DEG C, ultrasound 30 minutes under the conditions of supersonic frequency 40KHz, filtering merges filtrate twice, and solvent is volatilized with Rotary Evaporators, It is concentrated under reduced pressure into medicinal extract, 50 DEG C of thickening temperature, concentration rotating speed 70rpm（Rev/min）, under concentration vacuum 0.1Mpa, concentration Gained medicinal extract is and subtracts taste SHOUTAI WAN alcohol extract sample.
By the filter residue after alcohol extracting, solvent is volatilized at room temperature extremely without alcohol taste, plus seven times of amount distilled water (i.e. 7L) immersions After 30min, heating decocts 30min, and water boiling starts timing.Four layers of filtered through gauze, after filter residue adds distilled water 7L to soak 30min again, Heating decocts 30min, then with four layers of filtered through gauze, merges filtrate twice, and filtrate is concentrated under reduced pressure with Rotary Evaporators, concentrates condition It is as follows：Temperature 60 C, rotating speed 70rpm（Rev/min）, under concentration vacuum 0.1Mpa, concentration gained medicinal extract is and subtracts the taste longevity Tire ball water extract sample.
Taste SHOUTAI WAN alcohol extract will be subtracted to merge with water extract, obtained final product and subtracted taste SHOUTAI WAN total extract sample, weigh 51.6 grams, extracted Rate is 25.8%, is kept in dark place at 4 DEG C, standby.
The identification of 2.2 Experimental agents
2.2.1 the identification of teasel root
2.2.1.1 the Qualitative Identification of each active component of teasel root
Chloroform-strong sulfuric acid response（Qualitive test triterpenoid saponin）
Teasel root ethanol total extract, the purified of teasel root ethanol total extract, total saposins position position sample are taken respectively Aqueous solution 1mL, adds chloroform 2mL, adds concentrated sulfuric acid 3mL and is reacted, and as a result each reaction solution is divided into upper and lower two-layer, teasel root Ethanol total extract, the purified of teasel root ethanol total extract, total saposins position reaction it is larger, wherein total saposins position is upper The layer aqueous solution is changed into purple.Hence, it can be determined that triterpenoid saponin is contained at the position, that is, verify the total saposins portion that the position is teasel root Position.
2.2.1.2. each active component of teasel root and teasel root ethanol total extract composition Contrast analysis
HPLC-UV finger print methods
Teasel root ethanol total extract, the purified of teasel root ethanol total extract and total saposins position sample are taken respectively, respectively Dissolved with appropriate methyl alcohol, cross 0.45 μm of filter membrane, it is standby.Draw respectively in above sample injection high performance liquid chromatography, surveyed Examination.And compareed with reference substance dipsacus total saponin VI.
Chromatographic condition：Chromatographic column：Hyperisil ODS C18 posts (4.6 mm × 250mm i.d., 5 μm)；Stream Dynamic phase：0.1% phosphate aqueous solution (A), acetonitrile (B), 0 ~ 24 min, 5% ~ 17% B；24 ~ 60 min, 17% ~ 25% B；60~80 Min, 25% ~ 50% B, 80 ~ 81 min, 50%-5% B；Detection wavelength：212nm, 254nm, 270nm, 360 nm；Column temperature：30 ℃；Flow velocity：1 ml/min；Sample size：5 μ L, 10 μ L.
As a result：As shown in figure 1, teasel root ethanol total extract, the purified of teasel root ethanol total extract and total saposins position, The HPLC-UV finger-prints of TA position and reference substance dipsacus total saponin VI（212 nm）With preferable similitude；It is continuous The number of the chromatographic peak in the purified chromatogram of disconnected ethanol total extract is significantly more than the chromatographic peak at total saposins position；Meanwhile, The chromatographic peak at dipsacus total saponin position can find corresponding chromatographic peak, and retention time from teasel root ethanol total extract chromatogram It is basically identical；By the ultraviolet absorpting spectrum of identical retention time composition in above sample, each identical retention time is as a result found Composition ultraviolet absorpting spectrum it is identical；These results suggest that total saposins position has identical with teasel root ethanol total extract Study point, and total saposins position is a part for teasel root ethanol total extract composition (referring to Fig. 1).
2.3 Experimental agents dose designs
2.3.1 Experimental agents dose calculation methodology
According to adult's common dose：Semen Cuscutae 20g, Ramulus Taxilli 15g, teasel root 15g are calculated.
Low dose group（Dose,equivalent）：The daily kg body weight dosage of rat（g/kg/d）=adult common dose (g)/ 60kg × 6.25 × recovery rate.
Middle dose group：2.5 times of dose,equivalents.
High dose group：5 times of dose,equivalents.
2.3.2 Experimental agents Rapid Dose Calculation result
Teasel root total extract：Clinical recommended dose be daily 15g (by body weight 60kg calculate), recovery rate 44.7%, equivalent to 0.112g ·kg-1·d-1.Rat dose,equivalent is converted into for 0.6984g kg-1·d-1, 5 times of rat dose,equivalent are height Dosage group, i.e. 3.492g kg-1·d-1, 2.5 times of rat dose,equivalent are middle dose group, i.e. 1.746g kg-1·d-1, 1 times of rat dose,equivalent is low dose group, i.e. 0.6984g kg-1·d-1.Teasel root total extract high dose group is referred to as continuous total high Group, the referred to as continuous total middle group of teasel root total extract middle dose group, teasel root total extract low dose group is referred to as continuous total low group.
Dipsacus total saponin：Clinical recommended dose be daily 15g (by body weight 60kg calculate), recovery rate 22.5%, equivalent to 0.056g ·kg-1·d-1.Rat dose,equivalent is converted into for 0.352g kg-1·d-1, 5 times of rat dose,equivalent are height Dosage group, i.e. 1.76g kg-1·d-1, 2.5 times of rat dose,equivalent are middle dose group, i.e. 0.879g kg-1·d-1, greatly 1 times of mouse dose,equivalent is low dose group, i.e. 0.352g kg-1·d-1.It is high that dipsacus total saponin high dose group referred to as continues total glycosides Group, dipsacus total saponin middle dose group referred to as continues group in total glycosides, referred to as continuous low group of the total glycosides of dipsacus total saponin low dose group.
SHOUTAI WAN total extract：Clinical recommended dose is daily 50g (being calculated by 60kg), according to previous experiments result, is used 1g ·kg-1·d-1Dosage.
Hydroxyurea tablet（Modeling medicine）：The g kg of dosage 0.45-1·d-1。
Mifepristone piece（Modeling medicine）：Dosage 3.75mg kg-1·d-1。
Dydrogesterone piece（Treatment reference substance）：Dosage 3.02mg kg-1·d-1。
2.3.3 the preparation of experimental drug
SHOUTAI WAN total extract：Liquid is directly used.Solid takes 10g fertilization ball total extract grindings, plus physiological saline is to 50ml, Concentration is 0.2g/ml, for the administration of SHOUTAI WAN total extract group.
Teasel root total extract：Add physiological saline to 100ml proportions middle dose group liquids by 34.9g teasel root total extracts, obtain Concentration is 0.349g/ml.0.349g/ml concentration 30ml is taken to be administered for high dose group（Give 2 times of amount）.Press 0.349g/ Ml concentration teasel root total extracts 20ml is diluted to 50ml proportions low dose group liquids, and concentration is 0.1396g/ml.
Dipsacus total saponin：Add physiological saline to 100ml proportions middle dose group liquids by 17.58g dipsacus total saponin, obtain Concentration is 0.1758g/ml.0.1758g/ml concentration 30ml is taken to be administered for high dose group（Give 2 times of amount）.Press 0.1758g/ml concentration dipsacus total saponin 20ml is diluted to 50ml proportions low dose group liquids, and concentration is 0.0703g/ml.
Hydroxyurea tablet is prepared：Take 45 hydroxyurea tablets to be placed in mortar, add a small amount of distilled water grinding, then gradually by liquid It is transferred in graduated cylinder, plus physiological saline is to 250ml, 90mg/ml hydroxyurea tablet liquids is obtained, for modeling.
Mifepristone piece is prepared：Take 2 mifepristone pieces to be placed in mortar, add a small amount of distilled water grinding, then gradually will Liquid is transferred in graduated cylinder, plus physiological saline is to 67ml, 0.75mg/ml mifepristone piece liquids is obtained, for modeling.
The preparation of Dydrogesterone piece：Take 2 Dydrogesterone pieces to be placed in mortar, add a small amount of distilled water grinding, then gradually Liquid is transferred in graduated cylinder, plus physiological saline is to 33.1ml, obtains 0.604mg/ml Dydrogesterone piece liquids.For Dydrogesterone Piece group is administered.
2.3.4 the preparation of dissolution medium
0.5% CMC-Na is prepared：2.5g plus distilled water to 500ml are taken, is fully mixed with vortex mixer and is uniformly dissolved.For continuing Medium well alkaloids cosolvent.
Remaining Experimental agents uses 0.9% normal saline.
2.4 experimental techniques
Breeding：SPF grades of SD rat, non-motherhood raettin 160, male mouse 80, conventinal breeding one week, by female:Male 2:1 mates Breeding 12h.Female rats vaginal smear is looked into morning next day, a large amount of sperms or defulvium of vaginal suppository is occurred with vaginal smear and is met Estrus cellular features are used as pregnant first day, sequence breeding 7 days.
Packet：Pregnant mouse is divided into 13 groups by completely random method, respectively Normal group, model group, Dydrogesterone group, Subtract taste SHOUTAI WAN total extract group, teasel root total extract group（High, medium and low dosage group）, dipsacus total saponin group（High, medium and low dosage group）, Every group 10.
The preparation of kidney deficiency abortion-prone modelses：In addition to Normal group, remaining each group pregnant rat was from the 1st to the 10th Daily hydroxyl urea solution 450mg/kg dosage gavages, daily 5ml/kg, adds filling mifepristone molten by 1 times/day during the 10th day afternoon 3 Liquid (RU486) 3.75mg/kg.Normal group gives the physiological saline of equivalent.
Administration：
Normal group：Give physiological saline, 5ml/kg/ days, 1 times/day, gavage, continuous 10 days.
Model group (hydroxycarbamide+mifepristone), to physiological saline, 1 times/day, gavage, continuous 10 days.
Western medicine group (Dydrogesterone), modeling gives Dydrogesterone simultaneously, 3.02mg/kg, 1 times/day, gavage, continuously 10 days.
Each treatment group：Modeling gives each medicine, 1 times/day, gavage, continuous 10 days simultaneously.
2.5 Testing index
2.5.1 ordinary circumstance：The ordinary circumstance of observation animal, including form daily, hair color, activity, receive food, stool etc..
2.5.2 body weight：The 1st day after breeding, measure respectively and record the weight of animals within the 5th day, the 10th day.
3.5.3 take a blood sample：After mifepristone administration 20h, with etherization, orbital vein/abdominal aortic blood 3-4ml, 1000 turns/min centrifugations 10min separates serum, and -20 DEG C of Refrigerator stores are standby, estradiol to be detected（E2）, progesterone（P）.
2.5.4 gross anatomy
Uterus embryo observes：Animal is dissected after blood sampling, observes colporrhagia and extravasated blood in uterus situation；Sterilization equipment is cut Lower uterus and ovary tissue are placed in washing away blood stains in the culture dish for freeze physiological saline, wipe out adipose tissue and coating, mark Group；Total tire number, live births, abortion number are recorded, abortion ratio is calculated.
The criterion of normal fetus number, Aborted fetus number:
Normal fetus：Normal uterus thick such as beading, pinkiness or pale red, are shown in that embryo is intact, has no after dissection Hemostasis；
Part miscarriage uterus：Hemostasis is seen in uterine cavity, embryo is imperfect.In early days-only have maternal placenta and fetal placenta In the presence of；Mid-term-in addition to above-mentioned tissue, also some fetal tissues；
Complete abortion uterus：Mice weight is remarkably decreased, and uterus changes in ring sample, without obvious hemostasis or necrosis in uterine cavity Embryo only sees embryo nidation point, has no embryo, or embryo is in dark brown or colporrhagia once occurs.
Abortion ratio is calculated：Abortion ratio=
2.5.5 draw materials
（1）HE is dyeed and SABC detection：Take left uterine, ovary to weigh respectively, then longitudinal direction cuts uterus open, carefully Peel off blastocyst and decidua and weigh, implanted blastocyst and decidua are placed in 4% paraformaldehyde solution fixed preservation.HE is carried out respectively Dyeing and SABC detection ER, PR protein expression.
（2）PCR is detected：Right ovary is wrapped with sterile tin foil paper, and right uterine is longitudinally cut open, carefully peels off implanted blastocyst And decidua tissue, and wrap to be placed in cryopreservation tube with sterile tin foil paper respectively and mark, it is immediately placed in -80 DEG C of Refrigerator stores standby With, treat PCR detect ERs（ER mRNA）, progesterone receptor（PR mRNA）Expression.
2.5.6 detect
Estradiol（E2）, progesterone（P）：Detected using radioimmunology, put by nuclear medicine teaching and research room of Traditional Chinese Medicine University Of Guangzhou Exempt from center completion.Radioimmunological kit：Purchased from Beijing Kemei Biological Technology Co., Ltd., lot number：20111225.
ERs (ER), progesterone receptor (PR)：Quantitative fluorescent PCR（Sonde method）Slough off in detection Rats With Unilateral uterus ERs (ER), the expression of the mRNA of progesterone receptor (PR) in film, ovary.
Design of primers synthesizes
Genes of interest Mrna sequences are searched on GenBank, specific primer, software used by design primer are designed in CDS areas Title：The softwares of Primer express 2.0, and using the desk-top high flux DNA synthesizer synthesis of ABI 3900, sequence is as follows：
(1) sequence names：R-ER（Expanding fragment length 69bp）
Forward primer：5’-CCA CCG AGT CCT GGA CAA GA-3’
Reverse primer：5’-TGC AGA GTC AGG CCA GCT T-3’
Probe：5’-FAM-CAA CGA CAC TTT GAT CCA CTT GAT GGC C-TAMRA-3’
(2) sequence names：R-PGR（Expanding fragment length 62bp）
Forward primer：5’-CTC CAG AAG GCG ACC CTA AA-3’
Reverse primer：5’-GCC GGG AGG CTG GAA TT-3’
Probe: 5’-FAM-AGG ACG GGT TCC CAG TTT ACG G-TAMRA-3’
(3) sequence names：R-GAPDH（Expanding fragment length 110bp）Reference gene
Forward primer：5’-AGG GCT GCC TTC TCT TGT GA-3’
Reverse primer：5’-AAC TTG CCG TGG GTA GAG TCA-3’
Probe：5’-FAM-CCA TCA ACG ACC CCT TCA TTG ACC TC-TAMRA-3’
The extraction of total tissue RNA
(1) take during appropriate tissue puts 1.5mlEP pipes, Glass rod grinding tissue, plus Trizol 1 are shredded and used with scissors Ml, fully vibration.
(2) chloroform 0.2ml is added, lid is covered tightly, 15s is firmly shaken, 15-30 DEG C is incubated 2-3min, 4 DEG C of 12000r/ Min is centrifuged 15min, takes supernatant to new 1.5 ml Eppendorf pipes
(3) add and the isometric isopropanol of supernatant, 15-30 DEG C of samples of incubation 10min, 4 DEG C of 12000r/min centrifugations 10min, abandons supernatant
(4) 75% ethanol（Water containing DEPC）Once, 4 DEG C of 7500r/min are centrifuged 5min to 800ul washings precipitation, abandon ethanol.
(5) air or vacuum drying 5-10min（Should not be completely dried）, plus DEPC treatment water dissolving RNAs, -80 DEG C of preservations It is standby.If long-term preserve, 2.5 times of volume ethanols are added, put -80 DEG C of preservations.
Reverse transcription reaction
Take 3 μ l RNA templates and do reverse transcription reaction, instrument is BIO-RAD qualitative PCR instrument（The U.S.）, reaction system is such as Under：
The μ l of 5 × reverse transcription buffer 4
Anti-sense primer（10pmol/μl） 0.5μl
dNTPs（10mM） 0.5μl
MMLV （200U/μl） 0.5μl
DEPC.H2O 11.5μl
The μ l of RNA models 3
Cumulative volume： 20μl
Reverse transcription buffer compositions：50 mM Tris-HCl（pH8.0）, 50 mM KCl, 4 mM MgCl2, 10 mM DTT
Reaction condition：37 DEG C of 1h, then 95 DEG C 3 minutes.
Quantitative fluorescent PCR reacts
1. the preparation of positive criteria product and its gradient：（Standard curve quantitation method）
The preparation of 1.1 positive criteria products：The positive products of trial test PCR amplifications are by 2% low melting-point agarose gel electricity Swimming（Containing Ethidium Bromide, TAE buffers are used）, under long wave ultraviolet, cut off purpose band.Use QIAquick Gel Extraction Kit（QIAquick Gel Extraction Kit）Recovery purifying.Determine OD 260/280>1.8, show that purity is qualified.With OD260 measured values and Fragment length data reduction goes out concentration（copy/μl）, as positive criteria product.
The preparation of 1.2 positive criteria product gradients：The μ l of positive criteria product 5 are taken by 10 times of dilutions（Add water 45 μ l and fully mix It is even）, dilute successively, positive plasmid standards for quantitation gradient is prepared into, doubling dilution must be accurate, otherwise influences quantitative knot Really.Each necessary Fresh positive plasmid standards for quantitation gradient of upper machine, with four gradients comprising all samples during formal above machine Upper machine.
1.3 negative quality control standard product are using sterilizing distilled water
2. sample to be tested and positive criteria product are carried out by following reaction system：
The μ l of 5 × quantitative PCR buffer 10
Sense primer F（10pmol/μl） 1μl
Anti-sense primer R（10pmol/μl） 1μl
Probe（5pmol/μl） 1μl
dNTPs（10mM） 1μl
Taq enzymes（3U/μl） 1μl
cDNA 5μl
ddH2O 30μl
Cumulative volume： 50μl
PCR buffer compositions：10 mM Tris-HCl（pH8.0）, 50 mM KCl, 2 mM MgCl2
3. reaction condition is：93 DEG C 2 minutes, then 93 DEG C 15 seconds, 55 DEG C 25 seconds, 72 DEG C 25 seconds, totally 40 circulation.
Statistics
Result presses the numerical value under Quantity row in form（That is copy number）Analysis, is represented, i.e. B=copy numbers/μ l with B cDNA.If the difference of each sample total rna concentration is considered in the expression between comparing each sample, final calculation result is pressed Row formula scales：
A = B1（Genes of interest）÷B2（Reference gene）
A values are only the final numerical value for needing during statistics.
3 statistical methods
Statistical disposition is carried out to rat body weight and each Testing index and is tabulated, each group data adds and subtracts standard deviation with mean Represent（）, using SPSS13.0 statistical softwares one-way analysis of variance, Repeated Measurement Data count method carry out control group with The statistical significance inspection of each administration group difference.If variance is neat, mean compares and is checked with LSD-t between two groups.Enumeration data is adopted With Chi-square Test (x2).With P<0.05 is statistically significant.
4 experimental results
4.1 teasel root total extracts, influence of the dipsacus total saponin to kidney dificiency abortion model rat general state
Rats in normal control group general state is good, and hair color is smooth, and reaction is flexible, and food-intake is normal, body weight steady-state growth, Stool is normal.Model group rats occur the loose deficient gloss of chaeta on the 3rd day from modeling, slow in reacting, and food-intake is reduced, and hogback is tired Dynamic, the phenomenon such as muscular flaccidity is reduced, the state of similar kidney-yang deficiency is shown.Dydrogesterone group, the taste SHOUTAI WAN group that subtracts, teasel root group, There is hogback, ted and less moving in dipsacus total saponin, the indivedual rats of teasel root TA group, and the phenomenon such as muscular flaccidity is compared with model group Gently, time of occurrence is slower, and preliminary display teasel root and its each composition have the work that improves aborting rat kidney deficiency similar to SHOUTAI WAN With.
4.2 teasel root total extracts, influence of the dipsacus total saponin to kidney dificiency abortion model rat body weight
Result above shows：
First day：Each experimental group is not statistically significant (P ＞ 0.05) with control group bodyweight difference, and each group animal has for display Comparativity.
5th day：Teasel root total extract middle dose group, continuous low group of total glycosides compared with Normal group, weight loss (P< 0.05).It is not statistically significant (P ＞ 0.05) that each group compares difference with model group.
Tenth day：Subtract taste SHOUTAI WAN group, continued total high group, continue group, continuous low group of total glycosides in total middle group, continuous total low group, continuous total glycosides Compared with Normal group, weight loss (P<0.05).It is not statistically significant (P ＞ 0.05) that each group compares difference with model group.
5.3 teasel root total extracts, influence of the dipsacus total saponin to kidney dificiency abortion model rat embryo number and abortion ratio
Average tire number：Each medication group compares with Normal group and model group, no significant difference (P>0.05).It is aobvious There is comparativity between showing each group.
Live births：Model group, the taste SHOUTAI WAN group that subtracts, continuous low group of total glycosides compare with Normal group, and live births are significantly reduced, Difference has pole statistical significance (P<0.01).Continuous total low group is compared with Normal group, and live births are reduced, and difference has statistics Learn meaning (P<0.05).Continuous total middle group compares live births increase, the statistically significant (P of difference with model group<0.05).
Abortion number：Model group, the taste SHOUTAI WAN group that subtracts, continuous low group of total glycosides compare with Normal group, and abortion number is dramatically increased, Difference has pole statistical significance (P<0.01), continued total high group, continuous total low group compare with Normal group, abortion number increase, difference Statistically significant (P<0.05) .Continuous total middle group compares with model group, and abortion number is reduced, the statistically significant (P of difference< 0.05)。
Abortion ratio：Organized in Dydrogesterone group, continuous total middle group, continuous total glycosides and compared with Normal group, no statistical difference meaning Justice (P>0.05) .Organized in continuous total middle group, continuous total glycosides and compared with model group, abortion ratio reduction, the statistically significant (P of difference< 0.05).Model group, the taste SHOUTAI WAN group that subtracts, continuous low group of total glycosides compare with Normal group, and abortion ratio is dramatically increased, and difference has pole Statistical significance (P<0.01), continued total high group, continuous total low group compare abortion ratio with Normal group and increase, difference has statistics to anticipate Justice (P<0.05).
5.4 teasel root total extracts, dipsacus total saponin are to the bleeding of kidney dificiency abortion model rat vagina and the influence of extravasated blood in uterus
Result above shows：Each group colporrhagia rate is statistically significant, colporrhagia rate is ascending be arranged in order for： Continue group=Dydrogesterone group=normal group ＜ in total glycosides and to continue organize in total glycosides ＜ and subtract taste SHOUTAI WAN group ＜ and continue low group of ＜ of total glycosides and continue total glycosides High group ＜ continued total high groups=continuous total low group of ＜ model
Result above shows：Each group extravasated blood in uterus rate is not statistically significant.
The influence of 5.5 teasel root total extracts, dipsacus total saponin to kidney deficiency aborting rat genitals weight in wet base
Unilateral uterine wet weight：Group compares unilateral uterine wet weight with Normal group in model group, Dydrogesterone group, continuous total glycosides Mitigate, statistically significant (P<0.05).Each treatment group compares with model group, and unilateral uterine wet weight difference is not statistically significant (P>0.05)。
One ovary weight in wet base：Each medication group compares with Normal group and model group, the not statistically significant (P of difference> 0.05)。
Single embryo's weight in wet base：Model group, continuous total low group compare with Normal group, single embryo's weight in wet base mitigation has statistics Learn meaning (P<0.05), continue that total glycosides is high, middle dose group compares with model group, single embryo's weight in wet base increases, and difference has statistics to anticipate Justice (P<0.05).
5.6 teasel root total extracts, dipsacus total saponin are on the endocrine influence of kidney deficiency aborting rat
E2：Continued total high group, it is continuous total in compare with Normal group, E2Not statistically significant (the P of difference>0.05), remaining each group Difference compares with Normal group, E2Reduce, the statistically significant (P of difference<0.01),.
Continuous total high, middle group is compared with model group, E2Increase, the statistically significant (P of difference<0.05).
It is believed that E after the high, normal, basic group of modeling of continuous total low, continuous total glycosides2Level decreases compared with normal group, and continuous total high, continuous total The middle group of estradiol level that can improve model group and reach the level of Normal group.
P：Model group, continuous total, continuous total each dosage group of glycosides compare with Normal group, P reductions, the statistically significant (P of difference <0.01).Each group compares with model group, the not statistically significant (P of P difference>0.05).
P levels decrease after each group modeling, and teasel root each group can not significantly improve the progesterone of kidney deficiency aborting rat model Level.
5.7 teasel root total extracts, influence of the dipsacus total saponin to kidney deficiency aborting rat uterus and ovary progesterone expression
Uterine decidua PR mRNA：Organized in continuous total middle group, continuous total glycosides and compared with Normal group and with model group, uterus is sloughed off Film PR mRNA increase, the statistically significant (P of difference<0.05).
Ovary PR mRNA：Continuous total middle group compares with Normal group, and ovary PR mRNA increase, and difference is statistically significant (P<0.01).Organized in continuous total middle group, continuous total glycosides and compared with model group, ovary PR mRNA increase, the statistically significant (P of difference< 0.01)。
Result shows：Group can improve the progestational hormone of kidney dificiency abortion model rat uterus and ovary in continuous total middle group, continuous total glycosides Acceptor levels.
5.8 teasel root total extracts, influence of the dipsacus total saponin to kidney deficiency aborting rat uterus and ovarioestrogen expression of receptor
Uterine decidua ER mRNA：Continuous total middle group compares with Normal group, and uterine decidua ER mRNA increase, and difference has system Meter learns meaning (P<0.01) organized in continuous total glycosides and compared with Normal group, uterine decidua ER mRNA increase, and difference has statistics Meaning (P<0.05).Organized in continuous total middle group, continuous total glycosides and compared with model group, uterine decidua ER mRNA increase, and difference has statistics Meaning (P<0.01).
Ovary ER mRNA：Continuous total middle group difference compares with Normal group and model group, and ovary ER mRNA increase, poor Not statistically significant (P<0.01) group difference compares with Normal group and model group in, continuing total glycosides, and ovary ER mRNA are equal Increase, the statistically significant (P of difference<0.05).
Result shows：Group in continuous total, continue group in total glycosides and can significantly improve the female of kidney dificiency abortion model rat uterus and ovary The expression of hormone receptor.
Above experimental result shows, in the mechanism of action, dipsacus total saponin significantly improves the ovum of kidney dificiency abortion model rat Nest and the progesterone receptor level and Estrogen Receptor in uterus, so as to significantly improve the tire living of kidney dificiency abortion model rat Number, reduces abortion number, abortion ratio reduction, and can reduce the colporrhagia of kidney dificiency abortion model rat, illustrates that teasel root is total Saponin(e has antiabortive effect.
Embodiment one：The preparation of dipsacus total saponin
3.5kg teasel roots are dried, is chopped up, particle is processed by the crusher into, through 6 times（Weight/volume）75% ethanol is returned Stream is extracted three times（Respectively 2 hours, 1.5hr and 1.5hr）.After filtering, merge three filtrates, rotated evaporation under reduced pressure is dense Contracting removes ethanol, is concentrated into about 1500 mL without alcohol taste radix dipsaci alcohol extract.Condition concentrated under reduced pressure：Thickening temperature is interval 55 DEG C -60 DEG C, concentration rotating speed 70 rpm（Rpm）, vacuum is less than 0.1 Mpa.
HP-20 macroporous resin columns in sequential alcohol extract（Diaion HP-20, Mitsubishi Chemical Industries Company, diameter 100 Mm, 1 m high）, first carried out being eluted to distilled water near colourless, then eluted with the ethanol of 8L 95%, collect 95% ethanol elution Liquid, eluent rotated evaporation under reduced pressure concentration removes ethanol, be concentrated into 1000ml without alcohol taste containing TA and total glycosides Dipsacus total saponin crude extract.Condition concentrated under reduced pressure：Thickening temperature is interval 60 DEG C, concentrates the rpm/min of rotating speed 70, and vacuum is less than 0.1 Mpa.Thereafter, dipsacus total saponin crude extract is acidified with 1% watery hydrochloric acid, adjustment pH value to 1-2.Use isometric chloroform (1000ml) shaking out, obtains the common 16.1g of nonpolarity element (recovery rate is 0.46%).Stand 30 min layerings complete, go Except lower floor's extract, same operation extraction four times, aqueous fraction is neutralized with 1% NaOH solution, adjusts pH value 10 ~ 11, with etc. Volume of chloroform (1000ml) shaking out four times, aqueous fraction is neutralized with 1% hydrochloric acid, and be concentrated under reduced pressure to obtain dipsacus total saponin.
Condition concentrated under reduced pressure is above：60 DEG C of thickening temperature, concentration rotating speed 70rpm（Rpm）, concentrate vacuum 0.1Mpa。
Embodiment two：The preparation of dipsacus total saponin
3.5kg teasel roots are dried, is chopped up, particle is processed by the crusher into, through 5 times（Weight/volume）75% ethanol is returned Stream is extracted three times（Respectively 2 hours, 1.5hr and 1.5hr）.After filtering, merge three filtrates, rotated evaporation under reduced pressure is dense Contracting removes ethanol, is concentrated into about 1500 mL without alcohol taste radix dipsaci alcohol extract.Condition concentrated under reduced pressure：Thickening temperature is interval 55 DEG C, concentration The rpm of rotating speed 70（Rpm）, vacuum is less than 0.1 Mpa.
HP-20 macroporous resin columns in sequential alcohol extract（Diaion HP-20, Mitsubishi Chemical Industries Company, diameter 100 Mm, 1 m high）, first carried out being eluted to distilled water near colourless, then eluted with the ethanol of 8L 95%, collect 95% ethanol elution Liquid, eluent rotated evaporation under reduced pressure concentration removes ethanol, be concentrated into 1000ml without alcohol taste containing TA and total glycosides Dipsacus total saponin crude extract.Condition concentrated under reduced pressure：Thickening temperature is interval 55 DEG C, concentrates the rpm/min of rotating speed 70, and vacuum is less than 0.1 Mpa.Thereafter, dipsacus total saponin crude extract is acidified with 1% watery hydrochloric acid, adjustment pH value to 1 ~ 2.Use isometric chloroform (1000ml) shaking out, stands 30 min layerings completely, removal lower floor extract, same operation extraction four times, aqueous fraction Neutralized with 1% NaOH solution, adjust pH value 10 ~ 11, with isometric chloroform (1000ml) shaking out four times, aqueous fraction with 1% hydrochloric acid is neutralized, and be concentrated under reduced pressure to obtain dipsacus total saponin.
Condition concentrated under reduced pressure is above：55 DEG C of thickening temperature, concentration rotating speed 70rpm（Rpm）, concentrate vacuum 0.1Mpa。
Embodiment three：The preparation of dipsacus total saponin
3.5kg teasel roots are dried, is chopped up, particle is processed by the crusher into, through 7 times（Weight/volume）75% ethanol is returned Stream is extracted three times（Respectively 2 hours, 1.5hr and 1.5hr）.After filtering, merge three filtrates, rotated evaporation under reduced pressure is dense Contracting removes ethanol, is concentrated into about 1500 mL without alcohol taste radix dipsaci alcohol extract.Condition concentrated under reduced pressure：Thickening temperature is interval 58 DEG C, concentration The rpm of rotating speed 70（Rpm）, vacuum is less than 0.1 Mpa.
HP-20 macroporous resin columns in sequential alcohol extract（Diaion HP-20, Mitsubishi Chemical Industries Company, diameter 100 Mm, 1 m high）, first carried out being eluted to distilled water near colourless, then eluted with the ethanol of 8L 95%, collect 95% ethanol elution Liquid, eluent rotated evaporation under reduced pressure concentration removes ethanol, be concentrated into 1000ml without alcohol taste containing TA and total glycosides Dipsacus total saponin crude extract.Condition concentrated under reduced pressure：Thickening temperature is interval 58 DEG C, concentrates the rpm/min of rotating speed 70, and vacuum is less than 0.1Mpa.Thereafter, dipsacus total saponin crude extract is acidified with 1% watery hydrochloric acid, adjustment pH value to 1 ~ 2.Use isometric chloroform (1000ml) shaking out, stands 30 min layerings completely, removal lower floor extract, same operation extraction four times, aqueous fraction Neutralized with 1% NaOH solution, adjust pH value 10 ~ 11, with isometric chloroform (1000ml) shaking out four times, aqueous fraction with 1% hydrochloric acid is neutralized, and be concentrated under reduced pressure to obtain dipsacus total saponin.
Condition concentrated under reduced pressure is above：58 DEG C of thickening temperature, concentration rotating speed 70rpm（Rpm）, concentrate vacuum 0.1Mpa。
Sequence table
<110>Luo Songping
<120>Application of the dipsacus total saponin in antiabortive medicine is prepared
<160> 9
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>Forward primer
<400> 1
CCACCGAGTCCTGGACAA GA 20
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>Reverse primer
<400> 2
TGCAGAGTCAGGCCAGCTT 19
<210> 3
<211> 28
<212>
<213>Artificial sequence
<220>
<223>Probe
<400> 3
FAM-CAACGACACTTTGATCCACTTGATGGCC-TAMRA 28
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>Forward primer
<400> 4
CTCCAGAAGGCGACCCTA AA 20
<210> 5
<211> 17
<212> DNA
<213>Artificial sequence
<220>
<223>Reverse primer
<400> 5
GCCGGGAGGCTGGAA TT 17
<210> 6
<211> 22
<212>
<213>Artificial sequence
<220>
<223>Probe
<400> 6
FAM-AGGACGGGTTCCCAGTTTACGG-TAMRA 22
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>Forward primer
<400> 7
AGGGCTGCCTTCTCTTGT GA 20
<210> 8
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>Reverse primer
<400> 8
AACTTGCCGTGGGTAGAGTCA 21
<210> 9
<211> 26
<212>
<213>Artificial sequence
<220>
<223>Probe
<400> 9
FAM-CCATCAACGACCCCTTCATTGACCTC-TAMRA 26

Claims (7)

1. dipsacus total saponin is used as the application prepared in antiabortive medicine.
2. dipsacus total saponin is used as the application prepared in the medicine for reducing abortion ratio.
3. dipsacus total saponin is used as the application prepared in the medicine for improving live births.
4. dipsacus total saponin is used as the application prepared in the medicine for reducing colporrhagia.
5. dipsacus total saponin is used as the application prepared in the pregnant endocrine medicine of regulation.
6. dipsacus total saponin is used as the application for preparing the progesterone receptor level medicine for improving gestational period ovary and uterus.
7. dipsacus total saponin is used as the application for preparing the Estrogen Receptor medicine for improving gestational period ovary and uterus.
CN201410482049.5A 2014-09-19 2014-09-19 Application of the dipsacus total saponin in antiabortive medicine is prepared Active CN104288188B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410482049.5A CN104288188B (en) 2014-09-19 2014-09-19 Application of the dipsacus total saponin in antiabortive medicine is prepared

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410482049.5A CN104288188B (en) 2014-09-19 2014-09-19 Application of the dipsacus total saponin in antiabortive medicine is prepared

Publications (2)

Publication Number Publication Date
CN104288188A CN104288188A (en) 2015-01-21
CN104288188B true CN104288188B (en) 2017-06-09

Family

ID=52308302

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410482049.5A Active CN104288188B (en) 2014-09-19 2014-09-19 Application of the dipsacus total saponin in antiabortive medicine is prepared

Country Status (1)

Country Link
CN (1) CN104288188B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180050005A1 (en) * 2016-08-16 2018-02-22 Janssen Pharmaceutica Nv Concentrated Solution of 17-Hydroxydocosahexaenoic Acid

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1384110A (en) * 2002-05-20 2002-12-11 吉林天药科技股份有限公司 Prepn of hederagenin
KR20060008022A (en) * 2004-07-23 2006-01-26 유형근 Bone tissue regeneration promoter comprising oleanane compounds
CN101161251A (en) * 2007-11-22 2008-04-16 广州博济医药生物技术有限公司 On-off total saponin as well as its extracting method and application

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1384110A (en) * 2002-05-20 2002-12-11 吉林天药科技股份有限公司 Prepn of hederagenin
KR20060008022A (en) * 2004-07-23 2006-01-26 유형근 Bone tissue regeneration promoter comprising oleanane compounds
CN101161251A (en) * 2007-11-22 2008-04-16 广州博济医药生物技术有限公司 On-off total saponin as well as its extracting method and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
大孔吸附树脂分离纯化五鹤续断总皂苷的工艺研究;赵丽等;《医药导报》;20070630;第26卷(第6期);第649-651页 *
续断生药学研究;刘京晶;《中国博士学位论文全文数据库 医药卫生科技辑》;中国学术期刊（光盘版）电子杂志社;20111115(第11期);第21-25页 *

Also Published As

Publication number Publication date
CN104288188A (en) 2015-01-21

Similar Documents

Publication Publication Date Title
Sankhwar et al. Resident Perception of Obstetrical Hospitalists as Parturient Care Providers and Educators
Huang et al. Immunomodulatory mechanism of Bushen Huoxue Recipe alleviates cyclophosphamide-induced diminished ovarian reserve in mouse model
CN102258685B (en) Compound traditional Chinese medicine for treating diminished ovarian reserve and application
CN101073643B (en) Chinese-medicinal preparation for preventing and treating hypogalactias and and gynecopathy, its production and use
CN103223155B (en) Medicament for treating postpartum hemorrhage
Zhang et al. Study on prevention effect of Zishen Yutai pill combined with progesterone for threatened abortion in rats
WO2021253742A1 (en) Application of wubi chinese yam pills in preparation of drug for treatment of premature ovarian insufficiency
AU2021102869A4 (en) A traditional chinese medicine preparation and its application for treating infertility
CN104288188B (en) Application of the dipsacus total saponin in antiabortive medicine is prepared
CN115487247B (en) Traditional Chinese medicine composition and process for treating threatened abortion
CN101077384B (en) Application of traditional Chinese medicine preparation in preparing medicine for treating and preventing gynaecologic disease
CN107412555B (en) A medicine for treating ovulation disorder and preparation method thereof
CN107982269B (en) Application of crocetin in preparation of medicine for preventing and treating polycystic ovarian syndrome
CN100562323C (en) A kind of pharmaceutical composition for the treatment of hysteromyoma and preparation method thereof
CN103330721A (en) Holothurian flower extract for treatment of female POF and its preparation method
CN102008688B (en) Medicament for treating periodic psychosis
CN114869952A (en) Application of cortex lycii radicis extract in preparation of product for repairing reproductive system injury
CN104645297B (en) A kind of temperature palace helps pregnant Chinese medicine composition and its formulation preparation method
CN102125671B (en) Traditional Chinese medicinal composition for treating gynaecopathia caused by deficiency of the kidney and cold and preparation method thereof
CN106421727A (en) Traditional Chinese medicine composition for treating painful menstruation and preparation method and application thereof
CN105943758A (en) Traditional Chinese medicine composition for treating infertility and application of traditional Chinese medicine composition
CN102048913A (en) Traditional Chinese medicine preparation for treating climacteric syndrome and preparation method thereof
CN104288171B (en) Application of the Ramulus Taxilli total starches in antiabortive medicine is prepared
CN114748490B (en) Pharmaceutical composition for treating premature ovarian failure, application and preparation method thereof
CN116688000B (en) Application of ramulus mori total alkaloids in preparation of medicines for treating polycystic ovary syndrome (PCOS)

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant