CN104250647B - A kind of drought-inducible promoter and application thereof - Google Patents
A kind of drought-inducible promoter and application thereof Download PDFInfo
- Publication number
- CN104250647B CN104250647B CN201410442242.6A CN201410442242A CN104250647B CN 104250647 B CN104250647 B CN 104250647B CN 201410442242 A CN201410442242 A CN 201410442242A CN 104250647 B CN104250647 B CN 104250647B
- Authority
- CN
- China
- Prior art keywords
- promoter
- plant
- drought
- genes
- interest
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
One drought-inducible promoter of the present invention and application thereof belong to genetic engineering field, are specifically related to the non-coding nucleic acid that in DNA recombinant technique, a kind of regulator gene is expressed.The promoter that the present invention provides, the nucleotides sequence of this promoter is classified as SEQ ID NO:1.Promoter of the present invention can provide experiment and technical support for the research and development of plant bioreactor.Drought-inducible promoter described in utilization, using plant as bioreactor, expresses vaccine, antibody and other pharmaceutical proteins etc., can break through traditional agriculture category, extend to medical domain.
Description
Technical field
The invention belongs to genetic engineering field, be specifically related to the non-coding nucleic acid that in DNA recombinant technique, a kind of regulator gene is expressed.
Background technology
In plant genetic engineering is studied, external source genes of interest is made to express in receptor, to improve the crop resistance to environment stresses such as arid, low temperature, saline and alkaline and pest and disease damages, or improve crop quality and Crop Improvement economical character etc., it has also become a kind of important means of current crop breeding.Eukaryotic gene expression regulation includes pretranscriptional control, transcriptional control, post-transcriptional control, translational control and post-translational control.Wherein, the regulation and control of transcriptional level, by cis acting element and transcription factor coordinative role, are the key links of expression regulation.Therefore, separation and research about promoter become one of domestic and international focus studied.
Constitutive promoter is used to order about exogenous gene expression, not only cause the wasting of resources, also directly affect the growth promoter of plant and normal physiological metabolism, and use inducible promoter, not only do not result in the waste of various resource, plant resistance to external world can be strengthened again, reduce growth and development of plants and the impact of other metabolic pathways.Therefore, how to control exogenous gene high efficient expression at regular time and quantity, be the key point effectively applied in terms of crop genetic improvement of technique for gene engineering.In addition to finding effective genes of interest, find that the promoter effectively controlling exogenous gene expression becomes the major issue needing to solve in genetic engineering improvement.Promoter is roughly divided into constitutive promoter, tissue-specific promoter and inducible promoter three kinds according to its function and model of action.The gene expression of constitutive promoter regulation and control is not affected by external environmental condition, almost can express in all plant different tissues.Typically cauliflower mosaic virus (cauli-flower
Mosaic virus, CaMV) 35S promoter, it is widely used in dicotyledon transgenic engineering (Benfey etc., 1990, Science 250,959-966).Other unifacial leaf has maize ubiquitin Ubiquitin promoter (Streatfield
Deng, 2004, Transgenic Res 13,299-312) and rice actin (Actin) promoter.Such promoter activity is higher, but owing to it causes exogenous gene to be expressed at the different parts of the whole growth period of transgenic plant, affecting growth promoter and the normal physiological metabolism of plant, some product is likely to result in toxic action, it is unfavorable for the raising of quality and yield, results even in the death of plant.Kasuga etc. utilize induction type rd29A promoter to replace CaMV35S promoter arabidopsis thaliana transformation, improve the drought resistance of transgenic arabidopsis, decrease plant strain growth stagnation or the generation (Kasuga of dwarfism that composing type process LAN causes simultaneously, 2004, Plant and Cell Physiology
45, 346-350).Therefore, research and application in order to preferably regulate and control the expression of plant gene, tissue specific promoter and inducible promoter are increasingly paid attention to by people.
