CN106198971A - The application of antigen of mycobacterium tuberculosis albumen Rv2351c - Google Patents
The application of antigen of mycobacterium tuberculosis albumen Rv2351c Download PDFInfo
- Publication number
- CN106198971A CN106198971A CN201610622674.4A CN201610622674A CN106198971A CN 106198971 A CN106198971 A CN 106198971A CN 201610622674 A CN201610622674 A CN 201610622674A CN 106198971 A CN106198971 A CN 106198971A
- Authority
- CN
- China
- Prior art keywords
- rv2351c
- antigen
- mycobacterium tuberculosis
- albumen
- tuberculosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/5695—Mycobacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/04—Mycobacterium, e.g. Mycobacterium tuberculosis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
- G01N33/56972—White blood cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/35—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Mycobacteriaceae (F)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Hematology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Zoology (AREA)
- Communicable Diseases (AREA)
- Pulmonology (AREA)
- Mycology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention provides antigen of mycobacterium tuberculosis albumen Rv2351c application in preparing diagnosis reagent, Vaccinum Calmette-Guerini and antituberculotics.The present invention provides a kind of new tuberculosis detection antigen protein Rv2351c, compared with the detection means in the past using single antigen, can reduce the false negative caused because of single T cells with antigenic specificity, thus improve detection sensitivity.The antigen protein Rv2351c of the present invention is tuberculosis virulence correlation factor, and the high intensity of cellular immunization and humoral immunization shows that this antigen has stronger immunogenicity, can be used as novel Vaccinum Calmette-Guerini candidate antigens.
Description
Technical field
The present invention relates to molecular biology and field of immunology, specifically, relate to antigen of mycobacterium tuberculosis albumen
Rv2351c application in preparing diagnosis reagent, Vaccinum Calmette-Guerini and antituberculotics.
Background technology
Tuberculosis is the infectious diseases common to human beings and animals caused by mycobacterium tuberculosis, adds up according to World Health Organization (WHO), at present
The whole world there are about the population of 1/3 and infected mycobacterium tuberculosis, wherein there are about 10% and likely develops into active tuberculosis.China
Tuberculosis infection rate is 44.5%, is that one of serious country of 22 TB endemic in the whole world, tuberculosis patient sum occupy second,
It is only second to India.WHO report in 2014 shows 2013 has 9,000,000 newborn cases and 1,500,000 people to die from tuberculosis, and wherein 360,000
Belonging to HIV positive patients, 480,000 belong to multiple-drug resistance tuberculosis patient (MDR-TB), and mycobacterium tuberculosis merges human immune deficiency
Virus infects and the appearance of multiple antibiotic resistant strain so that tuberculosis becomes the public health problem of serious harm human health.
At present, tuberculosis is still in China's infectious disease a kind of disease endangering maximum, high specific and hypersensitivity tuberculosis
Sick technique for detection and reagent, for early diagnosis lungy, isolation in time and treatment, effectively cut off the route of infection, fall
Low M & M lungy is most important.The diagnosis of tuberculosis usually rely on laboratory diagnosis, imaging examination and
Clinical diagnosis etc., although sputum smear dyeing microscopy is simple in bacteriodiagnosis, but higher to the concentration requirement of sample, generally
Wanting bacteria containing amount just can detect the positive 5000～10000/ml, therefore positive rate is low, easy missing inspection, whether qualified sample is directly determines
Whether the positive of expectorant bacterium recall rate.Sputum culturing is the goldstandard of diagnosis of tuberculosis, but the cycle is long, and culture success ratio only has 80%,
It is unfavorable for quickly detecting.Be most commonly used that tuberculosis of skin rhzomorph is tested clinically, but skin experiment by bacillus calmette-guerin vaccine (BCG) inoculation and
The interference of environment mycobacterial infections causes false-positive appearance so that it is sensitivity is relatively low, and needs patient's secondary to seek medical advice.Knot
The imaging examination of core is as expensive in conventional x-ray inspection, CT examination, MRI inspection, ultrasonic examination etc., and produces health
The most traumatic, specificity is low, is not suitable for the inspection diagnosis of routine.
Mycobacterium tuberculosis resides in macrophage after invading human body, and human body is anti-to the immunity that mycobacterium tuberculosis is main
Should be cellular immunization, the cell being primarily involved in be CD4+ and CD8+T cell.By the T lymphocyte of pathogen sensitization, again contact
Can discharge IFN-γ after isoantigen, the reaction of high-caliber IFN-γ can point out the infection of this pathogen.With T cell it is
The ELISPOT detection method on basis is the peripheral blood lymphocyte stimulated through tuberculosis antigen by the capture of IFN-γ specific antibody
The IFN-γ produced after cultivation, and present in the way of enzyme connection spot development, determine emiocytosis cell from the quantity of speckle
The situation of the factor, evaluates cellular immune function from individual cell level.The detection of the external IFN-γ based on T cell by with
In auxiliary diagnosis lungy, this detection method can not only filter out active tuberculosis patient, also can detect simultaneously and hide
Phase patient, it is thus possible to preferably prevent and control tuberculosis incubation period, the most existing with M. tuberculosis genes group RD1 district coding
The whole protein of tuberculosis specific antigen ESAT-6 and CFP-10 or commercialization IGRA test kit that polypeptide is stimulus object, as
QuantiFERON-TB Gold test and T-SPOT, all presents higher susceptiveness and specificity.Rv2351c(GI:
15609488) it is by the Specific Antigen of Mycobacterium Tuberculosis of M. tuberculosis genes group difference section RD7 coding, also known as film phosphorus
Acid esters enzyme plcA, this antigen protein contains 512 aminoacid, is possible relevant virulence factor, and this albumen is at all of BCG
(BCG-Danish, BCG-Prague, BCG-Glaxo, BCG-Frappier, BCG-Connauht, BCG-Phipps, BCG-
Tice, BCG-Pateur, BCG-Moreau, BCG-Brikhaug, BCG-Sweden, BCG-Japan, BCG-Russian, BCG-
Brazil) all lack in, by bioinformatics software, it is carried out Epitope prediction analysis further, find Rv2351c
There is more t cell epitope in albumen, has potential diagnostic, and Rv2351c is only in mycobacterium tuberculosis and minority
Environment mycobacteria exists, can effectively distinguish tuberculosis patient, Pulmonary Diseases patient and Healthy People, do not connect by bacillus calmette-guerin vaccine simultaneously
The impact planted.
Quick and the early diagnosis of tuberculosis is that early treatment lungy provides strong guarantee, but wants to hold back on source
Tuberculosis processed also should be started with in terms of the preparation of Vaccinum Calmette-Guerini.BCG vaccine is most popular and is the only approved at present
The Vaccinum Calmette-Guerini used, BCG has good protective efficacy to infant meningitis, but to being grown up tuberculosis protective rate height the most not
One, the transformation to Vaccinum Calmette-Guerini at present is broadly divided into two aspects: one be novel subunit vaccine as booster immunization vaccine, to increase
The immunne response that strong BCG causes.Two is again to recombinate the Immunodominant Antigenic that BCG lacks to pass through process LAN in BCG vaccine
Immunodominant Antigenic, thus strengthen the protective immune response that BCG causes.BCG vaccine has used for many years, and its safety has obtained
To a large amount of checkings inoculating crowd, therefore both the above vaccine Reconstruc-tion policy is all set up the biggest advantage on the basis of BCG.
The panimmunity dominant antigens such as current antigen such as Ag85, Rv3425, HspX are identified and are being used for grinding of Vaccinum Calmette-Guerini
In studying carefully.Owing to mycobacterium tuberculosis is intracellular bacterium, field planting and propagation in pulmonary alveolar macrophage, cellullar immunologic response is removing knot
Playing an important role in core mycobacteria, research also demonstrate that the antibody that humoral immunoresponse(HI) causes can change mycobacterium tuberculosis
Disease, wherein research confirms that IgM, IgG1, IgG3 and IgA etc. are protection antibodies, and therefore cellular immunization and body fluid are exempted from
Epidemic disease is most important in tuberculosis infection.
Summary of the invention
It is an object of the invention to provide the application of antigen of mycobacterium tuberculosis albumen Rv2351c.
In order to realize the object of the invention, the present invention provides antigen of mycobacterium tuberculosis albumen Rv2351c in preparation tuberculosis
Application in detectable.Wherein, the aminoacid sequence of described antigen protein Rv2351c is as shown in SEQ ID NO:1, or this sequence
Arrange through replacing, lacking or add one or several amino acids formed aminoacid with identical immunogenicity and same antigen
Sequence.
The present invention also provides for the albumen derivative by described antigen protein Rv2351c or its analog.
The present invention also provides for encoding the DNA molecular of described antigen protein Rv2351c.
The present invention also provides for the expression vector containing described DNA molecular, expression cassette.
The present invention also provides for the transgenic cell line containing described DNA molecular.
The present invention also provides for the recombiant protein of the recombinant bacterium containing described DNA molecular and expression and purification thereof.Preferably by former
Antigen protein Rv2351c described in nuclear expression system expression, preferred prokaryotic expression carrier is pET-30a carrier, preferred protokaryon
Cell is e. coli bl21 (DE3).
In one embodiment of the invention, from Mycobacterium tuberculosis H37Rv genome, amplify Rv2351c
Purpose fragment, purpose fragment glue reclaim after be connected on T4 carrier, be transformed in bacillus coli DH 5 alpha competent cell cultivation,
After extracting plasmid order-checking correctly, plasmid double digestion is connected on pET-30a carrier is transformed into e. coli bl21 competence thin
In born of the same parents, 37 DEG C, obtain inclusion body protein after IPTG induction, after purified renaturation, obtain activated Rv2351c albumen.
The present invention also provides for a kind of diagnosis reagent, containing antigen of mycobacterium tuberculosis albumen in described detectable
Rv2351c, or encode the DNA molecular of described antigen protein Rv2351c, or produced by the recombinant bacterium containing described DNA molecular
Recombiant protein.
The present invention also provides for the tuberculosis ELISPOT detection kit containing above-mentioned detectable.
Described test kit also includes:
1. one resists: the mouse IgG monoclonal antibody of anti-human or animal's IFN-γ.
2. enzyme marking reagent: the another kind of mice of anti-human or animal's IFN-γ difference epi-position of horseradish peroxidase-labeled
IgG monoclonal antibody.
3. standard substance:
Culture plate: containing pvdf membrane or 96 hole micro reaction plates of nitrocellulose filter, containing tuberculosis in Positive control wells
Nonspecific stimulation antigen (such as PHA etc.), local comparison is containing PBS or substrate liquid.
4. the reagent needed for other ELISPOT detection and consumptive material.
Preferably, one anti-it is fixed on above-mentioned micro reaction plate.
The present invention also provides for antigen of mycobacterium tuberculosis albumen Rv2351c application in preparing Vaccinum Calmette-Guerini.
The present invention also provides for a kind of Vaccinum Calmette-Guerini, and its effective ingredient is antigen of mycobacterium tuberculosis albumen Rv2351c, or compiles
The DNA molecular of the described antigen protein Rv2351c of code, or the recombiant protein produced by the recombinant bacterium containing described DNA molecular.
The present invention also provides for antigen of mycobacterium tuberculosis albumen Rv2351c application in preparing antituberculotics.
Using antigen of mycobacterium tuberculosis albumen Rv2351c as immunogen, it is aided with adjuvant immunity laboratory animal, prepares many grams
Grand antibody；Or using antigen of mycobacterium tuberculosis albumen Rv2351c as immunogen, it is aided with adjuvant immunity laboratory animal, uses
Hybridoma technology and DNA recombinant technique, prepare and identify that the Humanized monoclonal of antigen of mycobacterium tuberculosis albumen Rv2351c resists
Body.
The present invention also provides for a kind of antituberculotics, and its effective ingredient is with antigen of mycobacterium tuberculosis albumen Rv2351c
As immunogen, it is aided with adjuvant immunity laboratory animal, the polyclonal antibody of preparation, or with antigen of mycobacterium tuberculosis albumen
Rv2351c, as immunogen, is aided with adjuvant immunity laboratory animal, uses hybridoma technology and DNA recombinant technique, the identification of preparation
The Humanized monoclonal antibodies of antigen of mycobacterium tuberculosis albumen Rv2351c.
The present invention further provides the specificity that described antigen protein Rv2351c causes at detection m tuberculosis infection
Application in T cell and B cell immunoreation.It is by the lymphocyte of human or animal after antigen protein Rv2351c stimulates,
Detection T cell or the cytokine of B cell secretion.
Wherein, the cytokine of tuberculosis specific T-cells secretion includes: IFN-γ (IFN-γ), interleukin II
(IL-2), interleukin-4 (IL-4), interleukin 10 (IL-10), tumor necrosis factor α (TNF-α) etc..B cell is secreted
Cytokine include antibody.
