CN101921325A

CN101921325A - Antigen capable of increasing CD4 + CD25 + Foxp3 + regulatory T cells and application thereof

Info

Publication number: CN101921325A
Application number: CN2010101331427A
Authority: CN
Inventors: 苏川; 周莎; 汪雪峰; 贺蕾; 刘丰
Original assignee: Nanjing Medical University
Current assignee: Nanjing University; Nanjing Medical University
Priority date: 2010-03-25
Filing date: 2010-03-25
Publication date: 2010-12-22
Anticipated expiration: 2030-03-25
Also published as: WO2011116655A1; CN101921325B

Abstract

The invention belongs to the immunology field, in particular to a proteantigen molecule-Japanese blood fluke heat shock protein 60KDa (SjHSP60) which is derived from a blood fluke and is capable of increasing CD4 + CD25 + Foxp3 + regulatory T cells and application thereof. The SjHSP60 has a full-length amino acid sequence as shown in SEQ.ID.NO.1, has a series of identical or highly similar cross-reactive T cell epitopes with HSP60 infected by a host. After being used for mouse in vivo immunization or in vitro stimulus to mouse spleen and lymph gland cells, the SjHSP60 can obviously increase CD4 + CD25 + Foxp3 + Tregs. In practical application, the SjHSP60 can effectively relieve inflammatory symptoms and immunopathological effects caused by arthritis, thereby having wide prospects in the aspects of immunological suppression inducement and treatment of immunological diseases.

Description

A kind of increase CD4 +CD25 +Foxp3 +The antigen of regulatory T cells and application thereof

Technical field

The invention belongs to field of immunology, be specifically related to a kind of increase CD4 ⁺CD25 ⁺Foxp3 ⁺Antigen molecule-Schistosoma japonicum heat shock protein(HSP) the 60KDa in the schistosomicide of regulatory T cells (Tregs) source (Schistosoma japonicum heatshock protein 60KDa, SjHSP60) and use.

Background technology

Before and after the eighties of last century the nineties, western developed country puts forward " health hypothesis ", think the developed country that improves greatly in hygienic condition, the sickness rate of some anaphylactic diseases and autoimmune disease greatly increases, and this is and developed country's sanitary condition improvement that the chance that pathogenic infection takes place the crowd reduces relevant (Wills-Karp, et al, Nat Rev Immunol, 2001,1:69-75).Thereafter several years, scientists proves by the Research of Animal Model for Study of some anaphylactic diseases and autoimmune disease, the chronic infection of some pathogenic agent can prevent the generation of these immunological diseases really or alleviate immunopathogenesis damage (Dunne, Nat Rev Immunol, 2005,5:420-426): can prevent or alleviate type i diabetes, experimental encephalitis, thyroiditis as schistosoma mansonii infection; Cestode infection can reduce the morbidity of experimental colitis; Streptococcal infection can suppress that collagen-induced type is arthritic to be developed, or the like.From the angle of evolutionary history, chronic infection be pathogenic agent and host long-term common evolve select each other after, the final formed a kind of equilibrium state all favourable to both sides.In this state, pathogenic agent can not removed fully by the host, but long-term existence is in the host; The host both can keep has certain resistibility to pathogenic agent, also can not produce the immunopathogenesis damage because of strong excessively immune response, but also prevent the generation of autoimmune disease.

Along with immunologic development, in immunity system, found the naturally occurring CD4 of a group ⁺CD25 ⁺Regulatory T cells (Tregs) (Sakaguchi, et al., J Immunol, 1995,155:1151-64), this group cell is mainly produced by thymus gland, participates in keeping tolerance of periphery autoimmunization and immune homeostasis; Found further afterwards that the infection of some pathogenic agent (virus, bacterium, parasite) also can be induced in periphery and be produced CD4 from the CD4+T cell ⁺CD25 ⁺Tregs (Bluestone and Abbas, Nat Rev Immunol, 2003,3:253-7).After infecting human body as hepatitis C virus (HCV), CD4 that can inducing specific ⁺CD25 ⁺Tregs (Bolacchi, et al., Clin Exp Immunol, 2006,144:188-96); Discover CD4 in the mouse bordetella pertussis infection model ⁺CD25 ⁺Tregs increase (McGuirk, et al., J Exp Med, 2002,195:221-31); During parasite type infects, in 4 weeks behind the schistosoma mansonii infection, find CD4 in the mesenteric lymph nodes ⁺CD25 ⁺Amplification has taken place in Tregs, gathers then and brings into play immunosuppressive effect (Wilson et al .unpublished observaton) in liver and the spleen.Further probe into and cause chronically infected pathogenic agent is how to induce regulatory T cells, thereby suppress immune attack, for improving host's resistance infection and treatment immunological disease meaning is all very great.Vermes in the parasite is that a class has the many cells eukaryote that complex biological is learned function, can be good at escaping host immune and attack, long-term existence in host's body (Maizels, et al., J ExpMed, 2009,206:2059-66).Schistosomicide is a kind of very typical chronic infection in the Vermes, discovers in its infection model, and its egg antigen is to stimulate to induce CD4 ⁺CD25 ⁺The key factor that Tregs produces (Baumgart, et al., JImmunol, 2006,176:5374-87); In addition, this seminar finds that also schistosoma japonice ovum antigen also can stimulate induces CD4 ⁺CD25 ⁺Thereby Tregs alleviate the airway inflammation reaction that asthma causes (Yang, et al., Immunology, 2006,120:8-18).

About the research of specific antigens at periphery induction of immunity negative regulation, at the more existing reports of autoimmunization research field, the autoreactivity of some autoantigen is after the feminine gender of having escaped the thymus gland maincenter is selected, they can also induce the autoreactivity regulatory T cells in periphery, thereby participate in immunoregulation.These autoantigens comprise: some tissue antigens (L-Glutamic decarboxylase GAD, oligodendrocyte albumen MOG, myosin etc.); Immunoregulation molecule (ubiquitin, interleukin, Actin muscle etc.); Stress protein (HSP40, HSP60, HSP70) (Merbl, et al., J Clin Invest, 2007,117:712-8).In fact, natural these antigenic antibody or the reaction-ive T cells that just exist of immunity system, or its specific acceptor (part), they can monitor body immune system constantly, keep immune homeostasis (Cohen, Nat Rev Immunol, 2007,7:569-74).In those early years just discover, people self HSP60 or its polypeptide can prevent or alleviate type i diabetes (Elias and Cohen, Diabetes, 1996,45:1168-72), and before 2 years, began to be applied to the clinical III phase and tested (Eldor, et al., DiabetesMetab Res Rev, 2009,25:316-20); Find by the rat assist agent arthritis model research, but also ameliorate osteoarthritis disease pathologic reaction of mouse self HSP60 (Durai, et al., J Autoimmun, 2009,33:208-13).And very specifically, HSP60 belongs to molecule family-heat-shock protein family the most conservative in the evolution, in all eucaryons and prokaryotic organism camber homology.Therefore, pathogenic agent utilizes this molecule to go to simulate the effect of host HSP60 possibly, and the induction of immunity regulation and control suppress host immune and attack, and keep chronic infection.If can identify and verify out " model molecule " in these pathogenic agent sources, not only can find and break chronically infected target, also can be applicable to prevention or treatment immunological disease.

