CN104225586A

CN104225586A - Tuberculosis subunit vaccine containing fusion protein A1D4

Info

Publication number: CN104225586A
Application number: CN201410420806.6A
Authority: CN
Inventors: 范雄林; 王晓春
Original assignee: Huazhong University of Science and Technology
Current assignee: Huazhong University of Science and Technology
Priority date: 2014-08-25
Filing date: 2014-08-25
Publication date: 2014-12-24

Abstract

The invention discloses a tuberculosis subunit vaccine containing fusion protein A1D4. The tuberculosis subunit vaccine contains the fusion protein A1D4, the concentration of the fusion protein A1D4 is 0.1-1mg/ml, and an encoding gene of the fusion protein A1D4 is Rv1813, Rv2660c, Ag85B, Rv2623 and HspX genes which are connected in series according to the sequence of Rv1813-Rv2660c-Ag85B-Rv2623-HspX. The tuberculosis subunit vaccine containing the fusion protein A1D4 disclosed by the invention is good in immune response effect and low in inoculation risk.

Description

A kind of tuberculosis subunit vaccine containing fusion rotein A1D4

Technical field

The invention belongs to biomedicine field, more specifically, relate to a kind of tuberculosis subunit vaccine containing fusion rotein A1D4.

Background technology

Bacillus calmette-guerin vaccine (Mycobacterium bovis BCG) is uniquely applied to tuberculosis (tuberculosis clinically, TB) attenuated live vaccine prevented, current annual global infant inoculation coverage rate is up to more than 90%, and accumulative immunity inoculation crowd is more than 3,000,000,000 people so far.Clinical and epidemiological study widely confirms, and bacillus calmette-guerin vaccine can effectively prevent infant tuberculosis.But the immune period of BCG is short, it is generally acknowledged only 10 ~ 15 years, stable, desirable protected effect (between 0 ~ 80%) cannot be provided to adult's prevention lungy.Therefore, the effective prevention adult of development vaccine lungy, imperative.

Subunit protein vaccine, because its constituent is clear and definite, have good safety, is one of important kind of vaccine development, also in widespread attention in prevention area lungy.So far, one has 12 kinds of tuberculosis candidate new vaccines enters human clinical trial, and subunit protein vaccine accounts for six kinds, also show its tuberculosis new generation vaccine development in critical role.At present, although tuberculosis subunit vaccine safety and stability, be convenient to produce, still there is the problem that immunne response effect is undesirable.

Summary of the invention

For above defect or the Improvement requirement of prior art, the invention provides a kind of tuberculosis subunit vaccine containing fusion rotein A1D4, its object is to by selecting antigen gene and fusion sequence to produce fusion rotein, coordinate suitable vaccine adjuvant, solve the technical problem that existing tuberculosis vaccine has inoculation risk, immunne response effect undesirable thus.

For achieving the above object, according to one aspect of the present invention, provide a kind of tuberculosis subunit vaccine, containing fusion rotein A1D4, its concentration is 0.1mg/ml to 1mg/ml, and described its encoding gene of fusion rotein A1D4 is the sequential series of Rv1813, Rv2660c, Ag85B, Rv2623 and HspX gene according to Rv1813-Rv2660c-Ag85B-Rv2623-HspX.

Preferably, described tuberculosis subunit vaccine, described in it, the sequence of fusion rotein A1D4 is:

(1) protein be made up of the aminoacid sequence shown in SEQ ID No.1; Or

(2) amino acid sequence homology limited with sequence SEQ ID No.1 is encoded 80% to 100% the aminoacid sequence of identical function protein; Or

(3) aminoacid sequence shown in SEQ ID No.1 has the albumen derivative by (1) of same isoreactivity through increasing, lacking or replace one or more aminoacid.

Preferably, described tuberculosis subunit vaccine, the Squalene oil of the trehalose also containing the monophosphoryl lipid A of 0.2mg/ml to 0.3mg/ml, 0.2mg/ml to 0.3mg/ml, volume fraction 1% to 4%, the sorbester p37 (Span85) of volume fraction 1% to 4% and the tween 80 of volume fraction 0.1% to 0.4% are Water-In-Oil sample solution.

Preferably, described tuberculosis subunit vaccine, trehalose described in it is 6,6 '-two mycolic acids.

In general, the above technical scheme conceived by the present invention compared with prior art, can obtain following beneficial effect:

1, (WBIA) technology is analyzed with the release of whole blood interferon, antigen A g85B, Rv1813, Rv2660c, HspX and Rv2623 of screening and A1D4, the peripheral blood of Chinese M.tb infection population all can be stimulated to produce high-caliber IFN-γ, and the level of A1D4 stimulation is significantly higher than the IFN-γ level of the stimulation generation of each subfraction antigen.Confirm that A1D4 by the antigen of the T cell identification of Chinese M.tb infection population, can combine the advantage of antigen A g85B, Rv1813, Rv2660c, HspX and Rv2623, there is good immunne response effect.

2, the protectiveness of A1D4/MTO subunit protein vaccine depends on the CD4 of antigenic specificity ⁺th1 reacts.A1D4/MTO group mouse boosting cell for the stimulation of specific antigen A1D4, can secretion inducing relative to PBS group high-caliber TNF-α and IFN-γ; Meanwhile, A1D4/MTO subunit protein vaccine immune mouse, induction creates remarkable high-caliber A1D4 specific IgG antibodies, and its IgG2a/IgG1 ratio also significantly raises, obviously tendency Th1 type immunne response.

3, subunit vaccine provided by the invention, it produces the fusion rotein A1D4 of immunne response effect, there is not pathogenic ability, and therefore relative to existing tuberculosis vaccine, subunit vaccine inoculation risk provided by the invention reduces greatly.

Accompanying drawing explanation

Fig. 1 is the Western-blotting qualification of embodiment 2 fusion rotein A1D4 and each subfraction protein purification products;

Fig. 2 is the IFN-γ level that embodiment 6 compares fusion rotein A1D4 and subfraction albumen and stimulates M.tb infection population (rCM-WBIA-positive) and the non-infection population of M.tb (rCM-WBIA-negative) to produce respectively;

Fig. 3 is specific antibody level in embodiment 7 subunit vaccine A1D4/MTO immune serum;

Fig. 4 is embodiment 8 subunit vaccine A1D4/MTO immune mouse spleen cell secretion A1D4 specific cytokines level;

Fig. 5 is embodiment 9 subunit vaccine A1D4/MTO immune mouse spleen antigenic specificity total IFN-γ and total TNF-α secretion-type T lymphocyte

Fig. 6 is embodiment 10 subunit vaccine A1D4/MTO immune mouse anti-M.tb H37Rv standard strain internal organs lotus bacterium amount after tail Intravenous Infection;

Fig. 7 is embodiment 10M.tb H37Rv infecting mouse lungs pathology figure.

Detailed description of the invention

In order to make object of the present invention, technical scheme and advantage clearly understand, below in conjunction with drawings and Examples, the present invention is further elaborated.Should be appreciated that specific embodiment described herein only in order to explain the present invention, be not intended to limit the present invention.In addition, if below in described each embodiment of the present invention involved technical characteristic do not form conflict each other and just can mutually combine.

Tuberculosis subunit vaccine provided by the invention, it is characterized in that, containing fusion rotein A1D4, its concentration is 0.1mg/ml to 1mg/ml, the Squalene oil of the trehalose also containing the monophosphoryl lipid A of 0.2mg/ml to 0.3mg/ml, 0.2mg/ml to 0.3mg/ml, volume fraction 1% to 4%, the sorbester p37 (Span85) of volume fraction 1% to 4% and the tween 80 of volume fraction 0.1% to 0.4% are Water-In-Oil sample solution.Described its encoding gene of fusion rotein A1D4 is the sequential series of Rv1813, Rv2660c, Ag85B, Rv2623 and HspX gene according to Rv1813-Rv2660c-Ag85B-Rv2623-HspX.Described trehalose is 6 of synthetic, 6 '-two mycolic acids.

The sequence of described fusion rotein A1D4 is:

(1) protein be made up of the aminoacid sequence shown in SEQ ID No.1; Or

M.tb infects after human body, can be divided into the different phases such as primary infection, latent infection and former postoperative infection in the generation of body and evolution.Also there is phase specificity at the gene profile of different phase M.tb metabolism and transcriptional expression.M.tb is after respiratory tract primary infection body, take immunosuppressant and immune evasion in early days, both escaped body anti-infective innate immune response, and also stoped DC cell migration to carry out angtigen presentation to regional nodes, thus delay adaptive immune response (mainly CD4 ⁺th1 cellullar immunologic response), make M.tb massive duplication set up primary infection in vivo.In the primary infection stage, the representative gene that in body, M.tb expresses in macrophage is based on Ag85 complex.DC cell, once arrive regional nodes, gets final product sensitized T cell, especially CD4 ⁺th1 cell also makes its infection focus of going back to the nest, and is engulfed and is killed and wounded antibacterial, raise more macrophages infiltration simultaneously and form granuloma at infection site, cause the formation of latent infection by cytokine activation macrophages such as secretion of gamma-IFN.The anaerobic environment of in-vitro simulated latent infection, discloses M.tb and is regulated and controled by dormancy regulator gene DosR at latency stage, encode and raise 48 gene expressions, comprising HspX, Rv2623 and Rv2626c etc.In addition, some genes are had to participate in the metabolic regulation of the M.tb in latent infection stage, as PhoY2, Rv3407, Rv2660c etc.In immunity degradation (particularly concurrent infection HIV), old, diabetes, organ transplantation, the situation such as auxotrophy and use immunosuppressant, the M.tb being in resting state in latent infection crowd (LTBI) body may activate again, form autogenous infection, and then develop into activeness TB patient.For body, CD8 ⁺t cell plays important immunosurveillance in control M.tb reactivation process.The more important thing is, BCG immunity weak or nonreply to the specific antigen in some stage.This is also cause BCG to one of major reason of latent infection and adult T B protectiveness difference.But the albumen of these different phase characteristics expression actually, which is important protective antigen, is suitable for the development of TB vaccine, it be unclear that.

Therefore, we are Prokaryotic expression, purification M.tb stage a series of antigens of expressing first, and from these antigens, through whole blood interferon release analytical technology (WBIA), screening can by the antigen of the T cell identification of Chinese M.tb infection population.Because Chinese population more than 99% is all by BCG immunity inoculation mistake, BCG immunity can affect the result that the release of whole blood interferon is analyzed.A kind of whole blood interferon based on M.tb distinctive RD2 district PROTEIN C FP21 and MPT64 release analytical technology detection method (rCM-WBIA) is established in our early-stage Study, because RD2 district lacks in BCG strain in China, its specificity is not subject to BCG strain in China on the impact of Chinese population immunity.Based on the clinical diagnoses to the non-infection population of health, tuberculosis infection crowd (comprising latent infection crowd and tuberculosis patient) two kinds of crowds, associating rCM-WBIA Examined effect, can get rid of the impact of BCG immunity on two kinds of crowds.Gather the periphery whole blood of M.tb infection population and non-infection population, by WBIA testing inspection with compare M.tb different phase antigenic stimulus two kinds of crowd's peripheral bloods after the IFN-γ level that produces.The specific targeted antigen of expressing in different phase after M.tb infects body is filtered out in the present invention, include fast breeding phase secretion antigen Ag85B (fbpB) and latent infection stage related gene Rv1813, Rv2660c, Rv2623 and HspX, equal energy inductive infection crowd produce high-caliber IFN-γ, equal can identify by the T cell of Chinese M.tb infection population, be can prevent effective candidate antigens of Chinese M.tb infection population by targeting.

In the present invention, we are based on these antigens filtered out, the fusion rotein A1D4 expressing above-mentioned antigen is constructed by manual design techniques, and confirm that the T cell of Chinese M.tb infection population can identify this fusion rotein through whole blood interferon release analytical technology, its peripheral blood produces A1D4 specific IFN-γ level, be significantly higher than non-infection population, there is predictive of this fusion rotein the ability of targeting prevention M.tb infection.

Be below embodiment:

The Design and synthesis of embodiment 1 fusion gene A1D4 sequence and prokaryotic expression primer thereof

According to the complete genome sequence of M.tb H37Rv, select Rv1813, the coded sequence of Rv2660c, Ag85B, Rv2623 and HspX.With Signalp software prediction and UniProtKB database retrieval search sequence whether with signal peptide, then with DNAMAN software, restriction enzyme site analysis and amino acid sequence analysis are carried out to it.Following principle need be followed when splicing 5 independent genes of interest: 1) if having a signal peptide to remove signal peptide, comprise original start codon, remove termination codon (adding TAA after splicing last complete gene order) simultaneously; 2) gene order of no signal peptide then retains initiator sequences.If start codon is GTG's, because its original expression product is Met but not Val, GTG also must should be expressed as Met as during non-initial code, therefore GTG need be corrected to ATG.This antigen-4 fusion protein gene splicing order is: Rv1813-Rv2660c-Ag85B-Rv2623-HspX, and after being synthesized by Shanghai Invitrogen company, sub-clone is to pDC316 vector plasmid (called after pDC316-A1D4), errorless through order-checking comparison.

Sequencing result is shown in sequence table SEQ ID No.2, its aminoacid sequence part sequence table SEQ ID No.1.

The structure of embodiment 2 fusion rotein A1D4 prokaryotic expression carrier and protein purification

1, genes of interest obtains:

(1) design of primers: according to the multiple clone site design primer on the complete sequence of fusion gene and prokaryotic expression carrier pET30b (+), primer sequence is synthesized by Shanghai Ying Jun biotech firm, and according to explanation, primer is diluted to 100pmol/ μ l ,-20 DEG C save backup.Underscore in following primer sequence represents enzyme recognition site.

A1D4-Fwd：

(Nde?I)-TTC CATATGCATCTCGCCAACGGTTCGATGTCGG

A1D4-Rev：

(Xho?I)-AT CTCGAGGTTGGTGGACCGGATCTGAATGTGC

(2) PCR reaction system:

(3) PCR reaction condition:

95℃5min；94℃1min,64℃1min?and72℃3min,30cycles；72℃10min；4℃forever

2, the structure of recombiant plasmid:

The genes of interest A1D4 with Nde I and Xho I restriction enzyme site reclaimed through DNA gel electrophoresis and empty carrier pET30b (+) is carried out double digestion respectively, and enzyme action system is:

The genes of interest A1D4 fragment reclaimed through enzyme action and carrier pET30b (+) are carried out coupled reaction according to following condition:

3, by recombiant plasmid through low temperature CaCl ₂method and heat shock proceed to E.coli DH5 α and E.coli BL21 (DE3), after resistance screening, obtain positive colony.

4, the purification of fusion rotein A1D4, qualification:

Confirm that A1D4 fusion rotein is present in bacterial body with inclusion bodies through solubility qualification, therefore through Ni-NTA post with urea-denatured method substep purifying protein, and verify correction and the activity of albumen through Western-blotting.According to the fusion rotein A1D4 that GE Health company Ni-NTA affinity column operation instruction step purification obtains, detect with Limulus amoebocyte lysate assay kit and remove endotoxin, its concentration controls within 0.1EU/ml, namely obtains described fusion rotein A1D4.

Experimental result is shown in Fig. 1.

From experimental result: confirm after A1D4 fusion protein purification process is carried out SDS-PAGE electrophoresis, A1D4 protein expression and size is about 105kDa, conforms to expection.Fusion rotein A1D4 and each subfraction albumen are carried out SDS-PAGE electrophoresis simultaneously, the wherein relative molecular weight of 5 subfraction albumen, be about Rv1813 (14kDa), Rv2660c (12kDa), Ag85B (30kDa), Rv2623 (33kDa) and HspX (16kDa) respectively, all conform to expection size.Western blotting qualification is carried out respectively with anti-His mouse monoclonal antibody (Tiangen company) and anti-A1D4 mice serum (obtaining with A1D4 fusion rotein associating incomplete Freund's adjuvant injection BALB/c mouse), confirm the size of fusion rotein A1D4 albumen and subfraction albumen thereof, immunological characteristic and specificity, prove successful expression and the purification of each albumen simultaneously.

Embodiment 3

A kind of tuberculosis subunit vaccine, it is characterized in that, containing fusion rotein A1D4 prepared by embodiment 2, its concentration is 0.1mg/ml, also containing the monophosphoryl lipid A of 0.2mg/ml, the synthetic of 0.2mg/ml 6, the Squalene oil of 6 '-two mycolic acids trehalose, volume fraction 1%, the sorbester p37 of volume fraction 1% and the tween 80 of volume fraction 0.1% are Water-In-Oil sample solution.

The preparation method of described tuberculosis subunit vaccine is as follows:

Draw fusion rotein solution and 100 μ l vaccine adjuvants that 100 μ l concentration are 0.2mg/ml respectively, in aseptic EP pipe, after covering tightly pipe lid, in vortex oscillator, interval is shaken 2 to 3 minutes, and the uniform emulsion of final formation, is namely prepared into described tuberculosis subunit vaccine.

Described vaccine adjuvant is Water-In-Oil sample solution, the Squalene of the monophosphoryl lipid A containing 0.4mg/ml, the trehalose of 0.4mg/ml, volume fraction 2% oil, the sorbester p37 of volume fraction 2% and the tween 80 of volume fraction 0.2%.Described trehalose is 6 of synthetic, 6 '-two mycolic acids.

Its preparation method is as follows:

Accurately take the trehalose 6 of monophosphoryl lipid A (MPL) 0.4mg, synthetic, 6 ˊ-bis-mycolic acids (TDB) 0.4mg, add in the aseptic PBS of 1ml, separately add 2% Squalene oil (v/v), the sorbester p37 (v/v) of volume fraction 2% and the Tween-80 (v/v) of 0.2%, vibration or stirring, be rendered as uniform Water-In-Oil sample solution after abundant mixing, be namely prepared into described vaccine adjuvant, called after MTO.

Embodiment 4

A kind of tuberculosis subunit vaccine, it is characterized in that, containing fusion rotein A1D4 prepared by embodiment 2, its concentration is 0.5mg/ml, also containing the monophosphoryl lipid A of 0.25mg/ml, the synthetic of 0.25mg/ml 6, the Squalene oil of 6 '-two mycolic acids trehalose, volume fraction 2.5%, the sorbester p37 of volume fraction 2.5% and the tween 80 of volume fraction 0.25% are Water-In-Oil sample solution.

The preparation method of described tuberculosis subunit vaccine is as follows:

Draw fusion rotein solution and 100 μ l vaccine adjuvants that 100 μ l concentration are 1mg/ml respectively in aseptic EP pipe, after covering tightly pipe lid, in vortex oscillator, interval is shaken 2 to 3 minutes, the uniform emulsion of final formation, is namely prepared into described tuberculosis subunit vaccine.

Described vaccine adjuvant is Water-In-Oil sample solution, the Squalene of the monophosphoryl lipid A containing 0.5mg/ml, the trehalose of 0.5mg/ml, volume fraction 5% oil, the sorbester p37 of volume fraction 5% and the tween 80 of volume fraction 0.5%.Described trehalose is 6 of synthetic, 6 '-two mycolic acids.

Its preparation method is as follows:

Accurately take the trehalose 6 of monophosphoryl lipid A (MPL) 0.5mg, synthetic, 6 ˊ-bis-mycolic acids (TDB) 0.5mg, add in the aseptic PBS of 1ml, separately add 5% Squalene oil (v/v), the sorbester p37 (v/v) of volume fraction 5% and the Tween-80 (v/v) of 0.5%, vibration or stirring, be rendered as uniform Water-In-Oil sample solution after abundant mixing, be namely prepared into described vaccine adjuvant, called after MTO.

Embodiment 5

A kind of tuberculosis subunit vaccine, it is characterized in that, containing fusion rotein A1D4 prepared by embodiment 2, its concentration is 1mg/ml, also containing the monophosphoryl lipid A of 0.3mg/ml, the synthetic of 0.3mg/ml 6, the Squalene oil of 6 '-two mycolic acids trehalose, volume fraction 4%, the sorbester p37 of volume fraction 4% and the tween 80 of volume fraction 0.4% are Water-In-Oil sample solution.

The preparation method of described tuberculosis subunit vaccine is as follows:

Draw fusion rotein solution and 100 μ l vaccine adjuvants that 100 μ l concentration are 2mg/ml respectively in aseptic EP pipe, after covering tightly pipe lid, in vortex oscillator, interval is shaken 2 to 3 minutes, the uniform emulsion of final formation, is namely prepared into described tuberculosis subunit vaccine.

Described vaccine adjuvant is Water-In-Oil sample solution, the Squalene of the monophosphoryl lipid A containing 0.6mg/ml, the trehalose of 0.6mg/ml, volume fraction 8% oil, the sorbester p37 of volume fraction 8% and the tween 80 of volume fraction 0.8%.Described trehalose is 6 of synthetic, 6 '-two mycolic acids.

Its preparation method is as follows:

Accurately take the trehalose 6 of monophosphoryl lipid A (MPL) 0.6mg, synthetic, 6 ˊ-bis-mycolic acids (TDB) 0.6mg, add in the aseptic PBS of 1ml, separately add 8% Squalene oil (v/v), the sorbester p37 (v/v) of volume fraction 8% and the Tween-80 (v/v) of 0.8%, vibration or stirring, be rendered as uniform Water-In-Oil sample solution after abundant mixing, be namely prepared into described vaccine adjuvant, called after MTO.

Embodiment 6

According to whole blood IFN-gamma release test (Whole Blood Interferon-gamma Release Assay, WBIA) M.tb infection population (rCM-WBIA Positive Populations) and non-infection population (rCM-WBIA Population with Negative) antigenic specificity IFN-γ concentration is detected, with examination antigen.

1, recruit by inspection crowd and distinguish M.tb infection population and non-infection population

The outpatient service crowd of Xinxiang City, Henan Province tuberculosis prevention and treatment institute is come from by inspection crowd, the equal informed consent of all persons under inspection also accepts questionnaire survey (relevant medical history, contact history and cardinal symptom etc.), and all carry out TST, rabat and Sputum smears (or cultivation) inspection, do not merge dysimmunity disease and HIV (human immunodeficiency virus) (HIV) infection simultaneously.

By the patient of clinical confirmation, LTBI and non-infection population, with the rCM specificity IFN-γ concentration that rCM-WBIA detects, according to the standard that this laboratory is published, i.e. specificity IFN-γ concentration >=or <398.5pg/ml, is divided into rCM-WBIA Positive Populations and Population with Negative respectively by M.tb infection population.Wherein, Positive Populations comprises M.tb latent infection crowd and patient, is rejected by Population with Negative; The non-infection population of M.tb is also divided into rCM-WBIA Positive Populations and Population with Negative, is rejected by Positive Populations.The impact of BCG immunity on crowd characteristic can be got rid of with this.

Filter out Chinese M.tb the infected (comprising TB patient and LTBI) and rCM-WBIA Positive Populations totally 27 example (Median:1959.69pg/ml of meeting clinical criteria altogether, Range:457.09-4964.31pg/ml), wherein male 16 example (age 36.7 ± 16.8), women 11 example (age 36.3 ± 17.5); Filter out the non-infection population of the China meeting clinical criteria and rCM-WBIA Population with Negative totally 15 example (Median:44.81pg/ml, Range:0-292.8794pg/ml), wherein male 8 example (age 42.9 ± 20.0), women 7 example (age 34.3 ± 15.8).

2, person under inspection's whole blood sample Collecting and dealing

(1) the fresh anticoagulated whole blood 8ml/ people of sterile collection experimenter; Add in aseptic 24 orifice plates in 6h, 0.5ml/ hole;

(2) every hole adds A1D4 or rCM and subfraction protein 20 μ l, and negative control is 20 μ l physiological saline solution, and Positive control wells adds 20 μ l PHA, slightly shakes mixing;

(3) 37 DEG C of incubation 20-24h;

3, the detection of whole blood IFN-gamma concentration

The pre-coated people IFN-γ detection kit that the detection of whole blood IFN-gamma uses Shenzhen Dakewe company to produce.Concrete operations by specification carries out.According to gauge orifice OD value and concentration drawing standard curve, then the content of each hole IFN-γ is calculated according to standard curve, the specificity IFN-γ content that after the content of IFN-γ deducts normal saline stimulation in serum after each person under inspection stimulates with testing protein, in serum, the content of IFN-γ produces for testing protein induction, and respectively organize median.

Experimental result is shown in Fig. 2.

From experimental result: the antigenic specificity IFN-γ concentration that each single subfraction albumen produces at M.tb infection population moderate stimulation is all significantly higher than non-infection population (P<0.05); Fusion rotein A1D4 also can induce M.tb infection population to produce higher levels of A1D4 specificity IFN-γ (P<0.05).

Embodiment 7

The immunoreation that tuberculosis subunit vaccine (A1D3R1/MTO vaccine) is induced trends towards the response of Th1 type

1. the grouping of laboratory animal and immunity

Vaccine adjuvant adopts the vaccine adjuvant MTO of preparation in embodiment 3.

Tuberculosis subunit vaccine (A1D3R1/MTO vaccine) adopts the tuberculosis subunit vaccine of preparation in embodiment 3.

(1) laboratory animal grouping:

The female C57BL/6 mice of SPF level in 6 week age, quality certification lot number is No.4200592079, purchased from Wuhan University ABSL-3 animal experimental center.

Experimentally need, laboratory animal be divided into following four groups: negative control group---PBS group; Positive controls---BCG group; Vehicle control group---MTO group; Experimental group---A1D4/MTO group.Often organize 3.Experiment repetition 1 time.

(2) experimental animal immune:

PBS group and BCG group, only 0 week time respectively subcutaneous injection 1 time, bolus doses is that (BCG bacteria containing amount is 1.67 × 10 to 200 μ l ⁶cFU); MTO group and A1D4/MTO group, respectively every 3 weeks subcutaneous inoculations 1 time, bolus doses is 200 μ l, totally 3 times.

2.ELISA detects antigenic specificity total IgG in mice serum, IgG1 and IgG2a

(1) latter 9 weeks of immunity, extracts eyeball by each group of mice and gets blood and collect serum, preserves standby inspection for-20 DEG C.

(2) fusion rotein A1D4 is diluted to 5 μ g/ml, routine bag is carried out by 96 hollow plates in 100 μ l/ holes.

(3) the aseptic 1 × PBS after the filtration of each group mice serum sample doubly dilutes by 1:200,200 μ l/ holes add to often row first hole, often arrange the 2nd hole to the 8th hole and add 100 μ l PBS respectively, each sample does multiple hole, then carry out doubling dilution to 1:51200 from the first hole, blank control wells adds bag and is buffered liquid 100 μ l.

(4) dilution factor that HRP labelling rabbit against murine two is anti-is respectively: IgG 1:5000, IgG1 1:10000, IgG2a1:10000;

(5) result treatment: after each each sample OD value is deducted blank control wells OD value, is averaged OD value with the multiple hole of a blood serum sample.Wherein with the OD value of PBS negative control group for negative control (N), immune group is sample (P), when blood-serum P/N value >=2.1 can be judged as the positive.Antibody titer represents with the inverse of the most highly diluted multiple occurring positive findings.

(6) result calculates: each sample result is expressed as log ₁₀(antibody titer), average between the multiple hole of each sample and be the actual value of this mice, calculating mean value and standard error in same group, carry out statistical analysis; IgG2a:IgG1 compares with the antibody titer of every mice, and in same group, result represents with meansigma methods ± standard error and carries out statistical analysis.

Experimental result is shown in Fig. 3.

From experimental result: consistent with expection, produce without obvious specific IgG antibodies and subclass thereof in MTO vehicle control group; The dissimilar antibody titer of top level is produced in A1D4/MTO group Mice Body, i.e. IgG (1:10667), IgG1 (1:3200) and IgG2a (1:8533), and be all significantly higher than BCG group (P<0.05).A1D4/MTO group IgG2a/IgG1 ratio the highest (3.33 ± 0.67), is significantly higher than BCG group (0.83 ± 0.17).

Embodiment 8 tuberculosis subunit vaccine (A1D3R1/MTO vaccine) induction produces the Th1 cytokines of antigenic specificity

1. the grouping of laboratory animal and immunity

Vaccine adjuvant adopts the vaccine adjuvant MTO of preparation in embodiment 4.

(1) laboratory animal grouping:

(2) experimental animal immune:

PBS group and BCG group, only 0 week time respectively subcutaneous injection 1 time, bolus doses is that (BCG bacteria containing amount is 1.67 × 10 to 200 μ l ⁶cFU); MTO group and A1D4/MTO group, respectively every 3 weeks subcutaneous inoculations 1 time, bolus doses is 200 μ l, totally 3 times.Immunity 9 is aseptic afterwards gets spleen separating Morr. cell.

2.ELISA detects antigen specific T h1 cytokines IFN-γ, TNF-α and IL-2 level in immune mouse spleen cell culture supernatant

(1) in 24 orifice plates, 100 μ l 2.5 × 10 are added ⁶the splenocyte in/hole.

(2) negative control hole adds RPMI1640 complete medium 20 μ l; Experimental port adds 20 μ l fusion rotein A1D4, final concentration 10 μ g/ hole; Positive control wells adds 20 μ l PPD working solutions (10 μ lTB-PPD stock solution+10 μ l RPMI1640 complete medium), and PPD final concentration is 10 μ g/ holes.

(3) CO2 cell culture incubator is placed in, cultivate 72h (splenocyte detecting IL-2 only needs to cultivate 24h) for 37 DEG C, to collect in 24 orifice plates splenocyte and juice in aseptic EP pipe, 2000rpm, centrifugal 10min, collects supernatant, is sub-packed in EP pipe, labelling group number and incubation time, frozen stand-by in-80 DEG C.

(4) 3 kinds of cytokine secretion amounts are detected.

Experiment flow is completed according to mice ELISA detection kit workbook.TMB blank colour developing hole is set to contrast, after all standard substance and the light absorption value of sample deduct the light absorption value of blank well, treats with standard curve Equation for Calculating the concentration that gaging hole is corresponding.Notice that measured value should within the detection range of standard curve.Calculate each experimental group meansigma methods and standard deviation and statistical analysis.

Experimental result is shown in Fig. 4.

From experimental result: consistent with expection is, latter 9 weeks of immunity, PBS matched group stimulates for PPD or A1D4 albumen, only secretes very low-level IL-2, IFN-γ and TNF-α, and all remarkable in BCG group (P<0.05).After PPD stimulates, BCG component is secreted the level producing TNF-α and IFN-γ and is all significantly higher than A1D4/MTO group (P<0.001).No matter stimulate with PPD or A1D4 albumen, IL-2 level is at A1D4/MTO group, no difference of science of statistics between BCG group and MTO group.Meaningfully, although the level of the TNF-α that MTO group produces for PPD and A1D4 secretion, all be significantly higher than PBS group (P<0.05), but remarkable in A1D4/MTO group (P<0.05) respectively.MTO group stimulates the IFN-γ level and PBS group zero difference that produce for PPD, and all remarkable in A1D4/MTO group (P<0.05).It should be noted that after A1D4 differential stimulus, A1D4/MTO component secretes IFN-γ and the TNF-alpha levels of generation, compares other each group and all significantly improves (P<0.001).

Embodiment 9 tuberculosis subunit vaccine (A1D3R1/MTO vaccine) induction produces the T lymphocyte of antigenic specificity secretion of gamma-IFN and TNF-α

1. the grouping of laboratory animal and immunity

Vaccine adjuvant adopts the vaccine adjuvant MTO of preparation in embodiment 5.

(1) laboratory animal grouping:

(2) experimental animal immune:

2, the T lymphocyte of intracellular cytokine dyeing and Flow cytometry immune mouse spleen cell antigenic specificity secretion of gamma-IFN and TNF-α

(1) splenocyte stimulates and cultivates:

1. in 24 orifice plates, 100 μ l 2.5 × 10 are added ⁶the splenocyte in/hole.

2. experimentally design adds different stimulated thing, and concrete sample loading alternative is as follows:

Experimental port: every hole adds 20 μ l fusion rotein A1D4, final concentration 10 μ g/ hole; Add 20 μ l anti-CD28mcAb simultaneously;

Positive control wells: every hole adds 20 μ l TB-PPD working solutions (10 μ l PPD stock solution+10 μ l RPMI1640 complete medium), and final concentration is 10 μ g/ holes.Add anti-CD28mcAb20 μ l simultaneously;

Negative control hole: every hole adds RPMI1640 complete medium 20 μ l; Add anti-CD28mcAb20 μ l simultaneously;

Blank control wells: add Cocktail working solution 40 μ l;

Positive test hole: add Cocktail working solution 40 μ l;

Singly mark pipe: add Cocktail working solution 40 μ l;

3. every hole is added into RPMI1640 complete medium to cumulative volume is 1ml, mixing.Be placed in 37 DEG C of CO2 incubators and hatch 16h.

4. the post-stimulatory 4 ~ 6h of albumen, every hole adds Brefeldin A+Monensin mixed liquor 20 μ l and blocks.

5. cultivate after terminating, be all collected in streaming pipe by liquid in every hole, the centrifugal 5min of 500g, abandons supernatant.

(2) lymphocytic cell surface and born of the same parents' internal labeling dyeing

1. experimental port, Positive control wells, negative control hole and test positive hole add respectively PBS dilution 100 μ l surface marker antibody, i.e. 0.5 μ l CD3 antibody+1.25 μ l CD4 antibody+1.25 μ l CD8 antibody+97 μ l PBS; Blank well adds 100 μ l PBS; The list mark pipe of surface markers only adds respective surfaces antibody, mends to cumulative volume 100 μ l with PBS; The list mark pipe of born of the same parents' intrinsic factor labelling adds 100 μ l PBS.

2. mix homogeneously, 4 DEG C of lucifuges hatch 30min.Add PBS2ml, the centrifugal 5min of 500g, abandons supernatant.Wash 2 times, abandon supernatant.

3. often pipe adds the Fixation100 μ l of pre-cooling, and fully mixing makes it fix.Room temperature lucifuge places 30min.

4. add 1ml1 × PB/ pipe, the centrifugal 5min of 500g, abandons supernatant.Wash 2 times, abandon supernatant (blank well, single mark hole also need fixedly to wear film)

5. experimental port, Positive control wells, negative control hole and test positive hole add respectively PBS dilution 100 μ l surface marker antibody, i.e. 1.25 μ l IFN-gamma antibodies+1.25 μ l TNF-Alpha antibodies+1.25 μ l IL-2 antibody+96.25 μ l1 × Permeabilization Buffer (1 × PB).Blank well adds 100 μ l PBS; The list mark pipe of born of the same parents' intrinsic factor labelling adds respective surfaces antibody, mends to cumulative volume 100 μ l with PBS.The list mark pipe of surface markers adds 100 μ l PBS.

6. mix homogeneously, 4 DEG C of lucifuges hatch 30min.Often pipe adds 1ml1 × PB/ pipe, and the centrifugal 5min of 500g, abandons supernatant.7. add the washing of 1ml1 × PBS/ pipe, the centrifugal 5min of 500g, abandons supernatant.

8. with 300 μ l PBS re-suspended cells, 4 DEG C keep in Dark Place to be checked.Whirlpool concussion before upper machine.First go up blank tube, regulation voltage, detect successively and singly mark pipe, regulate fluorescence to compensate.Each test all needs to do blank control wells to get rid of reagent difference, also needs to do the positive hole of experiment (Cocktail stimulation) to prove reagent effectiveness.

9. sorting strategy is as follows: first drawing a circle to approve lymphocyte populations is P1 door, then with CD3+CD4+ and CD3+CD8+ sorting CD4+ and CD8+ cell respectively.First establish door with the lymphocyte populations of secrete cytokines all in CD4+ and CD8+.

10. according to dissimilar T lymphocyte proportion in total cell number of upper machine testing, and the count results of every mouse boosting cell, calculate the lymphocytic absolute quantity of various cytokine secretion type T in single mouse spleen respectively.Often organize data calculating mean value and standard error respectively.

Experimental result is shown in Fig. 5.

As shown in Fig. 5 (A), relative to PBS group, the splenocyte of BCG group immune mouse, after PPD or antigen A 1D4 stimulates, total IFN-γ secreting type CD4+ that induction produces and CD8+T cell quantity, all significantly raise (P<0.05).The most important thing is, no matter stimulate with PPD or specific antigen A1D4, A1D4/MTO immune group mouse spleen total IFN-γ secreting type CD4+ and CD8+T cell number, in each experimental group, quantity is all the highest, compare PBS group, BCG group and MTO group, all significantly rise (P<0.05).In addition, although total the IFN-γ secreting type CD4+T cell number that produces for PPD of MTO group mice is suitable with PBS group, but its total IFN-γ secreting type CD8+T cell number is significantly higher than PBS group (P<0.05).After A1D4 protein-specific stimulates, MTO adjuvant group produces total IFN-γ secreting type CD4+ and CD8+T cell number, and all comparatively PBS group significantly raises (P<0.05).

As shown in Fig. 5 (B), after PPD stimulates, in each group, total TNF-α secreting type CD4+T cell number that the induction of BCG group immune mouse produces is the highest, is significantly higher than respectively other each group (P<0.05).Meaningfully, compare with MTO group with PBS group, A1D4/MTO group total TNF-α secreting type CD4+T cell number significantly rises (P<0.05).After A1D4 antigen-specific sexual stimulus, relative to PBS group, total TNF-α secreting type CD4+T that BCG group mice produces and CD8+T cell quantity all significantly raise (P<0.05); Importantly, total TNF-α secreting type CD4+T that A1D4/MTO group produces and CD8+T cell number, all be significantly higher than PBS group and MTO group (P<0.05), but A1D4/MTO group produces total TNF-α secreting type CD4+T cell number and BCG group is suitable, the total TNF-α secreting type CD8+T cell number produced, is significantly higher than BCG group (P<0.05).In addition, MTO group total TNF-α secreting type CD4+T and CD8+T cell number, be all significantly higher than PBS group (P<0.05).

The anti-M.tb H37Rv of embodiment 10 subunit vaccine A1D4/MTO immune mouse is through the short-term protective of tail Intravenous Infection

1, the grouping of laboratory animal and immunity:

The female C57BL/6 mice of SPF level in 6 week age, quality certification lot number is No.4200592074, purchased from Wuhan University ABSL-3 animal experimental center.Raise the Ventirack animal breeding cabinet in Wuhan University animal experimental center ABSL-3 laboratory, all operations all strictly observes Wuhan University's zoopery workbook.

Experimentally need, laboratory animal be divided into following four groups: negative control group---PBS group; Positive controls---BCG group; Vehicle control group---MTO group; Experimental group---A1D4/MTO group.Often organize 5.

Animal immune method and dosage the same.

Zoogenetic infection approach: after immune 9 weeks, (actual counteracting toxic substances bacterium amount is 1.2 × 10 through tail Intravenous Infection mice to utilize M.tb H37Rv standard strain ⁶cFU/ only).

2, the lotus bacterium component analysis of lungs and spleen

After putting to death mice, with 75% alcohol-pickled sterilization 10min, aseptic taking-up lungs and spleen, take full lung weight and the lung weight for pathological analysis; To remain lungs and whole spleen, add the aseptic 1 × PBST of 2ml respectively according to every internal organs, grind and rinse in mortar, transfer in 10ml sterile tube, agitator fully mixes.Get 100 μ l stock solutions to join in 900 μ l PBST and do doubling dilution, after agitator fully mixes, get 4 each 100 μ l coating 7H11-OADC culture dishs of dilution bacterium liquid and (during preparation, add cycloheximide, the growth of Antifungi, add TCH can Selective depression remain the growth of BCG).Three lattice are coated with respectively dull and stereotyped with 1 dilution bacterium liquid.Residue stock solution is kept at-80 DEG C of refrigerators, checks for subsequent use.Plate is put in 37 DEG C of incubators cultivations and carries out colony counting after 3 ~ 4 weeks.According to count results, dilution factor and organ weights, calculate into total plate count contained by single internal organs, with Log ₁₀(CFU) component analysis of lotus bacterium is carried out.Calculate average and the standard error of each group.

Experimental result is shown in Fig. 6.

With expection be consistent, the lungs of PBS negative control group mice and the lotus bacterium amount of spleen all the highest.It should be noted that, compared with PBS group, the lungs of A1D4/MTO vaccine group and BCG group and the lotus bacterium amount of spleen, all significantly reduce (p < 0.001) respectively, wherein, A1D4/MTO group mice lungs lotus bacterium amount decreases 1.05log than PBS group, and spleen lotus bacterium amount decreases 0.99log than PBS group.Although MTO group also provides low-level protectiveness relative to PBS group; the lotus bacterium amount of A1D4/MTO group mice lungs and spleen also significantly reduces (p < 0.001) relative to MTO group; A1D4/MTO group mice lungs lotus bacterium amount reduces 0.62log than MTO group, and spleen lotus bacterium amount reduces 0.64log than MTO group.These results all show, A1D4/MTO vaccine can suppress M.tb in the propagation of immune mouse lungs and spleen preferably, have the protectiveness of opposing M.tb actute infection.

3, lung tissue pathological evaluation

Often organize the superior lobe of left lung taking 3 mices at random, fixing in 4% paraformaldehyde solution.Through paraffin embedding and section, carry out HE dyeing and the section of acid-fast stain Pathologic specimen respectively.Evaluate lung tissue's structural damage and inflammatory cell infiltration situation and m tuberculosis infection situation by Pathology Doctors ' blind, and provide pathological replacement.

Experimental result is shown in Fig. 7.

The lung tissue of PBS group mice based on the Tuberculous nodular lesion of epithelioid cell, inflammatory cell hypertrophy, and merges in flakes; The exudative inflammatory backgrounds such as the epithelial cell come off, the inflammatory cell oozed out and pulmonary edema are had in the alveolar of local.Tuberculous lesion area accounts for 40% of lung tissue.After lung tissue section's acid-fast stain, the acid-fast bacilli of a large amount of agglomerating gathering of visible PBS group (++ ~ +++).MTO group mouse lung tissue alleviates to some extent than PBS group, but also have stronger periangiitis and peribronchitis, Tuberculous lesion area accounts for 36% of lung tissue, after lung tissue section's acid-fast stain, visible acid-fast bacilli is be dispersed in trend in a large number, localized clusters distribution (+~ ++).A1D4/MTO group mouse lung tissue injury comparatively PBS group and MTO group is light, and pathological changes is in local point-like, and interstitial inflammation is background, and local has exudative inflammation to change, and Tuberculous lesion area accounts for 30% of lung tissue.After lung tissue section's acid-fast stain, the acid-fast bacilli that is dispersed on a small quantity as seen (a little ~+).BCG group pathological change is the slightest relatively, and be dispersed in the lesser tubercle of distribution as seen, lesion area accounts for 10% of lung tissue.Acid-fast bacilli is had no in lung tissue section.

Those skilled in the art will readily understand; the foregoing is only preferred embodiment of the present invention; not in order to limit the present invention, all any amendments done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.

Claims

1. a tuberculosis subunit vaccine, it is characterized in that, containing fusion rotein A1D4, its concentration is 0.1mg/ml to 1mg/ml, and described its encoding gene of fusion rotein A1D4 is the sequential series of Rv1813, Rv2660c, Ag85B, Rv2623 and HspX gene according to Rv1813-Rv2660c-Ag85B-Rv2623-HspX.

2. tuberculosis subunit vaccine as claimed in claim 1, it is characterized in that, the sequence of described fusion rotein A1D4 is:

(1) protein be made up of the aminoacid sequence shown in SEQ ID No.1; Or

3. tuberculosis subunit vaccine as claimed in claim 1 or 2, it is characterized in that, the Squalene oil of the trehalose also containing the monophosphoryl lipid A of 0.2mg/ml to 0.3mg/ml, 0.2mg/ml to 0.3mg/ml, volume fraction 1% to 4%, the sorbester p37 of volume fraction 1% to 4% and the tween 80 of volume fraction 0.1% to 0.4% are Water-In-Oil sample solution.

4. tuberculosis subunit vaccine as claimed in claim 3, it is characterized in that, described trehalose is 6,6 '-two mycolic acids.