Detection method for the cytokine of tuberculosis specific T-cells secretion includes that ELISpot is tested
(ELISPOT) dyeing and T cell propagation examination in, elisa (ELISA), immune colloid gold test, cytokine
Test.The detection method of the cytokine of B cell secretion includes elisa (ELISA) etc..
Described lymphocyte is from peripheral blood, venous blood, cerebrospinal fluid, hydrothorax or the hydrothorax etc. of human or animal.
The invention have the advantages that
(1) present invention provides a kind of new tuberculosis detection antigen, compared with the detection means in the past using single antigen,
The false negative caused because of single T cells with antigenic specificity can be reduced, thus improve detection sensitivity.
(2) the antigen protein Rv2351c of the present invention is present in RD7 district, at all mycobacterium tuberculosis and
Lacking in Mycobacterium bovis, making detection not inoculated by BCG is affected, and is conducive to improving the specificity of detection.
(3) present invention utilizes prokaryotic expression purifying protein Rv2351c, is suitable for large-scale commercial and produces, and
Cost is relatively low.
(4) the antigen protein Rv2351c of the present invention is tuberculosis virulence correlation factor, cellular immunization and humoral immune reaction
High intensity show that this antigen has stronger immunogenicity, can be used as novel Vaccinum Calmette-Guerini candidate antigens.
Accompanying drawing explanation
Fig. 1 is the agarose gel electrophoresis testing result of genes of interest Rv2351c in the embodiment of the present invention 1.
Fig. 2 is the SDS-PAGE electrophoresis detection result of albumen Rv2351c in the embodiment of the present invention 1；Wherein, 1 for containing empty matter
BL21 (DE3) bacterium of grain, 2 is the BL21 (DE3) containing recombiant plasmid of induction, and 3 is the Rv2351c albumen of purification.
Fig. 3 is that the ELISPOT of antigen of mycobacterium tuberculosis albumen Rv2351c in the embodiment of the present invention 3 tests speckle figure.
Fig. 4 is that the ELISPOT of Rv2351c tuberculosis patient and healthy volunteer in the embodiment of the present invention 3 tests speckle figure.
Fig. 5 is each testing result organizing serum antibody titer in the embodiment of the present invention 4.
Detailed description of the invention
Following example are used for illustrating the present invention, but are not limited to the scope of the present invention.If not specializing, embodiment
All according to conventional laboratory conditions, as Sambrook equimolecular Cloning: A Laboratory Manual (Sambrook J&Russell DW,
Molecular Cloning:a Laboratory Manual, 2001), or the condition according to manufacturer's description suggestion.
The clone of embodiment 1 antigen of mycobacterium tuberculosis gene Rv2351c and the expression and purification of albumen
1. design of primers: according to the genome sequence of Mycobacterium tuberculosis H37Rv on NCBI, utilizes software Primer5 to set
Meter primer, forward primer: GCGCGGATCCATGTCACGTCGAGAGTTTTTG (containing BamH1 restriction enzyme site), downstream primer:
ATATAAGCTTTCAGCTGCACAGCCCGCTGG (containing Hind III restriction enzyme site).
2. the amplification of genes of interest: utilize CTAB method to extract the genomic DNA of Mycobacterium tuberculosis H37Rv, with DNA as mould
Plate, carries out the amplification of genes of interest, and the system of PCR reaction is as follows:
PCR response procedures: 95 DEG C of thermal starting 5min；94 DEG C of degeneration 1min, 60 DEG C of annealing 1min, 72 DEG C of extension 1min, 30
Individual circulation；Last 72 DEG C of incubation 10min.
3. the qualification of genes of interest: take 7 μ l PCR primer and carry out electrophoresis in the agarose gel of 1%, uses
DL1000DNAMarker is molecular weight standard, checks result preservation of taking pictures with gel imaging system.
The recovery of 4.PCR product and purification:
PCR primer 1% agarose gel electrophoresis, cuts purpose band with the scalpel sterilized, and will contain
The agar block of purpose fragment is placed in 2ml EP pipe.
A (1) adds the Buffer PG of 3 times of volumes in 100mg blob of viscose, hatches 10 minutes, therebetween every 2～3 points for 50 DEG C
Clock leniently turns upside down centrifuge tube, to guarantee that blob of viscose is completely dissolved.
A (2) adds the isopropanol of 1 times of volume, mixing of turning upside down.
A (3) column equilibration: adding 200 μ l Buffer PS in the adsorption column having been charged in collecting pipe, 16200g is centrifuged 2
Minute, outwell the waste liquid in collecting pipe, adsorption column is reentered in collecting pipe.
The solution that step (1) obtains is joined in the adsorption column filling collecting pipe by A (4), and room temperature is placed 2 minutes,
16200g is centrifuged 1 minute, outwells the waste liquid in collecting pipe, is put back in collecting pipe by adsorption column.
Adsorption column is put in a new 1.5ml centrifuge tube by A (5), to adsorbed film centre position unsettled dropping 50 μ l
Buffer EB, room temperature placement 2 minutes, 16200g is centrifuged 1 minute, collects DNA solution, and-20 DEG C preserve DNA.
5. the amplification of plasmid:
Empty plasmid pET-30a is transferred in bacillus coli DH 5 alpha, 37 DEG C of mistakes on the LB solid plate containing ammonia benzyl mycin
After night, the single bacterium colony of picking, it is placed in incubated overnight in the liquid LB of ammonia benzyl resistance, (Beijing health is that century is raw to secondary daily test kit
Extraction reagent kit in the plasmid without endotoxin that thing Science and Technology Ltd. produces) extract plasmid, step is as follows:
B (1) takes 5～15ml incubated overnight bacterium solution, adds in centrifuge tube, and ＞ 6200g is centrifuged 3 minutes and collects antibacterial, as far as possible
Discard whole supernatant.
B (2) adds 500 μ l Buffer P1 in the centrifuge tube leave bacterial sediment, uses pipettor or vortex oscillation
Device fully mixes, and suspended bacterial precipitates.
B (3) adds 500 μ l Buffer P2 in centrifuge tube, mixing 6～8 times of leniently turning upside down, and makes thalline abundant
Cracking, room temperature is placed 3～5 minutes, adds 500 μ l Buffer E3 in centrifuge tube, mixing 6～8 times of turning upside down immediately, this
Time white flock precipitate occurs, room temperature is placed 5 minutes, and 16200g is centrifuged 10 minutes, draws supernatant, supernatant is added Filter column
In, 16200g is centrifuged filtration in 1 minute, the filtrate in collecting pipe is transferred in centrifuge tube.450 μ l isopropyls are added in filtrate
Alcohol, mixing of turning upside down.