Treatment for anaphylactic disease and autoimmune disease, directly suppressed the chemicals of immunne response behavior with some since for a long time clinically always, as hormones, perhaps combined utilization azathioprine (anti-thymus gland sphaeroprotein class medicine), (Bougneres, et al., Diabetes such as ciclosporin A, 1990,39:1264-72).In a single day but wherein not only price comparison is expensive for some medicine, can allow the patient produce insufferable side effect, and discontinues medication, autoimmune response can rebound immediately, and disease can be staged a comeback.And cheap purifying protein molecule, not only safety does not have toxic side effect, the more important thing is, and it is by himself regulatory mechanism of immunology approach deactivation, has fundamentally solved problem; Be compared to similar small peptide vaccine, aminoacid sequence is long and be difficult for being degraded, and has a plurality of epi-positions, can unite to play a role, and is easilier discerned by body immune system; In addition, the preparation of protein molecular generally all is by biological expression system (protokaryon or eukaryotic expression system), rather than biosynthesizing, and this helps to form proteinic senior space structure, can more effectively form the immunology epi-position.

(Schistosoma japonicum heat shock protein60KDa, SjHSP60) gene sequence number in Genebank is AY813151 to disclosed Schistosoma japonicum heat shock protein(HSP) 60KDa.

In a word, utilize the antigen in pathogenic agent source in the chronic infection, the special molecular of regulatory T cells is induced in searching, not only help identifying and cause the chronic infection principal element, thereby can improve host's resistance infection pointedly, and be applied to treat in further research and have more wide prospect aspect anaphylactic disease or the autoimmune disease.

Summary of the invention

The present invention aims to provide a kind of increase CD4 ⁺CD25 ⁺Foxp3 ⁺The albumen of regulatory T cells.

The said increase of the present invention CD4 ⁺CD25 ⁺Foxp3 ⁺The albumen of regulatory T cells is Schistosoma japonicum heat shock protein(HSP) 60KDa (SjHSP60), shown in its full length amino acid sequence SEQ.ID.NO.1, is made of 572 amino acid.

The said increase of the present invention CD4 ⁺CD25 ⁺Foxp3 ⁺The albumen of regulatory T cells also comprises the SjHSP60 that has lacked one section polypeptide, i.e. SjHSP60 (D), and the sequence of SjHSP60 (D) is made up of 548 amino acid shown in SEQ.ID.NO.3.

(sequence number is SjHSP60 gene among albumen shown in the SEQ.ID.NO.1 of the present invention and the Genebank: protein sequence AY813151) and incomplete same (consistence is 87%).But SEQ.ID.NO.1 respectively with other kind homologous protein in Schistosoma mansoni HSP60 (SmHSP60, Genebank number: AF310263) with human HSP60 (HomoHSP60, Genebank number: consistence BC003030) is higher, be respectively 92% and 72%, and the consistence of the protein sequence of AY813151 and SmHSP60 and HomoHSP60 is respectively 81% and 65%.This is the difference place of mono-clonal order-checking and large scale sequencing, and the present invention is the sequence of translating out through after " Primer walking " order-checking splicing, so more accurate.

The said Protein S jHSP60 of the present invention mainly increases CD4 by following two approach ⁺CD25 ⁺Foxp3 ⁺Tregs, thereby enhancing body immunosuppression power:

1. above-mentioned said protein induced CD4 ⁺CD25 ^-The T cell transformation is CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs;

2. above-mentioned said albumen directly makes CD4 ⁺CD25 ⁺Tregs increases;

The invention discloses SjHSP60 and SjHSP60 (D) as strengthening CD4 ⁺CD25 ⁺Foxp3 ⁺The application of the immunosuppressor of regulatory T cells retarding effect.

The invention discloses SjHSP60 and SjHSP60 (D) application in the diseases associated with inflammation medicine that preparation treatment immune response causes.Particularly inflammatory symptoms due to the anti-curing arthritis of preparation and the application in the immunopathogenesis medicine.

Said SjHSP60 of the present invention and SjHSP60 (D) albumen make the CD4 after the amplification ⁺CD25 ⁺The immunosuppression power of Tregs strengthens.

The said albumen of the present invention is applied to have in the experimental inflammatory animal model effect that suppresses inflammatory symptoms and immunopathogenesis reaction, has more wide application prospect aspect the treatment immunological disease.

Description of drawings

Fig. 1 SjHSP60 sequence homology compare of analysis, natural expression analysis.

The full length amino acid sequence of A SjHSP60 carries out sequence alignment with host's (people, mouse) HSP60;

The natural expression of B SjHSP60 in polypide;

The intercrossing t cell epitope of table 1SjHSP60 and host (people, mouse) self HSP60 is analyzed.

Fig. 2 SjHSP60 increases CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs.

A immune mouse in the SjHSP60 body, CD4 in mice spleen and the lymphoglandula ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio significantly increases;

B detects CD4 in mice spleen and the lymphoglandula with immune mouse in the SjHSP60 body ⁺CD25 ⁺Foxp3 ⁺The Flow cytometry figure of Tregs ratio;

C SjHSP60 extracorporeal treatment mice spleen and lymph-node cell, CD4 ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio all increases;

D detects CD4 with SjHSP60 extracorporeal treatment mice spleen and lymph-node cell ⁺CD25 ⁺Foxp3 ⁺The Flow cytometry figure of Tregs ratio;

Fig. 3 SjHSP60 alleviates CIA (collagen induced arthritis) mouse inflammatory symptoms and pathology damage.

Immunity can alleviate CIA mouse arthritis symptom in the A SjHSP60 body;

Immunity can alleviate CIA mouse ankle swelling degree in the B SjHSP60 body;

Immunity can alleviate periarticular soft tissues swelling of CIA mouse and osteoarthrosis infringement in the C SjHSP60 body;

Immunity can alleviate the inflammation pathologic reaction of CIA mouse joint and surrounding soft tissue thereof in the D SjHSP60 body;

Fig. 4 SjHSP60 increases CIA mouse CD4 ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio, inflammation-inhibiting antigen (CollagenII, specificity humoral CII) and cellullar immunologic response.

Immune CIA mouse in the A SjHSP60 body, CD4 in mice spleen and the lymphoglandula ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio significantly increases;

Immune CIA mouse in the B SjHSP60 body detects CD4 in mice spleen and the lymphoglandula ⁺CD25 ⁺Foxp3 ⁺The Flow cytometry figure of Tregs ratio;

After the immunity, the specific humoral immune response level at inflammation antigens c II in the CIA mouse body obviously reduces in the C SjHSP60 body;

After the immunity, the specificity cellular immunity response level at inflammation antigens c II in the CIA mouse body obviously reduces in the D SjHSP60 body:

Fig. 5 HSP60 increases CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs can be by inducing CD4 ⁺CD25 ^-T is converted into CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs.

A handles mouse CD4 with SjHSP60 ⁺T, CD4 ⁺CD25 ^-The T cell, SjHSP60 induces CD4 ⁺CD25 ^-T is converted into CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs;

B handles mouse CD4 with SjHSP60 ⁺T, CD4 ⁺CD25 ^-The T cell, SjHSP60 induces CD4 ⁺CD25 ^-T is converted into CD4 ⁺CD25 ⁺Foxp3 ⁺The Flow cytometry figure of Tregs;

Fig. 6 SjHSP60 increases CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs can be by the CD4 that directly increases ⁺CD25 ⁺Tregs, and the CD4 after the amplification ⁺CD25 ⁺Tregs immunosuppression power is stronger.

The A SjHSP60 CD4 that directly increases ⁺CD25 ⁺Tregs;

CD4 after the B amplification ⁺CD25 ⁺Tregs has stronger immunosuppression power;

Fig. 7: SjHSP60 (D) still can significantly increase CD4 ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.