Tissue specific promoter is that regulation and control genes of interest is only expressed in certain organs or tissue.Such promoter generally there are the specific motifs that some are relevant to tissue specificity.Nitz etc. are isolated coding myrosin gene Pyk10 promoter sequence of specifically expressing in root and hypocotyl from arabidopsis, this promoter can regulate and control genes of interest at transgenic arabidopsis root high level specifically expressing (Nitz etc., 2001, Plant Science, 161,337-346).The promoter that Bate etc. analyze Rhizoma Solani tuber osi specific expression gene LAT25 by deletion mutation finds, regulation and control pollen-specific Expression element is positioned at this gene promoter-492 to-52 section (Bate etc., 1998,37,859-869).Maize leaf specificity PPCA1 promoter (Gowik
Deng, 2004, Plant Cell 16,1077-1090), strawberry fruit specificity GalUR promoter (Agius
Deng, 2005, J Exp Bot
56,37-46) etc..Further investigation to such promoter contributes to illustrating the rationale of growth and development of plants and physiological metabolism, and is with a wide range of applications.Inducible promoter refers to not express under normal condition or low expression, by some physically or chemically signal stimulated, the expression one class promoter of gene can be significantly increased.According to inducement, inducible promoter can be divided into Light-inducible promoter, temperature inducible promoter, wound inducement type promoter, hormone inducible promoter and fungus induction type promoter etc..It is characterized in: induced by physically or chemically factor；Containing several functions element, the collaborative activity strengthened or reduce promoter；Part inducible promoter has the feature of tissue-specific promoter simultaneously.Other inducible promoters such as Oryza sativa L. plasma membrane CaATPase promoter is induced (Huda etc., 2013, PLoS One 8) by arid, cold, (-)-methyl cis-2-pent-2'-enyl-3-oxocyclopentylacetate and abscisic acid.Arabidopsis RBCS-1A promoter is Light-inducible promoter, has tissue specificity (practise rain beautiful jade etc., 2012, Acta Agronomica Sinica 38,1561-1569) simultaneously；For inducible promoter, genes of interest only just can be expressed after accepting inducement signal, does not only result in the waste of various resource, can strengthen again plant resistance to external world, reduces growth and development of plants and the impact of other metabolic pathways.Therefore, studying and utilize inducible promoter, the adversity gene engineering for the research various physiological Mechanism coerced of plant responding and research crops has important meaning, also has broad application prospects in terms of basic research and Plant Biotechnology.But up to the present, the inducible promoter that can apply to transgenic research is the most little.Therefore, for the interaction between new degeneration-resistant promoter related clone, the determination of cis acting element particular sequence, each element, and remain the emphasis of promoter research from now on the research of the transcription factor of these element interactions.
Summary of the invention
It is an object of the invention to provide a kind of promoter and application thereof that can start destination gene expression when drought-induced.One aspect of the present invention provides a kind of promoter, and the nucleotides sequence of this promoter is classified as SEQ ID NO:1.
Present invention also offers the recombinant vector containing above-mentioned promoter, expression cassette, transgenic cell or recombinant bacterium.
Described recombinant vector be insert at the multiple clone site of carrier described in promoter after the recombiant plasmid that obtains.
Described expression cassette is by described promoter, the genes of interest of this promoter expression, and transcription terminator composition；Described promoter is connected with described genes of interest with functional way, and described genes of interest is connected with described transcription terminator.
The present invention have an aspect there is provided described promoter start genes of interest in plant express in application.Preferably when drought-induced.
A further aspect of the invention there is provided a kind of method utilizing described promoter to cultivate transgenic plant, comprises the steps:
1) build genes of interest recombinant expression carrier: be inserted into by genes of interest in the recombinant vector containing described promoter, drought-induced make described promoter start described destination gene expression, obtain genes of interest recombinant expression carrier；
2) the genes of interest recombinant expression carrier that step 1) builds is imported in purpose plant, drought-induced make described promoter start described destination gene expression, obtain expressing the transgenic plant of described genes of interest.
A further aspect of the invention there is provided a kind of method making plant express genes of interest when drought-induced, it is to be inserted into by genes of interest in the recombinant vector containing described promoter, and this recombinant vector is imported in purpose plant, the most drought-induced genes of interest is expressed in plant.
Promoter of the present invention can provide experiment and technical support for the research and development of plant bioreactor.Drought-inducible promoter described in utilization, using plant as bioreactor, expresses vaccine, antibody and other pharmaceutical proteins etc., can break through traditional agriculture category, extend to medical domain.
Accompanying drawing explanation
Fig. 1: promoter of the present invention pCD4 Build PCR electrophoretogram.
The promoter of Fig. 2: the present invention pCD4 Connect T vector plasmid enzyme action and identify electrophoretogram.
The promoter of Fig. 3: the present invention pCD4 Connect pC0390GUS enzyme action and identify electrophoretogram.
Fig. 4: under the conditions of drought-induced, promoter pCD4 The gus gene histochemical stain of transformation of tobacco blade.
Fig. 5: under the conditions of drought-induced, promoter pCD4 With the GUS expression activitiy compareed.
Detailed description of the invention
Below in conjunction with the accompanying drawings the method for the present invention is described in detail, but purpose described below is exemplary rather than limits the scope of the present invention.
Embodiment 1: drought-inducible promoter of the present inventionpCD4Separation
The preparation of 1.1 sweet buckwheat genomic DNAs
Being 8000LUX by the sweet buckwheat Seedling of band culture matrix at illumination condition, temperature is 25oGrow 3 weeks under the conditions of C.Then proceeding to illumination condition is 8000LUX, then uses plant genes group DNA rapid extraction test kit (catalog number (Cat.No.) DN15) of Ai Delai bio tech ltd, Beijing to extract DNA.
1.2 promoter pCD4 Cloned culturing
With the DNA that extracts above as template, expand FeDREB1 upstream region of gene promoter sequence by PCR method.Its amplimer is as follows, introduces Hind III restriction enzyme site in its forward primer, introducing Bamh I restriction enzyme site in downstream primer:
Forward primer: 5'-
CCCAAGCTTAAGGTTCTTTGCAAGTC -3'
Downstream primer: 5'-GCGGATCCGATCGATCCTGAATATAT
-3'
PCR reaction system
PCR response procedures: 94OC degeneration 5 min；94OC degeneration 30 s, 60OC anneals 30 s, and 72OC extends 2 min, 29 circulations；72OC 10 min,4OC is incubated.
Detect PCR result with the agarose gel electrophoresis of 1.0 %, see Fig. 1.
The recovery from agarose gel of the genes of interest DNA fragment is reclaimed test kit with Tian Gen biochemical technology company limited DNA and is reclaimed, and operation illustrates to carry out according to test kit.
PMD19-T Simple Vector) coupled reaction
Coupled reaction operates according to the PMD19-T Simple Vector support agent box explanation of takara company, and coupled reaction system is as follows:
Mixing reactant, of short duration centrifugal, 4 DEG C overnight.
Qualification with positive colony
Escherichia coli for converting are that DH5a(is purchased from Tian Gen biochemical technology company limited).The preparation of competent cell and the conversion of connection product the most aseptically operate.Picking converts the white colony on flat board, use plasmid to extract test kit on a small quantity and extract plasmid (be purchased from Tian Gen biochemical technology company limited) as template, PCR primer and amplification condition as described above carry out PCR amplification, the DNA fragmentation of a length of 1278bp is produced through agarose gel electrophoresis detection, named pCD4 。
4. sequence verification
Through identify pCD4 Positive colony, send Sangon (Shanghai Sheng Gong Bioisystech Co., Ltd) to carry out DNA sequencing, and its nucleotide sequence is as shown in sequence table 1.
Embodiment
2:
Promoter
pCD4
The structure of plant transient expression vector
Utilize Bam HI andHind III Cobra venom endonuclease enzyme action recombinant cloning vector (T+ pCD4 ) andpC0390::GUS Carrier (Fig. 2, Fig. 3), then willPromoter pCD4 WithpC0390::GUS The gus reporter gene of carrier connects, and builds plant transient expression vector.The plant transient expression vector built is namedpCD4::GUS 。pC0390::GUSCarrier andpC35S::GUSCarrier is provided by Ningxia University xuwei doctor Rong, concrete building process reference literature (Xu etc., 2010, Planta, 231:475 487).Use electric shocking method, by buildpCD4::GUSCarrier,pC0390::GUSCarrier (negative control) andpC35S::GUSCarrier (positive control) is directed respectively in Agrobacterium tumefaciems competence bacterial strain GV3101 with standby.