B (4) column equilibration: adding 200 μ l Buffer PS in the adsorption column have been charged into collecting pipe, 16200g is centrifuged 2 points
Clock, outwells the waste liquid in collecting pipe, is placed back in collecting pipe by adsorption column.
The mixed solution of filtrate in step B (3) Yu isopropanol is transferred in the adsorption column balanced by B (5).16200ⅹg
Centrifugal 1 minute, outwell the waste liquid in collecting pipe, adsorption column is placed back in collecting pipe.
B (6) adds 750 μ l Buffer PW in adsorption column, and 16200g is centrifuged 1 minute, outwells the waste liquid in collecting pipe.
Being placed back in by adsorption column in collecting pipe, 16200g is centrifuged 2 minutes, outwells waste liquid, and adsorption column is placed in drying at room temperature 5 points
Clock.
Adsorption column is placed in a new centrifuge tube by B (7), adds 100～300 μ l to the middle part of adsorbed film
Endo-Free Buffer EB, room temperature placement 2～5 minutes, 16200g is centrifuged 2 minutes, and-20 DEG C preserve plasmids.
6. the DNA product obtained and plasmid are carried out double digestion respectively.
The endonuclease reaction system of DNA product is:
The endonuclease reaction system of plasmid is:
Respectively 37 DEG C hatch 1 hour after, with DNA product purification kit (Tian Gen biochemical technology company limited), enzyme action is produced
Thing reclaims, and step is as follows:
C (1) column equilibration step: the balance liquid BL, 12000rpm that add 500 μ l in adsorption column CB2 are centrifuged 1min, outwell
Waste liquid in collecting pipe, places back in adsorption column CB2 in collecting pipe.
C (2) is added thereto to the combination liquid PB of 5 times of volumes, fully mixes.Gained solution is added an adsorption column CB2
In, room temperature is placed 2min, 12000rpm and is centrifuged 30～60sec, outwells the waste liquid in collecting pipe, adsorption column CB2 is put into collection
Guan Zhong.
C (3) adds 600 μ l rinsing liquid PW in adsorption column CB2, and 12000rpm is centrifuged 30～60sec, outwells in collecting pipe
Waste liquid, adsorption column CB2 is put in collecting pipe.
C (4) repetitive operation above-mentioned steps.
Adsorption column CB2 is put back in collecting pipe by C (5), and 12000rpm is centrifuged 2 minutes, removes rinsing liquid, by adsorption column as far as possible
CB2 places several minutes in room temperature, thoroughly dries.
Adsorption column CB2 is put in a clean centrifuge tube by C (6), to the unsettled dropping in adsorbed film centre position 30～50 μ
L elution buffer EB, room temperature is placed 2min, 12000rpm and is centrifuged 2min collection DNA solution.
7. recombiant plasmid and the acquisition of recombinant bacterium:
Connect: DNA and the pET-30a plasmid T4DNA ligase obtained by purification after enzyme action is attached, linked system
As follows:
16 DEG C overnight connect.
Convert: by the Plastid transformation of connection to escherichia coli DN5 α, 5 μ l plasmids are joined equipped with 50 μ l competence thin
In the centrifuge tube of born of the same parents, with rifle piping and druming uniformly, ice bath 30min, 42 DEG C of water-bath 90sec, ice bath 2min, add 400 μ l 37 DEG C preheating
LB culture medium without antibiotic, cultivates 45min, 150r/min, makes cellular-restoring Drug resistance in 37 DEG C of shaking tables, 4000r is centrifuged
2min.Discard 400 μ l supernatants, remaining 55 μ l mixings, be coated with LB plate.After being placed in room temperature 4～5min, it is inverted plate in 37 DEG C of cultivations
12～16 hours.
Order-checking: the single bacterium colony of picking, carries out bacterium solution PCR (Fig. 1), and the monoclonal of the checking positive is placed in LB liquid medium
After cultivating 12 hours, Beijing Qing Kexin industry Bioisystech Co., Ltd is sent to check order.
After the correct strain amplification culture again that will check order extract plasmid, be transformed in e. coli bl21 (DE3) (step with
On).To convert after BL21 (DE3) carry out bacterium colony PCR checking the positive after, part glycerol deposit in-70 DEG C as strain,
A part of amplification culture obtains albumen.
8. antigen of mycobacterium tuberculosis abduction delivering in escherichia coli:
Fresh for 1ml bacterium solution is added in the 300ml LB culture medium containing ammonia benzyl resistance after 37 DEG C of incubator overnight are cultivated, next day
Add 300ml LB culture medium amplification culture after 3 hours, measure OD value when 0.6～0.8, addition IPTG (isopropyl-β-
D-Thiogalactopyranoside) make its final concentration of 1mmol/ml, after 37 DEG C are induced 3 hours, 12000rpm is centrifuged collection in 5 minutes
Thalline, with the resuspended thalline of PBS containing 1%Triton X-100, after mixing, by power 300W Ultrasound Instrument, work 5s, stops 5s,
Ultrasonic 30min.12000rpm is centrifuged 5min, is retained by supernatant, after precipitation PBS is resuspended, carries out SDS-PAGE electrophoresis.Determine egg
Express in bacterial sediment with the form of inclusion body in vain.
The purification of 9.Rv2351c albumen and renaturation: collecting culture fluid, 8000 revs/min are centrifuged 10 minutes, collect precipitation
Thalline, in every 100ml bacterium solution add 4ml disruption buffer (pH8.550mM Tris-HCL, 2mM EDTA, 100Mm NaCl,
0.5%Triton X-100,1mg/ml lysozyme), mixing 45 minutes on ice, mixing thalline uses 300W Ultrasound Instrument work in frozen water
Making 5s, stop 5s, ultrasonic 10 minutes, then 12000g was centrifuged 10 minutes, discards precipitation, with the 50mM phosphate buffer of pH7.4
(containing 0.5M NaCl, 8M carbamide, 10mM imidazoles) resuspended precipitation, and with the membrane filtration of 0.45 μm, it is to avoid stifled post.Concrete operations
As follows:
(1) taking 1ml nickel NTA agarose gel prepacked column, use 10ml equilibration buffer, broken supernatant is with 0.5ml/
Min loading, then 2ml/ pipe subpackage.
(2) washing away unadsorbed sample, flow velocity 1～2ml/min with 15ml level pad, 2ml/ pipe is collected.
(3) unadsorbed sample, flow velocity 1 are washed away with 5ml lavation buffer solution (containing 0.5M NaCl, 8M carbamide, 25mM imidazoles)
～the collection of 2ml/min, 2ml/ pipe.
(4) foreign protein of absorption, flow velocity 1 is washed away with 5ml lavation buffer solution (containing 0.5M NaCl, 8M carbamide, 40mM imidazoles)
～the collection of 2ml/min, 2ml/ pipe.
(5) wash away destination protein with 5ml lavation buffer solution (containing 0.5M NaCl, 8M carbamide, 60mM imidazoles), flow velocity 1～
2ml/min, 2ml/ pipe is collected.
(6) wash away destination protein with 5ml elution buffer (containing 0.5M NaCl, 8M carbamide, 300mM imidazoles), flow velocity 1～
2ml/min, 2ml/ pipe is collected.
(7) with 5ml equilibration buffer pillar, fill 20% ethanol, close.
After the protein sample collected is carried out SDS-PAGE electrophoresis (Fig. 2), destination protein is used protein renaturation test kit
Carry out renaturation, and with BCA protein quantification test kit, the albumen Rv2351c of renaturation is carried out quantitatively.The aminoacid of albumen Rv2351c
Sequence is as shown in SEQ ID NO:1.
The preparation of embodiment 2 tuberculosis ELISPOT detection kit
Described test kit forms as follows substantially:
1. the proteantigen Rv2351c of embodiment 1 preparation.
2. one resists: the mouse IgG monoclonal antibody of anti-human or animal's IFN-γ.
Enzyme marking reagent: the another kind of mouse IgG of anti-human or animal's IFN-γ difference epi-position of horseradish peroxidase-labeled
Monoclonal antibody.
3. standard substance:
Culture plate: containing pvdf membrane or 96 hole micro reaction plates of nitrocellulose filter, containing tuberculosis in Positive control wells
Nonspecific stimulation antigen (such as PHA etc.), local comparison is containing PBS or substrate liquid.
4. the reagent needed for other ELISPOT detection and consumptive material.
Resist one and be fixed on above-mentioned micro reaction plate.
This test kit, based on double-antibody sandwich principle design, uses ELISPOT method detection antigen, and experimentation is:
On pvdf membrane coated one anti-can be in conjunction with the IFN-γ in cell conditioned medium as capture antibody, and IFN-γ can be by enzyme mark two
Anti-capture, colour developing.Two kinds of antibody are the monoclonal antibody identifying IFN-γ difference epitope.
Embodiment 3 antigen protein Rv2351c is for the Clinical detection of tuberculosis infection
1. the separation of peripheral blood lymphocyte
1.1 study subject
The screening criteria of volunteer's case:
Clinical manifestation symptom, sign and imaging examination of chest are diagnosed as phthisical, and Sputum culturing is positive lung knot
Core patient.
The screening criteria of Pulmonary Disease patients:
Sputum culturing and Sputum smears are negative pulmonary's other diseases, such as the Pulmonary Disease patients such as pneumoconiosis, chronic obstructive pulmonary disease.
The screening criteria of healthy volunteer:
Clinical symptoms without tuberculosis, without tuberculosis patient close contact history, without other diseases or infection.
Selected tuberculosis patient and volunteer's age 15-80 year between, from the continuous time medical to tuberculosis ward
Sample randomly selects.Acquire 60 example tuberculosis volunteers, 33 example Pulmonary Disease patients and 60 example healthy volunteer's blood altogether
Sample, uses during blood sampling and gathers peripheric venous blood without endotoxic anticoagulant heparin vacuum test tube, and every volunteer takes a blood sample about 5ml
～10ml.
1) sample separated liquid with Ficoll-Hypaque in 4 hours and separates PBMCs.
2) first by whole blood RPMI-1640 culture medium 1:1 dilution mixing, centrifuge tube adds the separation of certain volume
Liquid, tile separation liquid ullage by the blood sample after dilution, keeps two liquid level interfaces clear, separates liquid, anticoagulant not diluted
Whole blood, RPMI 1640 culture volume ratio for 1:1:1, room temperature (18～26 DEG C), 800g, centrifugal 20 minutes.
3) centrifugal terminate after, be erythrocyte at the bottom of pipe, intermediate layer is to separate liquid, and the superiors are plasma layers, plasma layer with separate
It it is white nebulous mononuclearcell (including lymphocyte and mononuclear cell) layer between liquid layer.White cloud and mist is drawn with suction pipe
Shape cellular layer is also transferred in 15ml sterile centrifugation tube, and addition RPMI 1640 culture medium is to 10ml, and under room temperature condition, 800g is centrifuged
10 minutes.
4) abandoning supernatant, resuspended rear addition 7ml RPMI 1640 culture medium, 700g is centrifuged 10 minutes.
5) abandon and reset and add the 0.5ml resuspended precipitation of AIM-V culture medium.
6) utilize automated cell calculating instrument to cell counting, with AIM-V culture medium prepare 500 μ L cell concentrations be 2.5 ×
106The cell suspension of/ml.
2.ELISPOT detects antigen protein Rv2351c specific T-cells
Using the test kit of embodiment 2, add following reagent in pre-coated one anti-microwell plate, each patient sets respectively
4 detection holes: Positive control wells (adding 100 μ L PHA-P HA as positive stimulus thing), negative control hole (add 100 μ L
PBS is as negative control), detection hole (adding the Rv2351c of the final concentration of 20 μ g/ml of 100 μ L), each hole adds on 100 μ L
State the PBMC diluted, make the quantity of PBMC in every hole reach 250,000, antigen and PBMC cell are placed in 37 DEG C, 5%CO2Training
Support in case and cultivate 20 hours.
3.ELISPOT washes plate and result judges
Washing away PBMC cell and antigenic stimulus thing, add the 100 anti-incubated at room temperature of μ L mono-1 hour, wash 5 times with PBS, it is anti-to add two
Incubated at room 1 hour, then wash 5 times with PBS, after adding the colour developing of substrate lucifuge 7 minutes, use purified water color development stopping, culture plate is put
The speckle number on access panel is dried at vent.
Result judges: blank control wells speckle number=N, detection hole speckle number=T, positive quality control hole speckle number=P.Result
Be shown in Table 1, Fig. 3 and Fig. 4.
Table 1ELISPOT result criterion
The result statistics of 60 example tuberculosis patients, 33 example pulmonary other diseases patients and 60 Healthy Peoples is shown in Table 2.Wherein, 60
Individual Healthy People there are 5 people be excluded owing to result cannot judge, amount to 55 Healthy Peoples, 60 tuberculosis patients and 33 pulmonarys
Other diseases patient includes statistical standard in.
Table 2Rv2351c crowd monitoring result
| Diagnosis of pulmonary tuberculosis is positive | Diagnosis of pulmonary tuberculosis is negative | Amount to | |
| The detection positive | 37 | 8 | 45 |
| Detection feminine gender | 23 | 80 | 103 |
| Amount to | 60 | 88 | 148 |
Being computed showing that the sensitivity that antigen protein Rv2351c detects tuberculosis patient is 61.67%, specificity is
90.91%.
Detection sensitivity=(tuberculosis patient detection number positive/tuberculosis patient sum) × 100%
Detection specificity=1-(consumptive detects number positive+healthy volunteer and detects number positive)/(pulmonary disease
Patient populations+healthy volunteer's sum)
The immunogenicity detection of embodiment 4 Rv2351c
1, immune mouse
Screen the female BAl BIc/c mice 30 of 6 week old, be divided into 5 groups, PBS negative control group (PBS), vehicle control group
(DP), antigen of mycobacterium tuberculosis protein A g85B 20 μ g low dose group (Ag85b-L), Ag85B 50 μ g high dose group
(Ag85B-H), Rv2351c 20 μ g low dose group (2351c-L), Rv2351c 50 μ g high dose group (2351c-H), will every group
Antigen and corresponding adjuvant--poly poly (I:C) 50 μ L and DDA (DDA) 100 μ L fills
Using the mode immune mouse of subcutaneous vaccination, every immunity in 3 weeks once, the most immune three times after point emulsifying, final immunization 4 weeks is laggard
Row detection.
2, the separation of mice serum
Eyeball of mouse is taken a blood sample 500 μ L, is placed in by blood in 37 DEG C of incubators 2 hours, proceeds to 4 DEG C of refrigerator overnight afterwards.Secondary
Day, draw supernatant after being centrifuged by blood 3000rpm 5 minutes.
3, serum antibody titer detection
1) ELISA Plate 4 DEG C of the Rv2351c albumen of 2 μ g/ml is overnight coated, next day, washs 5 times with PBST.
2) close 2 hours with the PBS liquid containing 2%BSA 37 DEG C, wash 5 times with PBST.
3) with PBS by each group of serum by 20000,40000,80000,160000,320000,640000,1280000,
2560000 times of dilutions, add the serum after 100 μ L dilutions, after 37 DEG C hatch 1 hour, wash 5 times with PBST in every hole.
4) it is separately added into IgG, IgG1, IgG2a antibody of the HRP labelling of 5000 times of dilutions, every hole 100 μ L, hatches 1 for 37 DEG C
After hour, wash 5 times with PBST.
5), after adding TMB 37 DEG C colour developing 15 minutes, 2M sulphuric acid is added as stop buffer.
6) the suction pipe shading value of microplate reader detection wavelength 450nm.
7) criterion: OD >=2.1 × OD(negative control)Judgement be positive.
8) interpretation of result: the antibody titer of each group serum is shown in Fig. 5.
Result shows, IgG, IgG1, IgG2a antibody titer that Rv2351c high and low dose group produces is the highest,
Rv2351c-L, Rv2351c-H cause than Ag85b-L, Ag85B-H group respectively the IgG of higher concentration, Rv2351c-L and
The ratio of Rv2351c-H group IgG2a/IgG1 is 2.5 and 3.5 respectively, and Rv2351c is more likely to induction generation Th1 type immunity should
Answer, body can be stimulated to produce effective humoral immunoresponse(HI).
The cell immunogenicity detection of embodiment 5 Rv2351c
1, by after the sacrifice of immunity in embodiment 4, soak 5 minutes in 75% ethanol, mice is fixed on ultra-clean
On cystosepiment in platform, cut off peritoneum, isolate spleen, be placed on equipped with in the plate of 1640.
2, on the nylon wire of 200 mesh, it is lightly ground mouse spleen with plunger, the cell of grinding is passed through filter screen
Filter.1000r/min is centrifuged 5 minutes and abandons supernatant, it is thus achieved that cell.
3, cell is vibrated gently make it loosen, only add erythrocyte cracked liquid according to 2mL/, after mixing, be placed in 37 DEG C of temperature
After hatching 10 minutes in case, adding 2 times of volumes in 1640 culture medium of erythrocyte cracked liquid and terminate reaction, 1000r/min is centrifuged 5
Minute abandon supernatant, it is thus achieved that splenocyte.
4, with the 1640 the most resuspended splenocytes of culture medium 2ml/, 1000r/min is centrifuged 5 minutes and abandons supernatant, it is thus achieved that splenocyte.With
Cell counter measures cell concentration.
5, with the 1640 culture medium dilution splenocytes containing 10%FBS so that it is concentration is 2 × 106/mL.Often group takes 500 μ L
Splenocyte is placed in 24 well culture plates, and PBS group and DP adjuvant group splenocyte are respectively with the Ag85B and 5 μ g/mL of 5 μ g/mL
Rv2351c antigen Co stituation, Ag85B-L and Ag85B-H group hatches jointly with the Ag85B antigen of 500 μ L 5 μ g/mL respectively,
2351c-L and 2351c-H group is hatched jointly with the Rv2351c antigen of 500 μ L 5 μ g/mL respectively, and often group adds the aseptic of 500 μ L
PBS and the phytohaemagglutinin (PHA) that 500 μ L concentration are 5 μ g/mL do 2 as negative control and positive control, each detection hole
Individual repetition.By splenocyte with corresponding stimulus object at 37 DEG C, 5%CO2After incubator is hatched 72 hours, collect cell conditioned medium,
IFN-γ in ELISA method detection supernatant, IL-2, IL-4, IL-10.
6, IFN-γ monoclonal antibody, IL-2 monoclonal antibody, IL-4 monoclonal antibody etc. are coated liquid (pH=9.6), L-10 monoclonal antibody carbon with carbonic acid
After acid buffer (pH=6.5) dilutes according to 1:500 times, joining in 96 microwell plates by 100 μ L/ holes, 4 DEG C are coated overnight.
7, after washing 3 times with PBTS, patting dry, the PBS room temperature adding 10%FBS is closed 1 hour.
8, wash after 5 times with PBST, by IFN-γ, IL-2, IL-4, IL-10 standard substance according to corresponding dilution proportion
Become respective concentration, be added separately on each elisa plate, as standard curve.Remaining adds on the cell of 100 μ L needs detections
Clearly, incubated at room 2 hours.
9, dilute after 5 times with PBST, be separately added into 100 μ L IFN-γ, IL-2, IL-4, IL-10 respective detection antibody+
The two of HRP labelling resist, incubated at room 1 hour.
10, after washing 7 times with PBST, adding TMB nitrite ion 100 μ L, incubated at room, after 30 minutes, adds stop buffer 50 μ L
Terminate reaction.
11, microplate reader measures the light absorption value of wavelength 450nm, and the light absorption value of detection wavelength 570nm is as comparison simultaneously.
12, interpretation of result: make standard curve according to cytokine standards product, then the OD value in detection hole is substituted into public affairs
Formula, calculates the final concentration often organizing the various cytokine of mice.Result is as shown in table 3.
The testing result (pg/mL) of 3 four kinds of cytokines of table
| Packet/cytokine | IFN-γ | IL-2 | IL-4 | IL-10 |
| PBS group | 29.6±11.8 | 11.9±4 | 7.8±2.4 | 22.1±6 |
| DP adjuvant group | 40.3±11.4 | 17.5±11 | 12.1±3.4 | 34.6±10.2 |
| Ag85B-L | 4098.6±593.5ab | 45±10.3ab | 20.8±6ab | 1590.3±438.1ab |
| Ag85B-H | 5257.4±818.5ab | 43.4±19.6ab | 38.4±19.4ab | 3884.6±972.4ab |
| 2351c-L | 3805.3±1061.2ab | 31.4±12.9 | 36.1±8.9ab | 2860.9±485.2ab |
| 2351C-H | 4978.7±596.7ab | 33±12.1 | 68.3±15.5ab | 4733.7±629.2ab |
Note: a represent experimental group compared with PBS group, experimental group, compared with DP adjuvant group, has aobvious to have significant difference, b to represent
Write sex differernce.
Result shows, compared with PBS group and adjuvant group, Rv2351c high low dose group all can produce the IFN-of higher concentration
γ (P ＜ 0.001), IL-4 (P ＜ 0.001), IL-10 (P ＜ 0.001), IFN-γ is Th1 cytokines, can be by swashing
Live macrophage thus promote the macrophage removing to mycobacterium tuberculosis.IL-4 and IL-10 is Th2 cytokines, promotees
Enter the antibody during tuberculosis infection to produce.Immunoregulation effect is played in tuberculosis infection.
In sum, Rv2351c can be used for diagnostic detection lungy, and Rv2351c energy as a kind of diagnostic reagent
Cause strong cellullar immunologic response and humoral immunoresponse(HI), be a kind of Immunodominant Antigenic, may be used for the structure of Vaccinum Calmette-Guerini
Build and prepare.
Although, the present invention is described in detail the most with a general description of the specific embodiments, but
On the basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to the scope of protection of present invention.
Claims (10)
1. antigen of mycobacterium tuberculosis albumen Rv2351c application in preparing diagnosis reagent；Wherein, described antigen egg
The aminoacid sequence of white Rv2351c is as shown in SEQ ID NO:1, or this sequence is through replacing, lacking or add one or several ammonia
The aminoacid sequence with identical immunogenicity and same antigen that base acid is formed.
2. a diagnosis reagent, it is characterised in that containing antigen of mycobacterium tuberculosis albumen in described detectable
Rv2351c, or encode the DNA molecular of described antigen protein Rv2351c, or produced by the recombinant bacterium containing described DNA molecular
Recombiant protein.
3. contain the tuberculosis ELISPOT detection kit of detectable described in claim 2.
Test kit the most according to claim 3, it is characterised in that also include in described test kit:
1. one resists: the mouse IgG monoclonal antibody of anti-human or animal's IFN-γ；
2. enzyme marking reagent: the another kind of mouse IgG list of anti-human or animal's IFN-γ difference epi-position of horseradish peroxidase-labeled
Clonal antibody；
3. standard substance:
Culture plate: containing pvdf membrane or 96 hole micro reaction plates of nitrocellulose filter, containing the non-spy of tuberculosis in Positive control wells
Opposite sex stimulator antigen, local comparison is containing PBS；
4. the reagent needed for other ELISPOT detection and consumptive material；
Preferably, one anti-it is fixed on above-mentioned micro reaction plate.
5. antigen of mycobacterium tuberculosis albumen Rv2351c application in preparing Vaccinum Calmette-Guerini.
6. a Vaccinum Calmette-Guerini, it is characterised in that its effective ingredient is antigen of mycobacterium tuberculosis albumen Rv2351c, or coding
The DNA molecular of described antigen protein Rv2351c, or the recombiant protein produced by the recombinant bacterium containing described DNA molecular.
7. antigen of mycobacterium tuberculosis albumen Rv2351c application in preparing antituberculotics.
Application the most according to claim 7, it is characterised in that using antigen of mycobacterium tuberculosis albumen Rv2351c as exempting from
Epidemic focus, is aided with adjuvant immunity laboratory animal, prepares polyclonal antibody.
Application the most according to claim 7, it is characterised in that using antigen of mycobacterium tuberculosis albumen Rv2351c as exempting from
Epidemic focus, is aided with adjuvant immunity laboratory animal, uses hybridoma technology and DNA recombinant technique, prepares identification mycobacterium tuberculosis
The Humanized monoclonal antibodies of antigen protein Rv2351c.
10. an antituberculotics, it is characterised in that its effective ingredient is to make with antigen of mycobacterium tuberculosis albumen Rv2351c
For immunogen, it is aided with adjuvant immunity laboratory animal, the polyclonal antibody of preparation, or with antigen of mycobacterium tuberculosis albumen
Rv2351c, as immunogen, is aided with adjuvant immunity laboratory animal, uses hybridoma technology and DNA recombinant technique, the identification of preparation
The Humanized monoclonal antibodies of antigen of mycobacterium tuberculosis albumen Rv2351c.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610622674.4A CN106198971A (en) | 2016-08-01 | 2016-08-01 | The application of antigen of mycobacterium tuberculosis albumen Rv2351c |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610622674.4A CN106198971A (en) | 2016-08-01 | 2016-08-01 | The application of antigen of mycobacterium tuberculosis albumen Rv2351c |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106198971A true CN106198971A (en) | 2016-12-07 |
Family
ID=57497597
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610622674.4A Pending CN106198971A (en) | 2016-08-01 | 2016-08-01 | The application of antigen of mycobacterium tuberculosis albumen Rv2351c |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106198971A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110437322A (en) * | 2019-08-30 | 2019-11-12 | 上海市肺科医院 | A kind of marker and its application for diagnosis of tuberculosis |
| CN116003540A (en) * | 2022-12-08 | 2023-04-25 | 中国疾病预防控制中心传染病预防控制所 | Preparation and application of mycobacterium tuberculosis antigen composition PFHP010 |
| CN117305214A (en) * | 2023-11-28 | 2023-12-29 | 中国疾病预防控制中心传染病预防控制所 | Recombinant bacillus calmette-guerin vaccine and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1599751A (en) * | 2001-02-22 | 2005-03-23 | 巴斯德研究院 | Comparative mycobacterial geneomics as a tool for identifying targets for the diagnosis, prophylaxis or treatment of mycobacterioses |
| US20140220599A1 (en) * | 2011-06-03 | 2014-08-07 | Universite Montpellier 2 Sciences Et Techniques | Diagnosis method of active tuberculosis |
| CN104685054A (en) * | 2012-09-27 | 2015-06-03 | 成都永安制药有限公司 | Modified bcg strains with reduced or eliminated activity of lsr2 and pharmaceutical composition comprising same |
-
2016
- 2016-08-01 CN CN201610622674.4A patent/CN106198971A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1599751A (en) * | 2001-02-22 | 2005-03-23 | 巴斯德研究院 | Comparative mycobacterial geneomics as a tool for identifying targets for the diagnosis, prophylaxis or treatment of mycobacterioses |
| US20140220599A1 (en) * | 2011-06-03 | 2014-08-07 | Universite Montpellier 2 Sciences Et Techniques | Diagnosis method of active tuberculosis |
| CN104685054A (en) * | 2012-09-27 | 2015-06-03 | 成都永安制药有限公司 | Modified bcg strains with reduced or eliminated activity of lsr2 and pharmaceutical composition comprising same |
Non-Patent Citations (2)
| Title |
|---|
| MACHAO LI,ET AL: "Comparative Analysis of Human B Cell Epitopes Based on BCG Genomes", 《BIOMED RESEARCH INTERNATIONAL》 * |
| 王兆芬 等: "青海省38株结核分枝杆菌plc基因多态性研究", 《现代预防医学》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110437322A (en) * | 2019-08-30 | 2019-11-12 | 上海市肺科医院 | A kind of marker and its application for diagnosis of tuberculosis |
| CN116003540A (en) * | 2022-12-08 | 2023-04-25 | 中国疾病预防控制中心传染病预防控制所 | Preparation and application of mycobacterium tuberculosis antigen composition PFHP010 |
| CN116003540B (en) * | 2022-12-08 | 2024-04-16 | 中国疾病预防控制中心传染病预防控制所 | Preparation and application of mycobacterium tuberculosis antigen composition PFHP010 |
| CN117305214A (en) * | 2023-11-28 | 2023-12-29 | 中国疾病预防控制中心传染病预防控制所 | Recombinant bacillus calmette-guerin vaccine and preparation method and application thereof |
| CN117305214B (en) * | 2023-11-28 | 2024-04-05 | 中国疾病预防控制中心传染病预防控制所 | Recombinant bacillus calmette-guerin vaccine and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110981944B (en) | African swine fever virus T cell antigen polypeptide and ELISPOT detection method for screening antigen epitope thereof | |
| CN107216373B (en) | Antigen polypeptide pool for detecting mycobacterium tuberculosis infection and application thereof | |
| CN107011418B (en) | Antigen polypeptide pool for detecting mycobacterium tuberculosis infection and application thereof | |
| CN106248934B (en) | Antigen of mycobacterium tuberculosis albumen Rv0446c and its t cell epitope peptide application | |
| CN107141341B (en) | Antigen polypeptide pool for detecting mycobacterium tuberculosis infection and application | |
| CN106198971A (en) | The application of antigen of mycobacterium tuberculosis albumen Rv2351c | |
| CN105601747A (en) | Mycobacterium tuberculosis fusion protein and application thereof in induction of peripheral blood mononuclear cells to generate cytokines | |
| RU2607006C1 (en) | Test strain leptospira of interrogans serogroup icterohaemorrhagiae serovar copenhageni for detection of antibodies to l icterohaemorrhagiae | |
| CN106226520A (en) | Antigen of mycobacterium tuberculosis albumen Rv0865 and the application of B cell epitope peptide thereof | |
| CN106405107B (en) | Antigen of mycobacterium tuberculosis albumen Rv2941 and its t cell epitope peptide application | |
| CN105567660A (en) | Escherichia coli recombinate expression method of mycobacterium tuberculosis Rv 2837c active protein and applications thereof | |
| CN102279257B (en) | Kit used for diagnosing immune associated diseases of human or animals | |
| CN102924576A (en) | Helicobacter pylori immunodominance epitope peptide and preparation method and application thereof | |
| CN106248935B (en) | Antigen of mycobacterium tuberculosis albumen Rv1798 and its t cell epitope peptide application | |
| CN104805063A (en) | Mycobacterium tuberculosis latent infection related proteins, preparation and applications thereof | |
| CN106442983B (en) | The application of antigen of mycobacterium tuberculosis albumen Rv3793 and its t cell epitope peptide | |
| CN105759054A (en) | ELISPOT detection kit for detecting bovine brucellosis | |
| CN102516356A (en) | Epitope polypeptide applicable to mycobacterium tuberculosis infection detection and application thereof | |
| Agnone et al. | Timing of activation of CD4+ memory cells as a possible marker to establish the efficacy of vaccines against contagious agalactia in sheep | |
| WO2020208368A1 (en) | Diagnostic reagents | |
| CN106248936B (en) | The application of antigen of mycobacterium tuberculosis albumen Rv2201 and its t cell epitope peptide | |
| CN104151433A (en) | Mycobacterium tuberculosis fusion proteins and their preparation method and use | |
| CN103304646B (en) | Mycobacterium tuberculosis candidate antigen polypeptide and application thereof | |
| CN106397553B (en) | The application of antigen of mycobacterium tuberculosis albumen Rv0585c and its t cell epitope peptide | |
| CN106814195A (en) | For aiding in detection kit lungy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161207 |
|
| RJ01 | Rejection of invention patent application after publication |