The prediction and the analysis of the protein steric structure of A SjHSP60 and function of surface residue (protein-protein action site);

It is overlapping and lacked two PCR products of SJMHE1 that B has obtained shank by twice PCR;

C has obtained the SjHSP60 (D) of disappearance SJMHE1 by PCR for the third time;

D immune mouse in SjHSP60 (D) body, CD4 in mice spleen and the lymphoglandula ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio significantly increases;

E detects CD4 in mice spleen and the lymphoglandula with immune mouse in SjHSP60 (D) body ⁺CD25 ⁺Foxp3 ⁺The Flow cytometry figure of Tregs ratio;

F SjHSP60 (D) extracorporeal treatment mice spleen and lymph-node cell, CD4 ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio significantly increases;

G detects CD4 with SjHSP60 (D) extracorporeal treatment mice spleen and lymph-node cell ⁺CD25 ⁺Foxp3 ⁺The Flow cytometry figure of Tregs ratio;

Fig. 8: remove one section polypeptide (the 435th to the 458th amino acid, design of primers method SJMHE1) and three step PCR synoptic diagram in the SjHSP60 full length sequence.

Embodiment:

Employed in the present invention term unless other explanation is arranged, generally has the implication of those of ordinary skills' common sense.

Below in conjunction with concrete preparation embodiment and Application Example, and comparable data is described the present invention in further detail.Be interpreted as: these embodiment are in order to demonstrate the invention, but not limit the scope of the invention by any way.

In following embodiment, various processes of Xiang Ximiaoshuing and method are not ordinary methods as known in the art.The source of agents useful for same, trade(brand)name and be necessary to list its moiety person indicate when occurring first that all used thereafter identical reagent if no special instructions, and is all identical with the content of indicating first.

Expression vector pGEX-6p-1 mentioned in the embodiment of the invention can buy (article No.: 28-9546-48) from GE Healthcare company.

The total cDNA of Schistosoma japonicum obtains: schistosoma japonicum infection oncomelania (positive oncomelania) is available from Jiangsu Prov. Bilharziasis Prevention and Control Inst..Infectious oncomelania can discharge have infective cercaria (one of Schistosoma japonicum etap, this stage has infectivity) thus be used for the experimental mouse of challenge infection.Cercaria can continue to grow in the mouse body and is virgin worm then, and final the growth is Schistosoma japonicum adult, resides in the portal system of mouse.After cuing open extremely mouse, can take out adult by perfusion mouse portal system, thereby can be used for the total RNA of extracting Schistosoma japonicum, last another mistake is transcribed into the total cDNA of Schistosoma japonicum.

Embodiment one: the sequence alignment analysis of SjHSP60 homology, intercrossing epitope analysis, and the detection of natural expression.

1, (sequence number is: AY813151) full length cDNA sequence according to SjHSP60 gene among the Genebank, design primer: upstream primer is 5 '-cgcggatcccaaccggtgacaatgttacgag-3 ' (containing BamHI restriction enzyme site and initiation codon word ATG) in advance, downstream primer is 5 '-ccgctcgagattaagagcaggcagtgtttac-3 ' (containing XholI restriction enzyme site and terminator codon TAA), and is synthetic by the English Weihe River, Shanghai Jie Ji trade Co., Ltd (Invitrogen); By the PCR method SjHSP60ORF full length sequence that from the total cDNA of Schistosoma japonicum, increases, send biotech company (the English Weihe River, Shanghai Jie Ji trade Co., Ltd, Invitrogen) order-checking, and reclaim the PCR product; Sequencing result shown in SEQ.ID.NO.2, again by online biology instrument Biology WorkBench ( Http:// workbench.sdsc.edu/) it is translated into aminoacid sequence; And carry out sequence alignment with the HSP60 of people and mouse (gene order number is respectively among the Genebank: people HSP60-BC003030, mouse HSP60-NM010477).

The full length sequence of SjHSP60 open reading frame ORF shown in SEQ.ID.NO.2, is total to 1719bp.

Aminoacid sequence after the full length sequence translation of SjHSP60 open reading frame ORF is shown in SEQ.ID.NO.1, totally 572 amino acid.

2, the online epi-position forecasting software of integrated application: IEDB (http://tools.immuneepitope.org/main/index.html), SYFPEITHI (http://www.syfpeithi.de/home.htm) analyze SjHSP60 respectively with people HSP60, the intercrossing t cell epitope of mouse HSP60.

3, with BamHI (NEB, #R3136V) and XholI (NEB, #R0146V) PCR product of plasmid pGEX-6P-1 and this being gone up (1) middle recovery carries out double digestion; Enzyme is cut product after agarose gel electrophoresis carries out isolation identification, and plasmid and the pulsating double digestion product of PCR are reclaimed in rubber tapping respectively again; (NEB #M0202S) carries out being connected of carrier and PCR product, makes up recombinant expression vector pGEX-SjHSP60 by the T4DNA ligase enzyme; Transformed E .coli BL21 competent cell, after 37 ℃ of overnight incubation, picking mono-clonal bacterium colony is inoculated in the LB nutrient solution that contains Amp, and after 37 ℃ of jolting overnight incubation, the row double digestion is identified behind the extracting plasmid, further send order-checking company to identify.After identifying successfully, bacterium liquid is carried out 1: 100 enlarged culturing, when the OD value reached 0.6-0.8, adding IPTG, to make its final concentration be 0.05mmol/L, 37 ℃ of abduction delivering 5h; Collect bacterium liquid, 4 ℃ of high speed centrifugation 20min are with the resuspended bacterial precipitation of 1 * PBS; Split bacterium by Ultrasonic Cell Disruptor and multigelation method; 4 ℃ of high speed centrifugation 20min get cleer and peaceful precipitation respectively once more, and uncracked total protein carries out proteic expression amount of SDS-PAGE electrophoretic analysis and distribution situation; After being accredited as solubility expression, by fusion rotein GST affinity chromatography, (GE Healthcare 17-0751-01) carries out the purifying of fusion rotein GST-SjHSP60 with Glutathione Sepharose 4B; And use protease P reScission ^TMProtease (GE Healthcare, 270843) carries out enzyme to fusion rotein and cuts, and obtains the SjHSP60 of purifying at last; Through SDS-PAGE electrophoretic analysis purification result, purity＞95%.The SjHSP60 of purifying transfers to Shanghai Chinese Academy of Sciences English and washes one's hair the monoclonal antibody (anti-SjHSP60mAb) that bio tech ltd prepares anti-SjHSP60.The adult (SWA) and the egg antigen (SEA) of preparation solubility are by specificity and the antibody titer of Weatern Blot experiment detection anti-SjHSP60mAb; After being proved to be successful, use anti-SjHSP60mAb again,, detect natural expression and the distribution situation of SjHSP60 in Schistosoma japonicum adult (female worm and male worm) and the worm's ovum by immunohistochemical method.

The result has the homology of height on SjHSP60 and people, the mouse HSP60 sequence shown in Fig. 1 and table 1, the consistence of sequence reaches 72% and 70% respectively; After the t cell epitope prediction, find SjHSP60, with people HSP60,, all have series of identical or highly similar MHCI and mhc class ii intercrossing t cell epitope with mouse HSP60.

Table 1

Embodiment two: immune mouse or stimulated in vitro mouse lymphocyte in the SjHSP60 body, observe SjHSP60 to CD4 ⁺CD25 ⁺Foxp3 ⁺The influence of Tregs.

1. with the SjHSP60 of purifying among the embodiment one (3), bacteriological filtration also passes through Polymyxin B-Agarose (Sigma, P1411) removal toxoid and associated molecule thereof wherein, and then by Limulus amebocyte lysate (LAL) detection kit E-TOXATE Kits (Sigma, ET0200), the endotoxin removal effect of checking purifying protein,＜0.001FU/ml (0.1pg/ml), (BIA-RAD 500-0111) carries out protein quantification to use DC Protein Assay at last.With SjHSP60 and incomplete Freund's adjuvant IFA (Sigma, F5501) equal-volume mixes, making SjHSP60 concentration is 250ug/ml, repeatedly the outstanding vibration in whirlpool mixing.To BALB/c mouse (the SPF level, age in 6-8 week, female, available from Shanghai Slac Experimental Animal Co., Ltd.) carry out the subcutaneous immunity of inguinal region, dosage is 25ug/100ul/, after the first immunisation, every the same again immunity of two weeks once, establishing the PBS immune group is control group.Whole process mouse is raised in SPF level Animal House (Nanjing Medical University's Experimental Animal Center).Last is immune to finish one week of back, cuts open mouse extremely, separates spleen and the lymphoglandula of respectively organizing mouse, and grinding is prepared into single cell suspension after filtering; Remove red corpuscle through erythrocyte cracked liquid again, be prepared into single lymphocyte suspension; After carrying out cell counting, every mouse of each group is got 1 * 10 ⁶Individual cell, (eBioscience, 88-8111-40) process specifications carries out lymphocytic dye marker, detects CD4 through flow cytometer FACSCalibur again to press MouseRegulatory T Cell Staining Kit ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.

2. the spleen and the lymphoglandula that separate normal BALB/c mouse by method in (1) on this, are prepared into single lymphocyte suspension; After the cell counting, be transferred to culture plate at the bottom of 96 hole circles respectively, 5 * 10 ⁵Individual cells/well; Dividing three groups to stimulate again, is respectively SjHSP60 group (0.1ug/ml)/PBS group/non-stimulated (Medium) group, establishes 4 holes for every group; At 37 ℃, 5%CO ₂The cell incubator was cultivated after 3 days, and collection is respectively organized cell and counted, and gets 1 * 10 for every group ⁶Individual cell is herewith gone up method detection CD4 in (1) ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.

The result as shown in Figure 2, experiment in vivo and vitro proves that all SjHSP60 can increase CD4 ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.

Embodiment three: probe into can SjHSP60 bring into play inflammation-inhibiting and immunopathogenesis reaction in inflammatory model effect.

1. press methods among the embodiment two (1), divide two groups: SjHSP60 group/PBS group, immune DBA1 mouse in the body (country of Nanjing University genetic engineering mouse resources bank, 6-8 all ages, female).Set up collagen-induced type sacroiliitis (CIA) mouse model: mixed bull source II Collagen Type VI (CII) Bovine Collagen Type II (BD, 354257) and Mycobacteriumtuberculosis H37RA (Difco, 3114), dilute with 1 * PBS, make both concentration be respectively 2mg/ml, 3mg/ml; In mixed system, add isopyknic incomplete Freund's adjuvant CFA again, mixing 2min on the outstanding shaker in whirlpool, 6-8 time repeatedly, every 30min once; A week behind first immunisation SjHSP60/PBS, induce CIA at two groups of subcutaneous immune hybrid antigens of mouse tail, 100ul/ is only.Induce one week of back, two groups of mouse are distinguished immune SjHSP60/PBS once again.Induce 4 weeks of back, begin to dynamic observe two groups of mouse arthritis disease performances, every other day once; Carry out the inflammatory symptoms severity scale by following standard:

0 minute: normal, asymptomatic;

1 minute: erythema, have only the slight swelling of ankle joint;

2 minutes: erythema, from the ankle joint to the metatarsal, the slight swelling of metacarpophalangeal joint;

3 minutes: erythema, from ankle joint to the swelling of metacarpophalangeal joint moderate;

4 minutes: erythema, from ankle joint to the finger tip serious swelling;

Every side limbs best result is 4 minutes, minimumly is divided into 0 fen; Every mouse PTS is up to 16 fens, and minimum is 0 minute.

2. go up (1) middle observing time therewith and put synchronously, use electronic digital display vernier callipers (available from Wenzhou three and measurer Instr Ltd.) to measure and respectively organize mouse left hind ankle joint diameter.

3. induce the back to cut open in 7 weeks extremely and respectively organize mouse, get and respectively organize the mouse fore paw and be fixed among the 1 * PBS that contains 10% formalin, send sample to Rui Jin, Shanghai hospital injury of the bone research institute to carry out X-ray check.

4.X light continues sample to be fixed among the 1 * PBS that contains 10% formalin after detecting, and transfers to Jiangsu Prov. People's Hospital Pathology Deparment and carries out sample decalcification, paraffin embedding, section and pathology HE dyeing; Microscopically is observed the HE pathological examination.

The result as shown in Figure 3, the CIA mouse of SjHSP60 immune group, the inflammatory symptoms in its joint, the swollen joint expansibility, joint damage degree and pathology inflammatory reaction all significantly alleviate.

Experimental example four: can observe SjHSP60 increase CIA mouse CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs, thereby performance immunosuppressive action.

1. separation of C IA induces back 3W and each group (HSP60 group/PBS group) mice spleen and lymphoglandula of 7W, presses method among the embodiment two (1), detects and respectively organizes mouse CD4 ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.

Cut open kill respectively organize mouse in (1) on this before, to each group mouse blood sampling, and isolate serum; Again through ELISA detect respectively organize CII specific antibody in the serum (IgG1), concrete operations are for IgG, IgG2a: wrap in advance by CII with the high-affinity enzyme plate, 5ug/ml, 4 ℃ of bags are spent the night; Discard coating buffer, PBS-T washes plate 2-3 time; 5% skimmed milk seals, and hatched 2 hours for 37 ℃ in the 200ul/ hole; Discard confining liquid, PBS-T washes plate 2-3 time; After dilution in 1: 20 is respectively organized serum, add enzyme plate, 100ul/ hole, 4 ℃ of overnight incubation; Discard serum, PBS-T washes plate 3-4 time; Adding two after diluting resists: HRP anti-mouse IgG (Boster, BA1050) dilution in 1: 10000, HRP anti-mouse IgG2a (BD, 553391) and HRP anti-mouse IgG1 (BD, 559626) dilution in equal 1: 1000, hatched 1 hour for 37 ℃ in the 100ul/ hole; Discard two and resist, PBS-T washes plate 4-5 time; (eBioscience 00-4201-56), after the room temperature lucifuge is placed 10-15min, adds 2N H to add TMB colour developing liquid ₂SO ₄Termination reaction, the 100ul/ hole; Value of reading on microplate reader at last.

3. get the lymphocyte of respectively organizing every mouse that obtains after separating in (1) on this, be transferred to 96 hole circle floor cells culture plates respectively, 4 * 10 ⁵Individual/hole, every mouse is established 9 holes, respectively is divided into three groups of processing: Medium group (not stimulating)/ConA stimulating group (2ug/ml)/CII stimulating group (5ug/ml) again, 3 hole/groups; Press method among the embodiment four (5), by ³The H method of mixing detects respectively organizes the lymphopoiesis situation: be cultured to 56 hours, adding tritium thymus pyrimidine ( ³H-thymidine, ³H-TDR), 0.5 μ Ci/ hole; After continue cultivating 16 hours (amount to and cultivated 3 days), detect cell through the Beckman liquid scintillation counter ³H-TDR mixes situation, thereby reflects the specific cellullar immunologic response level of CII.

The result as shown in Figure 4, SjHSP60 makes CD4 in the CIA model mice body ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio significantly increases; Further experiment also proves at specific body fluid of C II and cellullar immunologic response obvious suppression is arranged all.

Embodiment five: the external mouse CD4 that stimulates respectively of SjHSP60 ⁺The T cell, CD4 ⁺CD25 ^-The T cell, how further observe SjHSP60 increases CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs.

Separate normal BALB/c mouse spleen and lymphoglandula, be prepared into single lymphocyte suspension; Use test kit CD4 ⁺(MACS 130-090-860) sub-elects CD4 to T cellIsolation Kit ⁺The T cell; Remaining CD4 ^-Lymphocyte is through the 50ug/ml mitomycin, and 37 ℃, 5%CO ₂After handling 30min, use as antigen presenting cell (APC).Get portion C D4 again ⁺The T cell is further used CD4 again ⁺CD25 ⁺(MACS 130-091-041) removes CD4 to Regulatory T Cell Isolation Kit ⁺CD25 ⁺Tregs, thus isolate CD4 ⁺CD25 ^-The T cell.Concrete sorting step is all with reference to product description.By Flow cytometry CD4 ⁺T cell and CD4 ⁺CD25 ^-The T cell purity, purity difference＞90% and＞95%.Two kinds of cells are shifted culture plate at the bottom of 96 hole circles, 2 * 10 respectively ⁵Individual cells/well adds APC, 2 * 10 again ⁵Individual/hole; CD4 ⁺T cell and CD4 ⁺CD25 ^-The T cell divides two groups of processing more separately, stimulating group (SjHSP60,0.1ug/ml)/not treatment group (Medium); At 37 ℃, 5%CO ₂The cell incubator was cultivated after 3 days, collected and respectively organized cell and counting; Get 1 * 10 for every group ⁶Individual cell, Flow cytometry CD4 ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.But relevant concrete grammar reference example two (1) in this example.

The result as shown in Figure 5, SjHSP60 increases CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs can be by inducing CD4 ⁺CD25 ^-The T cell transformation.

Embodiment six: observing SjHSP60 increases CD4 ⁺CD25 ⁺Foxp3 ⁺Whether Tregs can be by the CD4 that directly increases ⁺CD25 ⁺Tregs, the CD4 after the amplification ⁺CD25 ⁺Tregs immunosuppression power how.

1. separate the spleen and the lymphoglandula of normal BALB/c mouse by method among the embodiment two (2), be prepared into single lymphocyte suspension; Use CD4 ⁺CD25 ⁺Regulatory T Cell Isolation Kit step to specifications sub-elects CD4 ⁺CD25 ⁺Tregs.With reference to method among the embodiment five, Flow cytometry CD4 ⁺CD25 ⁺The cell purity of Tregs, purity＞95%.Shift CD4 ⁺CD25 ⁺Tregs to 96 hole circle floor cells culture plate, 2 * 10 ⁵Individual cells/well; Divide three groups of processing: anti-CD3 (BD, 553057) stimulating group (1ug/ml)/SjHSP60 stimulating group (0.5ug/ml)/SjHSP60 (0.5ug/ml)+anti-CD3 (1ug/ml) stimulating group again, be 5 hole/groups.Press method among the embodiment four (3), by ³The H method of mixing detects respectively organizes CD4 ⁺CD25 ⁺The propagation situation of Tregs.

2. by concrete grammar sorting and stimulation process CD4 in (1) on this ⁺CD25 ⁺Tregs cultivated after 3 days, collected and counting; Be transferred to 96 hole circle floor cells culture plates, 1 * 10 ⁵Individual/hole, 4 hole/groups.Press the normal BALB/C mice CD4 of method sorting among the embodiment five again ^-Cell (using) and CD4 as APC ⁺CD25 ^-The T cell adds every hole CD4 respectively ⁺CD25 ⁺Tregs, 1 * 10 ⁵Individual/hole.After cultivating 3 days altogether, press method among the embodiment four (3) equally, by ³The H method of mixing detects respectively organizes CD4 ⁺The propagation situation of CD25-T cell, and then CD4 is respectively organized in reflection ⁺CD25 ⁺The restraint of Tregs.

The result as shown in Figure 6, SjHSP60 also can be by the CD4 that directly increases ⁺CD25 ⁺Tregs increases CD4 ⁺CD25 ⁺Foxp3 ⁺Tregs; And the CD4 after the amplification ⁺CD25 ⁺Tregs has stronger immunosuppression power.

Embodiment seven: whether behind the 435th to the 458th amino acid whose polypeptide (SJMHE1), obtain SjHSP60 (D) in the removal SjHSP60 full length sequence, observing SjHSP60 (D) can also increase mouse CD4 ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.

1. be applied in linear protein matter 26S Proteasome Structure and Function forecasting software Phyre server (http://www.sbg.bio.ic.ac.uk/phyre/), the space structure and the function of surface residue (protein-protein action site) of prediction SjHSP60 protein molecular.

2. press design primer shown in Figure 8 in the accompanying drawing:

P1(5’-3’)：cgcggatcccaaccggtgacaatgttacgag

P2(5’-3’)：cacacctgttcgctgtatgccttcctcaattgct

P3(5’-3’)：attgaggaaggcatacagcgaacaggtgtgcg

P4(5’-3’)：ccgctcgagattaagagcaggcagtgttta

Recombinant expression vector pGEX-SjHSP60 with structure among the embodiment one (3) is a template: be that the upstream and downstream primer carries out PCR I with P1/P2; Carry out PCRII with P3/P4 for the upstream and downstream primer; After the twice PCR, two PCR products that obtained disappearance SJMHE1 and overlapped.

3. waiting mole to mix (2) middle PCR I and PCRII product (mass ratio is approximately 3.5: 1) on this, as template, is the upstream and downstream primer with P1/P4, carries out PCRIII, has obtained the SjHSP60 (D) of disappearance SJMHE1, altogether 1816bp.The aminoacid sequence that its full length cDNA sequence and process are translated out is respectively shown in SEQ.ID.NO.4 and the SEQ.ID.NO.3.

4. reclaim (3) middle PCR III product on this; Press method among the embodiment one (3), make up recombinant expression vector pGEX-SjHSP60 (D) with PCR III product that reclaims and pGEX-6P-1; Abduction delivering and purifying SjHSP60 (D); Carry out endotoxic removal and quantitative verification again, carry out protein quantification at last.Press concrete grammar among the embodiment two (1), with the normal BALB/c mouse of immunity in SjHSP60 (D) and polypeptide SJMHE1 (it is synthetic to give birth to worker company by Shanghai, purity＞99%, sequence is shown in the SEQ.ID.NO.5) body, if the PBS immune group is a control group, detects and respectively organize CD4 in mice spleen and the lymphoglandula ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.

5. press method among the embodiment two (2),, detect and respectively organize CD4 in mice spleen and the lymphoglandula with the spleen and the lymph-node cell of SjHSP60 (D)/normal BALB/c mouse of polypeptide SJMHE1/PBS stimulated in vitro ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.

The result finds that through software prediction except SJMHE1, also there is some other functional residue (protein-protein action site) in the three-D space structure surface of SjHSP60 as shown in Figure 7; Further experiment in vivo and vitro proves, the SjHSP60 (D) of disappearance SJMHE1 still can increase CD4 in mice spleen and the lymphoglandula ⁺CD25 ⁺Foxp3 ⁺The Tregs ratio.In conjunction with Fig. 2 analysis, can find: compare with SJMHE1, immune mouse (in vivo) increases CD4 in SjHSP60 and SjHSP60 (D) body ⁺CD25 ⁺Foxp3 ⁺The ability of Tregs ratio is stronger; And stimulated in vitro lymphocyte (in vitro), SJMHE1, SjHSP60 and SjHSP60 (D) three increases CD4 ⁺CD25 ⁺Foxp3 ⁺The ability no significant difference of Tregs ratio.

The invention is not restricted to these disclosed example approach, the present invention will cover the scope described in the patent book, and the various modification of claim scope and equivalence variation.

SEQUENCE?LISTING

＜110〉Nanjing Medical University

＜120〉a kind of increase CD4 ⁺CD25 ⁺Foxp3 ⁺The antigen of regulatory T cells and application thereof

<130>

<160>5

<170>PatentIn?version?3.3

<210>1

<211>572

<212>PRT

<213>Schistosoma?japonicum

<400>1

Met?Leu?Arg?Ala?Leu?Ser?Ser?Leu?Arg?Gly?Ser?Leu?Val?Pro?Ala?Arg

1 5 10 15

Gln?Lys?Val?Val?Gln?Arg?Phe?Tyr?Ala?Lys?Glu?Val?Lys?Phe?Gly?Ala

20 25 30

Asp?Ala?Arg?Ser?Ala?Met?Leu?Ile?Gly?Val?Asp?Val?Leu?Ala?Asp?Ala

35 40 45

Val?Ala?Val?Thr?Met?Gly?Pro?Lys?Gly?Arg?Asn?Val?Ile?Ile?Glu?Ser

50 55 60

Ser?Trp?Lys?Ser?Pro?Lys?Ile?Thr?Lys?Asp?Gly?Val?Thr?Val?Ala?Lys

65 70 75 80

Gly?Ile?Glu?Leu?Lys?Asp?Lys?Phe?Gln?Asn?Ile?Gly?Ala?Lys?Leu?Val

85 90 95

Gln?Asp?Val?Ala?Asn?Asn?Thr?Asn?Glu?Glu?Ala?Gly?Asp?Gly?Thr?Thr

100 105 110

Thr?Ala?Thr?Val?Leu?Ala?Arg?Ala?Ile?Ala?Lys?Glu?Gly?Phe?Glu?Lys

115 120 125

Ile?Ser?Lys?Gly?Ala?Asn?Pro?Ile?Glu?Phe?Arg?Arg?Gly?Val?Met?Leu

130 135 140

Ala?Val?Asp?Ala?Val?Val?Lys?Glu?Leu?Lys?Ser?Phe?Ser?Lys?Gln?Ile

145 150 155 160

Ser?Thr?Pro?Glu?Glu?Ile?Ala?Gln?Val?Ala?Thr?Ile?Ser?Ala?Asn?Gly

165 170 175

Asp?Lys?Ala?Ile?Gly?Asp?Leu?Ile?Ala?Ser?Ala?Met?Lys?Arg?Val?Gly

180 185 190

Asn?Asp?Gly?Thr?Ile?Thr?Val?Lys?Asp?Gly?Lys?Thr?Leu?His?Asp?Glu

195 200 205

Leu?Glu?Phe?Ile?Glu?Gly?Met?Lys?Phe?Asp?Arg?Gly?Tyr?Ile?Ser?Pro

210 215 220

Tyr?Phe?Ile?Asn?Thr?Glu?Lys?Gly?Ala?Arg?Cys?Glu?Phe?Gln?Asp?Ala

225 230 235 240

PheIle?Leu?Phe?Ser?Glu?Lys?Lys?Ile?Asn?Ser?Ile?Gln?Thr?Leu?Leu

245 250 255

Pro?Ala?Leu?Glu?Leu?Cys?His?Gln?Gln?Lys?Arg?Pro?Leu?Leu?Ile?Ile

260 265 270

Ala?Glu?Asp?Val?Glu?Gly?Glu?Ala?Leu?Thr?Ala?Leu?Val?Leu?Asn?Arg

275 280 285

Leu?Lys?Leu?Gly?Leu?Gln?Val?Cys?Ala?Val?Lys?Ala?Pro?Gly?Phe?Gly

290 295 300

Asp?Asn?Arg?Lys?Asn?Thr?Leu?Lys?Asp?Met?Ala?Val?Ala?Thr?Gly?Gly

305 310 315 320

Ile?Val?Phe?Gly?Asp?Glu?Ala?Asp?Met?Tyr?Lys?Leu?Glu?Asp?Val?Gln

325 330 335

Leu?Gln?Asp?Leu?Gly?Arg?Val?Ser?Glu?Ala?Val?Ile?Thr?Lys?Asp?Asp

340 345 350

Cys?Leu?Leu?Met?Arg?Gly?Arg?Gly?Asn?Lys?Met?Asp?Ile?Asp?Lys?Arg

355 360 365

Ile?Ala?Gln?Ile?Lys?Asp?Glu?Met?Glu?Ala?Ser?Asn?Ser?Glu?Tyr?Glu

370 375 380

Lys?Glu?Lys?Met?His?Glu?Arg?Leu?Ala?Lys?Leu?Ser?Asn?Gly?Val?Ala

385 390 395 400

Val?Ile?Lys?Val?Gly?Gly?Ser?Ser?Glu?Val?Glu?Val?Ser?Glu?Lys?Lys

405 410 415

Asp?Arg?Tyr?Thr?Asp?Ala?Leu?Asn?Ala?Thr?Arg?Ala?Ala?Ile?Glu?Glu

420 425 430

Gly?Ile?Val?Pro?Gly?Gly?Gly?Thr?Ala?Leu?Leu?Arg?Cys?Ile?Pro?Val

435 440 445

Leu?Asp?Thr?Leu?Ser?Thr?Lys?Asn?Glu?Asp?Gln?Arg?Thr?Gly?Val?Arg

450 455 460

Ile?Val?Leu?Arg?Ala?Leu?Ser?Thr?Pro?Cys?Tyr?Thr?Ile?Ala?His?Asn

465 470 475 480

Ala?Gly?Val?Asn?Ala?Ser?Val?Val?Val?Glu?Lys?Val?Lys?Gly?Met?Ser

485 490 495

Gln?Asn?Met?Gly?Tyr?Asp?Ala?Gln?Asn?Asp?Val?Tyr?Val?Asp?Met?Ile

500 505 510

Glu?Ala?Gly?Ile?Ile?Asp?Pro?Thr?Lys?Val?Val?Arg?Thr?Ala?Leu?Val

515 520 525

Asp?Ala?Ala?Gly?Val?Ala?Ser?Leu?Leu?Thr?Thr?Ala?Glu?Thr?Val?Val

530 535 540

Thr?Asp?Leu?Pro?Lys?Glu?Glu?Thr?Gly?Gly?Asn?Ala?Ala?Gly?Met?Gly

545 550 555 560

Gly?Met?Gly?Gly?Met?Gly?Gly?Met?Gly?Gly?Met?Met

565 570

<210>2

<211>1719

<212>DNA

<213>Schistosoma?japonicum

<400>2

atgttacgag?ctctaagttc?acttcgtggt?agtttggttc?cagctagaca?aaaagttgtt 60

caaaggtttt?atgcaaagga?agtgaagttc?ggggctgacg?caagatcagc?tatgttgatt 120

ggtgttgatg?tactggcgga?tgctgttgca?gtcaccatgg?gccctaaagg?tcgtaacgta 180

ataatagaaa?gctcgtggaa?atctccaaaa?atcacaaaag?atggggttac?tgttgccaaa 240

ggtattgagc?tgaaggataa?gttccagaat?attggggcta?agttagtaca?ggacgttgct 300

aacaacacca?acgaagaggc?tggggatggt?actacaacag?ccactgtttt?agcgcgagct 360

atagctaaag?agggttttga?aaagataagt?aaaggcgcta?atcctatcga?gttccgaaga 420

ggtgttatgc?ttgctgttga?tgctgttgtc?aaagagctca?aatctttttc?gaagcaaata 480

tccacaccag?aagagatagc?acaagttgcg?acaatatccg?ctaacggtga?caaggctatt 540

ggcgacctaa?tcgcttcagc?tatgaagagg?gttgggaatg?atggcacgat?aactgttaag 600

gatggcaaaa?ctcttcacga?tgagttggag?tttatcgaag?gtatgaaatt?cgaccgtggt 660

tatatctctc?catattttat?caacactgag?aaaggagccc?gatgtgaatt?ccaagatgcc 720

ttcatattgt?tttctgaaaa?aaagataaac?agcattcaga?cattattacc?agctctcgaa 780

ctatgccacc?aacaaaaacg?gccgctgctg?attatcgccg?aggatgttga?aggtgaagct 840

cttacagcac?ttgtactaaa?tcgcttaaaa?ctgggcttgc?aggtctgtgc?agtcaaagca 900

ccaggttttg?gggataatcg?caaaaataca?ttaaaagata?tggctgtagc?aacaggtggt 960

atagtgttcg?gtgacgaagc?agatatgtac?aagttagagg?atgtacaact?gcaagatctg 1020

ggacgtgtgt?cagaagctgt?aataacaaaa?gacgattgtt?tactaatgcg?aggtcgtgga 1080

aacaaaatgg?acatcgacaa?acgtatcgca?caaattaaag?atgaaatgga?agcctccaac 1140

agcgagtatg?aaaaagaaaa?aatgcacgaa?cgcttggcca?agttgtcaaa?cggcgtcgca 1200

gtaattaagg?ttggtggaag?tagtgaagta?gaagttagtg?agaaaaagga?tcgatatact 1260

gatgcactca?atgcaacgag?agcagcaatt?gaggaaggca?tagtgcctgg?tggtggcact 1320

gctttgctgc?gatgcattcc?tgtcctggat?acgttatcta?ccaagaacga?agatcagcga 1380

acaggtgtgc?ggattgttct?acgtgcactt?tcaactccgt?gctataccat?tgcacataac 1440

gcaggtgtca?acgcctctgt?tgtcgttgaa?aaagtcaaag?gtatgagcca?gaatatgggt 1500

tacgatgctc?aaaatgatgt?ttacgttgat?atgatcgagg?ctggaattat?tgacccaact 1560

aaggtcgtta?gaactgcatt?ggttgatgca?gctggtgttg?cttccttact?cacaactgca 1620

gaaaccgtgg?tgacggattt?accaaaagaa?gagaccggag?gcaacgcagc?aggaatgggt 1680

gggatgggag?gtatgggtgg?aatgggaggc?atgatgtaa 1719

<210>3

<211>548

<212>PRT

<213>Schistosoma?japonicum

<400>3

Met?Leu?Arg?Ala?Leu?Ser?Ser?Leu?Arg?Gly?Ser?Leu?Val?Pro?Ala?Arg

1 5 10 15

Gln?Lys?Val?Val?Gln?Arg?Phe?Tyr?Ala?Lys?Glu?Val?Lys?Phe?Gly?Ala

20 25 30

Asp?Ala?Arg?Ser?Ala?Met?Leu?Ile?Gly?Val?Asp?Val?Leu?Ala?Asp?Ala

35 40 45

Val?Ala?Val?Thr?Met?Gly?Pro?Lys?Gly?Arg?Asn?Val?Ile?Ile?Glu?Ser

50 55 60

Ser?Trp?Lys?Ser?Pro?Lys?Ile?Thr?Lys?Asp?Gly?Val?Thr?Val?Ala?Lys

65 70 75 80

Gly?Ile?Glu?Leu?Lys?Asp?Lys?Phe?Gln?Asn?Ile?Gly?Ala?Lys?Leu?Val

85 90 95

Gln?Asp?Val?Ala?Asn?Asn?Thr?Asn?Glu?Glu?Ala?Gly?Asp?Gly?Thr?Thr

100 105 110

Thr?Ala?Thr?Val?Leu?Ala?Arg?Ala?Ile?Ala?Lys?Glu?Gly?Phe?Glu?Lys

115 120 125

Ile?Ser?Lys?Gly?Ala?Asn?Pro?Ile?Glu?Phe?Arg?Arg?Gly?Val?Met?Leu

130 135 140

Ala?Val?Asp?Ala?Val?Val?Lys?Glu?Leu?Lys?Ser?Phe?Ser?Lys?Gln?Ile

145 150 155 160

Ser?Thr?Pro?Glu?Glu?Ile?Ala?Gln?Val?Ala?Thr?Ile?Ser?Ala?Asn?Gly

165 170 175

Asp?Lys?Ala?Ile?Gly?Asp?Leu?Ile?Ala?Ser?Ala?Met?Lys?Arg?Val?Gly

180 185 190

Asn?Asp?Gly?Thr?Ile?Thr?Val?Lys?Asp?Gly?Lys?Thr?Leu?His?Asp?Glu

195 200 205

Leu?Glu?Phe?Ile?Glu?Gly?Met?Lys?Phe?Asp?Arg?Gly?Tyr?Ile?Ser?Pro

210 215 220

Tyr?Phe?Ile?Asn?Thr?Glu?Lys?Gly?Ala?Arg?Cys?Glu?Phe?Gln?Asp?Ala

225 230 235 240

Phe?Ile?Leu?Phe?Ser?Glu?Lys?Lys?Ile?Asn?Ser?Ile?Gln?Thr?Leu?Leu

245 250 255

Pro?Ala?Leu?Glu?Leu?Cys?His?Gln?Gln?Lys?Arg?Pro?Leu?Leu?Ile?Ile

260 265 270

Ala?Glu?Asp?Val?Glu?Gly?Glu?Ala?Leu?Thr?Ala?Leu?Val?Leu?Asn?Arg

275 280 285

Leu?Lys?Leu?Gly?Leu?Gln?Val?Cys?Ala?Val?Lys?Ala?Pro?Gly?Phe?Gly

290 295 300

Asp?Asn?Arg?Lys?Asn?Thr?Leu?Lys?Asp?Met?Ala?Val?Ala?Thr?Gly?Gly

305 310 315 320

Ile?Val?Phe?Gly?Asp?Glu?Ala?Asp?Met?Tyr?Lys?Leu?Glu?Asp?Val?Gln

325 330 335

Leu?Gln?Asp?Leu?Gly?Arg?Val?Ser?Glu?Ala?Val?Ile?Thr?Lys?Asp?Asp

340 345 350

Cys?Leu?Leu?Met?Arg?Gly?Arg?Gly?Asn?Lys?Met?Asp?Ile?Asp?Lys?Arg

355 360 365

Ile?Ala?Gln?Ile?Lys?Asp?Glu?Met?Glu?Ala?Ser?Asn?Ser?Glu?Tyr?Glu

370 375 380

Lys?Glu?Lys?Met?His?Glu?Arg?Leu?Ala?Lys?Leu?Ser?Asn?Gly?Val?Ala

385 390 395 400

Val?Ile?Lys?Val?Gly?Gly?Ser?Ser?Glu?Val?Glu?Val?Ser?Glu?Lys?Lys

405 410 415

Asp?Arg?Tyr?Thr?Asp?Ala?Leu?Asn?Ala?Thr?Arg?Ala?Ala?Ile?Glu?Glu

420 425 430

Gly?Ile?Gln?Arg?Thr?Gly?Val?Arg?Ile?Val?Leu?Arg?Ala?Leu?Ser?Thr

435 440 445

Pro?Cys?Tyr?Thr?Ile?Ala?His?Asn?Ala?Gly?Val?Asn?Ala?Ser?Val?Val

450 455 460

Val?Glu?Lys?Val?Lys?Gly?Met?Ser?Gln?Asn?Met?Gly?Tyr?Asp?Ala?Gln

465 470 475 480

Asn?Asp?Val?Tyr?Val?Asp?Met?Ile?Glu?Ala?Gly?Ile?Ile?Asp?Pro?Thr

485 490 495

Lys?Val?Val?Arg?Thr?Ala?Leu?Val?Asp?Ala?Ala?Gly?Val?Ala?Ser?Leu

500 505 510

Leu?Thr?Thr?Ala?Glu?Thr?Val?Val?Thr?Asp?Leu?Pro?Lys?Glu?Glu?Thr

515 520 525

Gly?Gly?Asn?Ala?Ala?Gly?Met?Gly?Gly?Met?Gly?Gly?Met?Gly?Gly?Met

530 535 540

Gly?Gly?Met?Met

545

<210>4

<211>1647

<212>DNA

<213>Schistosoma?japonicum

<400>4

atgttacgag?ctctaagttc?acttcgtggt?agtttggttc?cagctagaca?aaaagttgtt 60

caaaggtttt?atgcaaagga?agtgaagttc?ggggctgacg?caagatcagc?tatgttgatt 120

ggtgttgatg?tactggcgga?tgctgttgca?gtcaccatgg?gccctaaagg?tcgtaacgta 180

ataatagaaa?gctcgtggaa?atctccaaaa?atcacaaaag?atggggttac?tgttgccaaa 240

ggtattgagc?tgaaggataa?gttccagaat?attggggcta?agttagtaca?ggacgttgct 300

aacaacacca?acgaagaggc?tggggatggt?actacaacag?ccactgtttt?agcgcgagct 360

atagctaaag?agggttttga?aaagataagt?aaaggcgcta?atcctatcga?gttccgaaga 420

ggtgttatgc?ttgctgttga?tgctgttgtc?aaagagctca?aatctttttc?gaagcaaata 480

tccacaccag?aagagatagc?acaagttgcg?acaatatccg?ctaacggtga?caaggctatt 540

ggcgacctaa?tcgcttcagc?tatgaagagg?gttgggaatg?atggcacgat?aactgttaag 600

gatggcaaaa?ctcttcacga?tgagttggag?tttatcgaag?gtatgaaatt?cgaccgtggt 660

tatatctctc?catattttat?caacactgag?aaaggagccc?gatgtgaatt?ccaagatgcc 720

ttcatattgt?tttctgaaaa?aaagataaac?agcattcaga?cattattacc?agctctcgaa 780

ctatgccacc?aacaaaaacg?gccgctgctg?attatcgccg?aggatgttga?aggtgaagct 840

cttacagcac?ttgtactaaa?tcgcttaaaa?ctgggcttgc?aggtctgtgc?agtcaaagca 900

ccaggttttg?gggataatcg?caaaaataca?ttaaaagata?tggctgtagc?aacaggtggt 960

atagtgttcg?gtgacgaagc?agatatgtac?aagttagagg?atgtacaact?gcaagatctg 1020

ggacgtgtgt?cagaagctgt?aataacaaaa?gacgattgtt?tactaatgcg?aggtcgtgga 1080

aacaaaatgg?acatcgacaa?acgtatcgca?caaattaaag?atgaaatgga?agcctccaac 1140

agcgagtatg?aaaaagaaaa?aatgcacgaa?cgcttggcca?agttgtcaaa?cggcgtcgca 1200

gtaattaagg?ttggtggaag?tagtgaagta?gaagttagtg?agaaaaagga?tcgatatact 1260

gatgcactca?atgcaacgag?agcagcaatt?gaggaaggca?tacagcgaac?aggtgtgcgg 1320

attgttctac?gtgcactttc?aactccgtgc?tataccattg?cacataacgc?aggtgtcaac 1380

gcctctgttg?tcgttgaaaa?agtcaaaggt?atgagccaga?atatgggtta?cgatgctcaa 1440

aatgatgttt?acgttgatat?gatcgaggct?ggaattattg?acccaactaa?ggtcgttaga 1500

actgcattgg?ttgatgcagc?tggtgttgct?tccttactca?caactgcaga?aaccgtggtg 1560

acggatttac?caaaagaaga?gaccggaggc?aacgcagcag?gaatgggtgg?gatgggaggt 1620

atgggtggaa?tgggaggcat?gatgtaa 1647

<210>5

<211>24

<212>PRT

＜213〉artificial sequence

<400>5

Val?Pro?Gly?Gly?Gly?Thr?Ala?Leu?Leu?Arg?Cys?Ile?Pro?Val?Leu?Asp

1 5 10 15

Thr?Leu?Ser?Thr?Lys?Asn?Glu?Asp

20

Claims

1. one kind increases CD4 ⁺CD25 ⁺Foxp3 ⁺The antigen of regulatory T cells is Schistosoma japonicum heat shock protein(HSP) 60KDa, and its full length amino acid sequence is shown in SEQ.ID.NO.1.

2. the said increase of claim 1 CD4 ⁺CD25 ⁺Foxp3 ⁺The antigen of regulatory T cells is as strengthening CD4 ⁺CD25 ⁺Foxp3 ⁺The application of the immunosuppressor of regulatory T cells retarding effect.

3. the said increase of claim 1 CD4 ⁺CD25 ⁺Foxp3 ⁺The application of the antigen of regulatory T cells in the diseases associated with inflammation medicine that preparation treatment immune response causes.

4. said increase CD4 in the claim 1 ⁺CD25 ⁺Foxp3 ⁺The antigen of regulatory T cells due to the anti-curing arthritis of preparation inflammatory symptoms and the application in the immunopathogenesis medicine.

5. one kind increases CD4 ⁺CD25 ⁺Foxp3 ⁺The antigen of regulatory T cells is to have lacked the 435th to the 458th amino acid whose Schistosoma japonicum heat shock protein(HSP) 60KDa, and its aminoacid sequence is shown in SEQ.ID.NO.3.

6. the said increase of claim 5 CD4 ⁺CD25 ⁺Foxp3 ⁺The antigen of regulatory T cells is as strengthening CD4 ⁺CD25 ⁺Foxp3 ⁺The application of the immunosuppressor of regulatory T cells retarding effect.

7. the said increase of claim 5 CD4 ⁺CD25 ⁺Foxp3 ⁺The application of the antigen of regulatory T cells in the diseases associated with inflammation medicine that preparation treatment immune response causes.

8. said increase CD4 in the claim 5 ⁺CD25 ⁺Foxp3 ⁺The antigen of regulatory T cells due to the anti-curing arthritis of preparation inflammatory symptoms and the application in the immunopathogenesis medicine.