Embodiment
3:
Identify under drought condition, promoter
pCD4
Activity
3.1
3.1.1
Nicotiana tabacum L. is cultivated and instantaneous conversion
Ben Shi tobacco seed, after 4 DEG C process 1 week, is seeded in the sterilization matrix of nutritive cube, and covers preservative film, moves into artificial intelligence's weather incubator after seeding room grows 3 weeks and emerges.The tobacco plant of 5 weeks is cultivated for agriculture bacillus mediated instantaneous conversion analysis in incubator.Concrete method for transformation is as follows: 1. inoculation comprises Agrobacterium 20 μ l that promoter and GUS construct in LB fluid medium fresh for 20mL, additional rifampicin 50mg L-1, Kan 50mg L-1, in 28 DEG C of constant-temperature table 240rpm, incubated overnight；2. the Agrobacterium bacterium solution of incubated overnight is transferred in the sterile centrifugation tube of 50mL, in room temperature 6000rpm, centrifugal 10min；3. supernatant is abandoned, and with permeabilization buffer (10 mM of 10mL
MES, 10 mM
MgCl2, 100 μMs of AS pH, 5.7) resuspended thalline；4. take resuspended after bacterium solution 2mL, measure OD600 value, the bacterium solution being diluted to OD600 value about 0.6 with permeabilization buffer is used for converting；5. with before the Agrobacterium bacterium solution injection tobacco leaf epidermal cells after dilution, Nicotiana tabacum L. is taken out from climate box, is placed in 1h under incandescent light, make pore open being beneficial to completely inject infiltration.6. draw ready Agrobacterium bacterium solution with the syringe of the needleless of 1mL, at the injection point chosen, syringe needle is propped up, slowly bacterium solution is injected the intercellular substance of tobacco leaf, make bacterium solution penetrate into whole blade as far as possible.7. the tobacco plant after infiltration covers preservative film, puts back to weather incubator, renewal cultivation 1d；8. after cultivating 1 d, the aqueous solution of transformation of tobacco plant 15% PEG6000 processes in impregnated tobacco plant root simulating drought induction；The most above-mentioned each transformation of tobacco plant is respectively after drought stress processes and normal condition cultivates 1 d, and clip adjoining tree and drought stress process the blade of plant with further analysis use immediately.
3.1.2
Transformation of tobacco plant leaf
GUS
Expression activity is analyzed
GUS histochemical stain is with reference to the scheme of Jefferson (1987).Tobacco leaf material is placed in sterilizing plate, adds GUS dyeing liquor (10 mM
Na2EDTA, 100 mM NaH2PO4, 0.5 Mm K4Fe(CN)6·3H2O, 0.1% Triton X-100 and 0.5 mg L-1X-Gluc, pH 8.0) cover material；Plate is placed in the constant incubator of 37 DEG C cultivation 24h；Reclaim dyeing liquor；To plate adds 70% ethanol, in 37 DEG C of incubation 5-6h；Outwell the ethanol in plate, add 90% ethanol, continue incubation 10h at 37 DEG C；Outwell ethanol, carry out GUS dyeing and observe and photograph.The comparison and the process Tissues of Tobacco that take about 1g are placed in mortar, powdered by liquid nitrogen grinding, add Extraction buffer (containing 50 mM
L-1Sodium phosphate, 10 mM L-1EDTA, 0.1% TritonX-100,1% Sarcosyl, 10 mmol
L-1Beta-mercaptoethanol), mixing, 4 DEG C, after 5000 rpm are centrifuged 10min, take supernatant and obtain GUS soluble protein crude extract.Taking-up part adds 1 mM
L-1GUS reaction substrate 4-MUG, 37 DEG C insulation 30 min after, add 0.2 m M
L-1 Na2CO3Reaction terminating liquid terminates reaction.Utilize Hitachi 850 type fluorescent spectrophotometer assay fluorescent value, exciting light 365 nm, launch light 455 nm.Soluble protein content is with reference to Bradford(1976) method mensuration, measure GUS protein content, excitation wavelength 595 nm with UV-2102C ultraviolet spectrophotometer.1 pM is generated with 1 min hydrolysis 4-MUG
The required enzyme amount of 4-MU is an enzyme activity unit, represents GUS activity with the enzyme activity of every milligram of albumen.Above-mentioned experiment is in triplicate.
What GUS activity was the strongest demonstrates the deepest blueness, and light blue expression activity is relatively low, represents that GUS activity is relatively low without blue.As shown in Figure 4, wild type (WT) and conversionpC0390::GUS The tobacco leaf of plant expression vector (negative control) normal growth, drought-induced under the conditions of can not be by X-Gluc
Solution dyes blueness, but convertspC35S::GUSThe tobacco leaf of plant expression vector the most all can be by X-Gluc
Solution dyes blueness, explanationpC0390::GUS Plant expression vector can be used for the activity analysis of the promoter fragment of this experiment.
Under drought-induced process, convertpCD4::GUSTobacco leaf occurs navy blue, showspCD4(-1278bp) promoter, under the conditions of drought-induced, can significantly activateGUSGene expression, explanationpCD4(-1278bp) is drought-inducible promoter.The fluorescent quantitation result of the GUS in Fig. 5 shows,pCD4Promoter activity is the activity 42.0% of positive control, illustrates that this promoter is the promoter of a kind of efficient drought-inducible.
3.2
Select arabidopsis, Oryza sativa L. and sweet buckwheat respectively, use and 3.1 similar approach, analyze promoter pCD4 activity activity under the conditions of the PEG6000 of above-mentioned 15% under arid simulated conditions.It was found that compare normal growing conditions in contrast, convertpCD4::GUS Arabidopsis, Oryza sativa L. and sweet buckwheatBladeUnder the conditions of low temperature induction, all dyed blueness by X-Gluc, illustratepCD4(-1278bp) is drought-inducible promoter.The fluorescent quantitation of GUS shows, in three kinds of plantspCD4(-1278bp) promoter section activity is activity 38.6 %, 35.4 % and 39.8% of positive control respectively, illustrates that this promoter is the promoter of a kind of efficient drought-inducible.
Sequence table
<110>Changjiang University
<120>a kind of drought-inducible promoter and application thereof
<160> 3
<170> PatentIn version 3.5
<210>1
<211> 1278
<212> DNA
<213>sweet buckwheat
<220>
<223>promoter pCD4
<400> 1
aaggttcttt gcaagtctta taatagtccg accttcctgt acttgtctta cattccatta 60
atcatcttct tatcttccat tatcatccat aattccgcat tcttagttgc gcagaatctt
120
ggcctgttct tgagtaaata ttgcccaaga gtttcttcag tttacccgag atttgctttt 180
attgatcaat ctgatgattt tcaatctaga tcgggaattg cgacatcagc cccgcatcag 240
ttagtttgaa aaacttgaaa agttatggtc ggttttacaa taaggtaagt tagattggtt 300
atcctaccaa aattttctat tttgtaatgg ttaagtttat gtttttttca aatttacata
360
tttgatattt tgggatgatc gggttgtgat actatttttt ttttttaaat aattgtttta
420
acttctcatg ggttatgtaa ataactccct ataaatattt ttcaagcaat ttttacaaac
480
ccctcaccat acgtgcatag ttaggagttt ttaacaacgt cagaactatt tttagctgta 540
gttttttgaa aagaccctga aaatatttat caaggttttt tttaaaaatt gtcatttgtt
600
gtttgtctag ggttaaaaat aactaatgag aaatatttat cagccaagcg cataaaaagt 660
aaaacaaaaa cacattctca ttcagtaaaa taaatattga gagagtttat gtgtactagt 720
gtttgtgttg ttttcggacc atggtagtcg tagttgaaga ttagtcaccc ttataaaacc 780
ggaaactaca taaacatatt tataatatag ttagtatata tattgtagta ctgagtacct 840
cccaaagttt attaattaaa tatagtgtgt caatttggat aaaaccgtgc aatatataaa 900
gttatggttt gaagttgtaa tttcgctaaa agtaagaata aaaaaataaa taaaggcaat 960
cattgtagag aaattgataa tatagtcgac gtggaaagcc tgtgaaaaat agacctagtc 1020
aggatcacga ctgtactccc ttacccagaa acctccttac gaacacttgc gccagctccc 1080
tgaatatcca atccgccaga ccgccaccag ctgtctcctc cgtgttaacc accaccacac 1140
tcttcccaca ctctatttcc tcgtccccaa ttcaaccaac actatataaa atcacaccat
1200
ccatcttaca acttaattag attaaattct taaatcttaa tcaactcaaa attacttcat
1260
atatattcag gatcgatc
1278
<210>2
<211> 26
<212> DNA
<213>artificial sequence
<220>
<223> primer 1
<400> 2
cccaagctta aggttctttg caagtc
26
<210>3
<211> 26
<212> DNA
<213>artificial sequence
<220>
<223> primer 2
<400> 3
gcggatccga tcgatcctga atatat
26
Claims (7)
1. a promoter, it is characterised in that the nucleotides sequence of this promoter is classified as SEQ ID NO:1.
2. contain the recombinant vector of promoter as claimed in claim 1.
3. contain the transgenic cell of recombinant vector as claimed in claim 2.
4. contain the recombinant bacterium of recombinant vector as claimed in claim 2.
5. promoter as claimed in claim 1 is starting genes of interest application in plant is expressed.
Apply the most as claimed in claim 5, it is characterised in that: described promoter starts genes of interest application in plant is expressed when drought-induced.
7. one kind makes the method that plant expresses genes of interest when drought-induced, it is characterized in that the method is to be inserted into by genes of interest in the recombinant vector containing promoter as claimed in claim 1, and this recombinant vector is imported in purpose plant, the most drought-induced genes of interest is expressed in plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410442242.6A CN104250647B (en) | 2014-09-02 | 2014-09-02 | A kind of drought-inducible promoter and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410442242.6A CN104250647B (en) | 2014-09-02 | 2014-09-02 | A kind of drought-inducible promoter and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104250647A CN104250647A (en) | 2014-12-31 |
| CN104250647B true CN104250647B (en) | 2016-11-30 |
Family
ID=52185899
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410442242.6A Expired - Fee Related CN104250647B (en) | 2014-09-02 | 2014-09-02 | A kind of drought-inducible promoter and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104250647B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104195138B (en) * | 2014-09-02 | 2016-10-26 | 长江大学 | A kind of cold-inducible promoter and application thereof |
| CN106916818B (en) * | 2017-03-22 | 2020-01-31 | 江汉大学 | drought-induced promoter, preparation method thereof, recombinant expression vector and transformant |
| CN107815452A (en) * | 2017-12-06 | 2018-03-20 | 新疆农垦科学院 | A kind of specific expressed promoter of plant leaf blade and its application |
| CN108165552B (en) * | 2018-02-01 | 2021-06-29 | 南京农业大学 | Drought-inducible promoter PvHVA1-pro of plant and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007048030A2 (en) * | 2005-10-21 | 2007-04-26 | University Of Toledo | Plants expressing environmental stress tolerances having petunia cbf genes therein |
| CA2698972C (en) * | 2007-09-11 | 2014-07-22 | Pioneer Hi-Bred International, Inc. | Regulatory elements associated with cbf transcription factors from maize |
| CN101693891B (en) * | 2009-10-22 | 2011-12-28 | 复旦大学 | Promoter of shepherd spurse CBF path key gene CbCBF and applications thereof |
| CN103421784A (en) * | 2013-03-26 | 2013-12-04 | 华中农业大学 | Identification and utilization of drought and high-salt induced paddy rice promoter PDS1 |
-
2014
- 2014-09-02 CN CN201410442242.6A patent/CN104250647B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104250647A (en) | 2014-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104250647B (en) | A kind of drought-inducible promoter and application thereof | |
| CN103103194A (en) | Gene promoter of ginseng PgPDR3 responded by methyl jasmonate and application thereof | |
| CN103088027A (en) | PDR transport protein gene promoter for controlling ginsenoside accumulation, and its application | |
| CN102154289A (en) | Corn drought inducible gene promoters and activity analysis thereof | |
| CN101585870B (en) | Protein related to plant heat resistance property and coding gene and application thereof | |
| CN102712929A (en) | Identification and use of plant root-specific expression promoter | |
| CN104195138B (en) | A kind of cold-inducible promoter and application thereof | |
| CN108795943A (en) | A kind of plant specific expression promoter POssalt2 and its application | |
| CN103667296B (en) | A composition type expression promoter and application thereof | |
| CN108588070A (en) | A kind of Mongolia's Ammopiptanthus mongolicus guard cell specific expression promoter and its application | |
| CN103667291B (en) | Derive from endosperm specificity expression promoter and the application thereof of paddy rice | |
| CN114480447A (en) | Application of kenaf thioredoxin analog protein gene HcTrx and recombinant vector thereof in VIGS silencing system | |
| CN107058324A (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivating method | |
| CN109337906B (en) | Promoter for wheat endosperm specific expression and application thereof | |
| CN104152454B (en) | Derive from drought-induced promoter GmMYB363P and the application thereof of soybean | |
| CN102517284A (en) | Promoter miR390 and applications thereof | |
| CN101182530A (en) | Inducing reinforced composing type promoter and uses thereof | |
| CN109385424A (en) | Promoter and recombinant vector and its application | |
| CN104450708A (en) | Retrotransposon promoter PCb-RARE induced by high salt and salicylic acid and application of retrotransposon promoter PCb-RARE | |
| CN103966220A (en) | Synthetic root-specific promoter and application thereof | |
| CN114561387B (en) | Peanut promoter and application thereof | |
| CN113416732B (en) | Dendrobium officinale salt inducible promoter proDoMYB75 and application thereof | |
| CN112048490B (en) | Cotton silk/threonine protein phosphatase GhTPOPP 6 and coding gene and application thereof | |
| CN109825507B (en) | Plant drought-induced synthetic promoter SP18 and application thereof | |
| CN111718938B (en) | High-temperature inducible promoter specifically expressed by plant green tissue and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20161130 Termination date: 20200902 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |