CN101002948A - Peptide-DNA double vaccine based on T-cell epitope for anti-Schistosoma japonicum infection - Google Patents

Abstract

A double peptide-DNA vaccine based on T-cell epitope for preventing and treating the Japanese schistosome infection features that its eucaryotic expression carrier carrying the epitope peptide coding gene is wrapped by the protein containing the epitope peptide. The amino acid sequence of said T-cell epitope peptide is AKQYNICCKFKELLD. Said vaccine can be prepared by cationic peptide carrying technique.

Description

Peptide-dna double vaccine based on the protection against Schistosoma japonicum infection of t cell epitope

Technical field

The invention belongs to field of immunology, be specifically related to a kind of albumen and DNA mixed vaccine of protection against Schistosoma japonicum infection.

Background technology:

In recent years, rebound momentum appears again in China's schistosomicide epidemic situation, and the urgent needs of consolidating and improve the prevention and cure of snail fever effect that will rely on scientific and technological advances once more places on the agenda.In view of vaccine unrivaled effect in many infectious disease controls, attempt to develop the schistosomicide disease vaccine, obtaining the expectation that double benefit that chemotherapy " fugitive " effect and vaccination induces the immunoprophylactic effect of " long-acting " to combine solves control of schistosomiasis is that nearly 20-30 comes the relevant scientist's goal to fight in countries in the world, also is WHO/TDR has worldwide coordinated the effort of schistosomicide vaccine development since the eighties in last century original intention.

Along with the development of technique for gene engineering, the development work of schistosomicide recombinant subunit vaccine is carried out in a large number, but still is primarily aimed at Schistosoma mansoni so far.1997, TDR recommended 6 schistosomiasis mansoni vaccine candidate antigen molecules likely (Bergquist NR.Mem Imst Oswaldo Cruz 1998,93Suppl; 1:95-101): glutathione transferase (Sm28 GST), MAP-4 (deriving from the section of synthesized peptide of TPI), 62kDa peptide section (IrV-5), paramyosinogen Sm97, MAP-3 (deriving from the section of synthesized peptide of Sm23) and Sm14.Serve as more, the more deep vaccine candidate antigen of research wherein with Sm28 GST.And mostly the present several Japanese blood fluke vaccine antigen molecules studied of China are to use for reference that working experience that the Schistosoma mansoni institute obtains grows up.For example; be cloned into the antigenic homologue of a series of Schistosoma mansonis; as the 62kDa peptide section (Sj62) of Schistosoma japonicum 26kDa glutathione transferase (Sj26GST), TPI, myosin, 23kDa, 22.6kDa (Sj22.6), 32kDa antigen (Sj32) etc., and more existing molecules have carried out the protectiveness test at large animals such as cattle, pig, sheep.Yet; no matter Man or Schistosoma japonicum; though these adopt the vaccine of single antigen molecule preparation can induce the antibody response that produces higher level in immunity/challenge infection experiment; but how can not stably obtain to be higher than 40% protection; and most molecules inductive host's protections of institute and immunne response dependency do not illustrate yet (McManus DP.Int JParasitol 2000,30:265-271).Also attempt using forming compound polyvalent vaccine a plurality of molecules or epitope wherein are common,, but still can not stably obtain to be higher than 40% protection though protectiveness slightly improves by the people.Trace it to its cause and may be: one, the strategy of existing vaccine development is the mechanism that the host produces protective immune response in the hope simulation schistosomicide natural infection process; thereby the present vaccine molecule that adopts is the molecule of polypide predominant expression in the schistosomicide natural infection process; the acquisition approach of its encoding gene; mainly be to screen from the japonicum gene library with infected patient or animal serum to obtain, its immunoprotection mechanism mainly is the antibody response of inducing the host.But may be because in host and the long-term coevolution process of schistosomicide, schistosomicide has produced the immunological adaptation evolution to the selection pressure of host immune system, so under the natural infection state, these molecules can not induce the host to produce effective protection; Two, may be existing single subunit vaccine be combined in subunit in " cocktail " vaccine or the selection of peptide epitopes with induce desirable protective immune response and do not match; Three, after the injection that the bacterin preparation form of development mainly is recombinant protein vaccine and dna vaccination so far, conventional (subcutaneous, muscle, vein), the former is as the solubility small molecular protein, the general main antibody response of inducing; And latter's consumption is big, and mainly causes more weak cellullar immunologic response.

Therefore; above-mentioned Man of having cloned and having expressed and/or Schistosoma japonicum recombiant vaccine candidate molecules; comprise what the WHO recommendation was furtherd investigate, all obtain the protection effect (＜40%) (P.S.Coulson, Adv.Parasitol.39 (1997) 271-336.) that to expect.Yet, according to the on-the-spot experimentation in popular district, to reach at least the effect that the protection that is higher than 50% or more could really play effective attenuating propagation (McManusDP.Int J Parasitol 2000,30:265-271).Therefore, the immunogenicity of raising schistosomicide vaccine should be subjected to special attention with the target of inducing higher protection.

It is the model that produces high-level protection that stands the test of time most so far that irradiation causes weak cercaria model.Schistosoma mansoni, mammal can produce high-caliber protection at normal cercaria challenge infection after the inoculation gamma-ray irradiation causes weak cercaria.The C57BL/6 mice, through once inoculation, protection can reach 60%～70%, in non-human primate, through 3 inoculations, protection＞50%.If giving mouse inoculation when causing weak cercaria, add with reorganization IL-12, on average protection level almost can reach 90%, wherein some in addition the sterile immumity phenomenon appears.Schistosoma japonicum, cause weak cercaria inoculation FischerF344 rat with ultraviolet (UV), 1 inoculation, protection can reach 77.5%, three time and then bring up to 90%, and this sustainable 40 weeks of high protection; UV causes weak schistosoma japonicum cercariae and is seeded in pig and can induces generation up to 95% or 92% protection, and when being applied to Babalus bubalis L. at the scene, has also successfully obtained the protection up to 89.1%.The high level protection effect of this models show shows that not only the blood fluke vaccine exploitation is the target that can expect, and provides the template with navigational significance for this target.Cause the effector mechanism of weak cercaria about irradiation, the research that has had has disclosed certain characteristics: (1) t helper cell (Th) plays a major role in this model is replied, and then proof INF γ is this key factor of replying, and shows that the Th that relates to belongs to the Th1 hypotype; (2) IL-12 (IFN-γ inducer) is crucial inducible factor in the INF of this model γ produces, or the decision of saying so start immunne response to the Th1 answer party to polar essential condition; (3) as if cause the weak repeatedly immune C57BL/6 mice of cercaria with irradiation, can cause the protection level to increase (increasing to 82% from 59%), at this moment, antibody horizontal raises (IgG1 and total IgE), and the protection that increases is by antibody-mediated.Probably once immunity with immune induction repeatedly different Th hypotypes reply.Once immunity mainly is that Th1 replys, and repeatedly immunity also presents the Th2 type to reply (IL-4, IL-5 and IgG1) except that Th1 replys, or perhaps the Th1/Th2 mixing is replied.Irradiation causes weak cercaria model and has pointed out schistosomicide specificity T accessory cell (Th) to reply at host's schistosomicide to infect the main effect of high protection in expressing.

In sum, irradiation causes that inductive high protection is to reply interactional complex process by panimmunity in the weak cercaria model, therefore when these immune characteristics of imitation come combination-vaccine to make up, not only needs the B cell epitope, more needs t cell epitope.But the T epi-position of concrete MHC high-affinity it be unclear that in the aforementioned existing blood fluke vaccine candidate molecules.

Peptide-dna double vaccine (PDDV), be meant with the plasmid (DNA) that has the antigenic peptides encoding gene be core, in this antigenic peptides of its coated outside (protein), thereby form a kind ofly be similar to the virion shape, diameter is the peptide-DNA mixed vaccine of 10-15 nanometer.Existing studies show that can be used for reference cationic peptide load technology structure protein-nucleic acid double vaccine (Hong-Li Liu, et al.ImmunologyLetters 89 (2003) 167-173) (Yu-Zhang Wu, et al.Journal of Virology 76 (2002) 10264-10269), thus make this dosage form of PDDV that is easier to the inducing cell immunne response.But, also do not utilize t cell epitope to make up the report of the peptide-dna double vaccine of protection against Schistosoma japonicum infection at present.

Summary of the invention

The purpose of this invention is to provide a kind of protection against Schistosoma japonicum infection peptide-dna double vaccine based on t cell epitope.

The inventor with various software such as SYFPEITHI and TEPITOPE to Schistosoma japonicum 22.6kDa pellicle albumen total length antigen (Sj22.6GeneBank number: DNA AF030404; A-protein AC67308) carries out the prediction and the analysis of t cell epitope, after homology comparison and restriction enzyme site eliminating, select the highest epi-position of score value again, its aminoacid sequence is AKQYNICCKFKELLD, through the above-mentioned sequence that screening obtains, has proposed technical scheme of the present invention based on the inventor:

The peptide of said protection against Schistosoma japonicum infection-dna double vaccine is to be wrapped with the albumen that contains this epitope peptide at the carrier for expression of eukaryon that has the epitope peptide encoding gene, and the aminoacid sequence of said epitope peptide is AKQYNICCKFKELLD.

Conventional carrier for expression of eukaryon can both be used for the present invention, but in order to reach effect preferably, recommends to use the eukaryon expression plasmid that has monokaryon, macrophage-colony stimulating factor (GM-CSF), preferred pUMVC1-mGM-CS.

The present invention also provides the preparation method of the peptide-dna double vaccine of said protection against Schistosoma japonicum infection:

1) is that the aminoterminal of AKQYNICCKFKELLD epitope peptide adds 18 lysines in sequence, obtains synthetic peptide KKKKKKKKKKKKKKKKKKAKQYNICCKFKELLD, thereby make the whole synthetic peptide lotus that becomes positively charged;

2) epitope peptide AKQYNICCKFKELLD DNA sequences encoding is inserted carrier for expression of eukaryon, construction recombination plasmid;

3) with above-mentioned synthetic peptide and the recombiant plasmid that obtains, utilizing the cationic peptide carrying method, is core with the recombiant plasmid, at the synthetic peptide of its outer wrapping, is built into the protein-nucleic acid double vaccine.

Above-mentioned steps 2) specifically can be: 5 ' end of epitope peptide AKQYNICCKFKELLD DNA sequences encoding is added Sal I restriction enzyme site, add EcoR I restriction enzyme site, insert among the plasmid pUMVC1-mGM-CSF, the preparation plasmid at 3 ' end.

The protection that can improve protection against Schistosoma japonicum infection based on the PDDV vaccine of t cell epitope of the present invention by following approach:

(1) by t cell epitope choose and special form (PDDV) should be used for induce the host to produce comprehensive schistosomicide immunne response based on cellullar immunologic response, thereby improve the protection of vaccine;

(2) t cell epitope with strong immunostimulatory potency is obtained in screening, has reduced the ill effects such as cross reaction of using the full-length peptide section to bring:

(3) PDDV is that diameter is the particulate antigen of 10-15 nanometer, can efficiently enter antigen presenting cell, efficiently induces the host to produce comprehensive schistosomicide immunne response based on cellullar immunologic response.

(4) structure of the similar virus of PDDV (appearance is a protein, and interior is nucleic acid) makes its effectively digestion of the interior DNA enzyme of opposed body, therefore, compares with traditional protein vaccine or dna vaccination, and the PDDV consumption can reduce an order of magnitude (nearly 10 times).

Preferably in the technical scheme, the skeleton of PDDV is the plasmid that contains GM-CSF, can be used as propagation, the maturation of intramolecularly adjuvant stimulation of host antigen presenting cell (mainly being DC), thereby helps the enhancing of whole immunne response in the present invention.

Description of drawings

Fig. 1 is the building process sketch map of PDDV vaccine

Fig. 2 is that the ELISA method detects antibody horizontal sketch map in the serum

Fig. 3 is that the ELISA method detects IL-4 cytokine levels sketch map in the cells and supernatant

Fig. 4 is that the ELISA method detects IFN-gamma cells factor level sketch map in the cells and supernatant

Fig. 5 is the cell proliferation test result schematic diagram

Fig. 6 is that the liver worm's ovum granuloma pathology that schistosomicide causes changes sketch map.

The specific embodiment:

Employed in the present invention term unless other explanation is arranged, generally has the implication of those of ordinary skills' common sense.

Below in conjunction with concrete preparation embodiment and Application Example, and comparable data is described the present invention in further detail.Should be understood that these embodiment just in order to demonstrate the invention, but not limit the scope of the invention by any way.

In following embodiment, various processes of Xiang Ximiaoshuing and method are not conventional methods as known in the art.The source of agents useful for same, trade name and be necessary to list its constituent person indicate when occurring first that all used thereafter identical reagent if no special instructions, and is all identical with the content of indicating first.

Expression vector pUMVC1-mGM-CSF mentioned in the embodiment of the invention can buy (article No. is 4014) from aldevron company.

Embodiment one: the PDDV preparation

With various software such as SYFPEITHI and TEPITOPE Schistosoma japonicum 22.6kDa pellicle albumen total length antigen is carried out the prediction and the analysis of t cell epitope, select the highest epi-position of score value again after homology comparison and restriction enzyme site eliminating, its aminoacid sequence is AKQYNICCKFKELLD (Ala Lys Gln Tyr Asn Ile Cys Cys Lys Phe Lys Glu Leu Leu Asp).

Building process as shown in Figure 1,

1) orders the peptide section of above-mentioned sequence and when synthetic, add 18 lysine KKKKKKKKKKKKKKKKKKAKQYNICCKFKELLD (purity 〉=99%) from Invitrogen company, thereby make the whole synthetic peptide lotus that becomes positively charged, its called after P5 at its aminoterminal.In addition, for matched group is set, we have ordered one section peptide section (purity 〉=99%) that only contains 18 lysine KKKKKKKKKKKKKKKKKK simultaneously, with its called after 18K.

2) 5 ' end with epitope peptide AKQYNICCKFKELLD DNA sequences encoding adds Sal I restriction enzyme site, add EcoR I restriction enzyme site (tcgacatg atcactgaacttgaagatgttgcagagagagaacgattaaaagcgg) at 3 ' end, insert among the plasmid pUMVC1-mGM-CSF, prepare plasmid with amount plasmid extraction test kit among the Qiagen, we are with this recombiant plasmid called after pGT.

3), prepare two kinds of PDDV vaccines and be used for follow-up mouse immune/challenge infection experiment by the consumption of following method calculating nucleic acid and peptide: the PDDV of a kind of P5 of being and pGT preparation, we are with its called after T5-PDDV; Another kind is the PDDV of 18K and the preparation of empty DNA plasmid, and we are used for contrast with its called after 18K-PDDV.Detail is as follows:

The concentration of making the nucleic acid of PDDV can be 50～100ng/ μ L, and total amount is decided according to the requirement of final vaccine.The consumption of peptide calculates according to following formula: M _p=KrM _d, wherein K is a constant, r be peptide with cationic charge and nucleic acid with the ratio of anionic charge, determine that by DNA retardance experiment, DNase digestion experiment and electron microscopic observation cation and plasmid DNA can best combination and form granule big or small about 20nm when adopting this r; M _dBe the amount of used nucleic acid (calculating of the derivation of formula and K value is referring to Zhao Jianping Master's thesis " MOLECULE DESIGN of " simulated virus " and bring out research that specific CTL reply at body ", May calendar year 2001).

The calculating of A.K value

The negative charge number of 1 μ g plasmid DNA molecule:

(1 μ g ÷ 330g/mol) * 6.023 * 10 ²³Individual/mol * 1e ^-/=1.83 * 10 ¹⁵e ^-

1 μ g cationic peptide positively charged number (molecular weight of epitope peptide is 3907.12):

(1 μ g ÷ 3907.12g/mol) * 6.023 * 10 ²³Individual/mol * 18e ⁺/=2.77 * 10 ¹⁵e ⁺

In every and 1 μ g plasmid DNA the amount of electronegative required cationic peptide represent with K, then

K＝1.83×10 ¹⁵e-÷2.77×10 ¹⁵e ⁺＝0.66

B. be 100 μ g, i.e. M as the required nucleic acid amount of preparation vaccine _dBe 100 μ g, the r value is defined as 4 by DNA retardance experiment, DNase digestion experiment and electron microscopic observation, then

M _p=KrM _d=0.66 * 4 * 100=264 μ g is promptly when zwitterion electric charge ratio is 4, and preparing PDDV with 100 μ g plasmid DNA, to need cationic peptide be 264 μ g

When C. the NaCl final concentration was 150mM in the obtain solution of nucleic acid and cationic peptide HEPES buffered saline (HBS) solution, cation and plasmid DNA can best combination and are formed the granule of size about 10-15nm.With HEPES regulator solution pH value is 7.35～7.45.

D. be the preparation that example describes nucleic acid and cationic peptide HBS solution in detail still with above-mentioned result of calculation, the preparation final concentration is the NaCl solution of 150mM, the HEPES solution that final concentration is 40mM earlier, if the final volume of preparation PDDV solution is defined as 800 μ L (the volume decision of the solvent that adopts when this measures by immune animal), then prepare each 400 μ L of HBS solution of nucleic acid and cationic peptide respectively

The preparation of nucleic acid HBS solution

Plasmid DNA (10 μ g/ μ L) 10 μ L

5M NaCl 24μL

1M HEPES 32μL

ddH ₂O 334μL

The preparation of cationic peptide HBS solution

Cationic peptide (20 μ g/ μ L) 13.2 μ L

5M NaCl 24μL

1M HEPES 32μL

ddH ₂O 330.8μL

E. prepare PDDV: the HBS solution of the cationic peptide amount with 5 μ L/ time dropwise is added in the HBS solution of nucleic acid, added once in per 5 minutes.Upward with the speed vortex of 1400/rpm, temperature is provided with 25 ℃ to the solution of maintenance nucleic acid or preparation at Thermomixer (Eppendorf, Germany) in the whole application of sample process.After application of sample was finished, sample continued vortex 30min or 1h.

Embodiment two: the PDDV vaccine that makes with embodiment one carries out immunity/challenge infection experiment

Cleaning level C57BL/6 mice: congratulate the center available from country of Nanjing University mice genetic resources, 8 ages in week, female.

Experiment for the first time:

A) mice is divided into three groups at random, 14 every group, called after T5-PDDV group, 18K-PDDV organize and matched group respectively.

B) weekly immunity once, at every turn at subcutaneous T5-PDDV solution (containing 28 μ g P5 peptide sections and 5 μ g eukaryotic expression recombinant plasmid DNA), 18K-PDDV solution (containing the empty eukaryon expression plasmid DNA of 28 μ g 18K peptide sections and 5 μ g) or the PBS solution of injecting 100 μ l respectively of mouse back.

C) PDDV vaccine inductive immunne response in the mice body detects: 1. immunity is preceding adopts the mouse tail vein blood sample with last after 2 weeks of immunity, is used for the content that ELISA detects immunity front and back serum antibody; 2. last is after 2 weeks of immunity, and every group is killed 7 mices, get the individual cells suspension that mouse spleen and lymph node prepare spleen and lymph node, 1 * 10 ⁶Individual/mL is laid on Tissue Culture Plate, at different antigenic stimulus P5 (10ug/ml), and 18K (10ug/ml), or do not have antigenic stimulus, and 37 ℃, 5%CO ₂Incubator is cultivated 48h, collects culture supernatant and is used to detect cytokine; 3. last is after 2 weeks of immunity, and every group is killed 7 mices, get the individual cells suspension that mouse spleen and lymph-node cell prepare spleen and lymph node, 2 * 10 ⁵Individual/mL is laid on Tissue Culture Plate, at different antigenic stimulus P5 (10ug/ml), and 18K (10ug/ml), or do not have antigenic stimulus, and 37 ℃, 5%CO ₂Incubator is cultivated 48h, with ³The H method of mixing detects antigenic peptides to spleen and the lymphocytic effect of stimulating proliferation.

D) protection of PDDV vaccine (worm reduction rate and egg reduction rate) detects: last remains every group of 7 mices after 2 weeks of immunity, and every Mus infects through skin of abdomen with 40 schistosoma japonicum cercariaes.In infection 6 weeks of back, cut open extremely, pour into to collect adult and carry out worm reduction rate calculating, and the worm's ovum in the microscopy mouse liver carries out egg reduction rate calculating.

Following scheme is all adopted in second and third time experiment:

A) mice is divided into three groups at random, 14 every group, called after T5-PDDV group, 18K-PDDV organize and matched group respectively.

B) immunity every other week once, at every turn at subcutaneous T5-PDDV solution (containing 28 μ g P5 peptide sections and 5 μ g eukaryotic expression recombinant plasmid DNA), 18K-PDDV solution (containing the empty eukaryon expression plasmid DNA of 28 μ g 18K peptide sections and 5 μ g) or the PBS solution of injecting 100 μ l respectively of mouse back.

C) PDDV vaccine inductive immunne response in the mice body detects: 1. immunity is preceding adopts the mouse tail vein blood sample with last after 2 weeks of immunity, is used for the content that ELISA detects immunity front and back serum antibody; 2. last is after 2 weeks of immunity, and every group is killed 7 mices, get the individual cells suspension that mouse spleen and lymph node prepare spleen and lymph node, 1 * 10 ⁶Individual/mL is laid on Tissue Culture Plate, at different antigenic stimulus P5 (10ug/ml), and 18K (10ug/ml), or do not have antigenic stimulus, and 37 ℃, 5%CO ₂Incubator is cultivated 48h, collects culture supernatant and is used to detect cytokine; 3. last is after 2 weeks of immunity, and every group is killed 7 mices, get the individual cells suspension that mouse spleen and lymph-node cell prepare spleen and lymph node, 2 * 10 ⁵Individual/mL is laid on Tissue Culture Plate, at different antigenic stimulus P5 (10ug/ml), and 18K (10ug/ml), or do not have antigenic stimulus, and 37 ℃, 5%CO ₂Incubator is cultivated 48h, with ³The H method of mixing detects antigenic peptides to spleen and the lymphocytic effect of stimulating proliferation.

D) protection of PDDV vaccine (worm reduction rate and egg reduction rate) detects: last remains every group of 7 mices after 2 weeks of immunity, and every Mus infects through skin of abdomen with 40 schistosoma japonicum cercariaes.In infection 6 weeks of back, cut open extremely, pour into to collect adult and carry out worm reduction rate calculating, and the worm's ovum in the microscopy mouse liver carries out egg reduction rate calculating.

The PDDV vaccine is inductive immunne response test experience in the mice body:

1) the ELISA method detects the level of antibody in the serum:

A. wrap quilt: be cushioned liquid and envelope antigen SWAP 20 μ g/ holes bag by 96 orifice plates with 100ul bag.4 ℃ are spent the night.Discard solution in the hole next day, washes 3 times each 3 minutes with the PBS-T lavation buffer solution.(being called for short washing, down together).

B. application of sample: the sample 0.1ml to be checked that adds dilution in 1: 50 in above-mentioned wrapped by reacting hole in, put 37 ℃ and hatched 1 hour.Washing then.(doing blank well simultaneously, negative control hole and positive control hole).

C. add enzyme labelled antibody: in each reacting hole, add IgG, IgG1 or IgG2a enzyme labelled antibody (dilution factor after the titration) 0.1ml of fresh dilution.Hatched 0.5～1 hour washing for 37 ℃.

D. add substrate solution colour developing: in each reacting hole, add the tmb substrate solution 0.1ml of interim preparation, 37 ℃ 10～30 minutes.

E. cessation reaction: in each reacting hole, add 2M sulphuric acid 0.05ml.

F. the result judges: on the ELISA detector, in the 450nm place, survey each hole OD value with zeroing back, blank hole.The result has successfully induced special IgG antibody (Fig. 2 A) of schistosome antigen and IgG1, IgG2a antibody (Fig. 2 B) as shown in Figure 2 behind the T5-PDDV immune mouse

2) level of the IL-4 and the IFN-gamma cells factor in the ELISA method detection cells and supernatant: with reference to cytokines measurement test kit description, with corresponding cytokine antibodies wrapper sheet, all the other methods are fully with above-mentioned step 1).IL-4 and IFN-γ detection kit adopt the Read-set-go test kit (article No. is respectively IL-4 88-7044-77, IFN-γ 88-7314-77) available from eBiosciense company

The result has successfully induced IFN-γ (Fig. 3) and IL-4 (Fig. 4) production of cytokines as shown in Figure 3, Figure 4 behind the T5-PDDV immune mouse.

3) it is 2 * 10 that the cell cell proliferation test: with 2) is adjusted cell concentration ⁵Individual/mL is laid on Tissue Culture Plate, at different antigenic stimulus T5 (10ug/ml), and 18K (10ug/ml), or do not have antigenic stimulus, and 37 ℃, 5%CO ₂Incubator is cultivated 3d..Preceding 16～the 18h of cell harvesting adds ³H-TdR, the 0.5uCi/ hole.The Beckman liquid scintillation instrument is measured the cpm value, and the result can stimulate the propagation of spleen and lymph-node cell as shown in Figure 5 behind the T5-PDDV immune mouse.

But the cellullar immunologic response of the immunity inducing mouse of above description of test T5-PDDV.

The PDDV vaccine is inductive immune protective efficiency observation experiment in the mice body:

1) last remains every group of 8 mices after two weeks of immunity, and every Mus infects through skin of abdomen with 40 schistosoma japonicum cercariaes.Infect 6 weeks of back, cut open and kill, pour into, collect adult and mouse liver.

2) be counted as the borer population amount, calculate worm reduction rate: worm reduction rate=(matched group is on average seized into borer population-experimental group and on average seized into borer population)/matched group is on average seized into borer population * 100%.The results are shown in Table 1.

3) get liver left, center, right leaf part, make pathological section, HE dyeing, microscopically is observed granulomatous size of worm's ovum and quantity.The result as shown in Figure 6, behind the T5-PDDV immune mouse, the liver worm's ovum granuloma quantity that schistosomicide causes is lacked than matched group, area is littler than matched group.

4) will remain liver and spend the night with 37 ℃ of digestion of 5% potassium hydroxide, microscopically counting worm's ovum quantity is calculated egg reduction rate=(matched group worm's ovum quantity-experimental group worm's ovum quantity)/matched group worm's ovum quantity * 100%.

The result is as shown in table 1 in three experiments; compare with matched group; after T5-PDDV uses in the mice body; make the intravital adult of mice reduce 39.3%, 47.7% and 33.8% respectively; and make worm's ovum reduce 55.8%, 34.3% and 33.3%, thereby show the protection that T5-PDDV can induce schistosomicide to a certain degree to infect.

Table 1.PDDV inductive protection (worm reduction rate and egg reduction rate) in the mice body

Group	Average every Mus worm lotus (x ± SE)	Worm reduction rate (%)	Worm's ovum number in average every Hepar Mus (x ± SE)	Egg reduction rate (%)
					T5-PDDV Exp1	14.5±8.4	39.3 **	38000±2406	55.8 **
Exp2	18.1±6.0	47.7 **	95750±3471	34.3 **
					Exp3	20.8±5.1	33.8 **	98000±3998	33.3 **
18K-PDDV Exp1	23.3±6.4	2.4	80333±2444	6.6
					Exp2	28.1±4.6	18.9	127250±5317	12.7
Exp3	26.2±9.5	16.5	120000±3170	18.4
					Control Exp1	23.9±6.3	0	86000±2347	0
Exp2	34.7±5.2	0	145750±3688	0
					Exp3	31.4±9.1	0	147142±3552	0

The invention is not restricted to these disclosed embodiments, the present invention will cover the scope described in the patent book, and the various modification of claim scope and equivalence variation.

Claims (5)

1, a kind of peptide of protection against Schistosoma japonicum infection-dna double vaccine is to be wrapped with the albumen that contains this epitope peptide at the carrier for expression of eukaryon that has the epitope peptide encoding gene, and the aminoacid sequence of said epitope peptide is AKQYNICCKFKELLD.

According to the said peptide of claim 1-dna double vaccine, it is characterized in that 2, wherein said carrier for expression of eukaryon is the eukaryon expression plasmid that has the GM-CSF gene.

3, according to the said peptide of claim 2-dna double vaccine, it is characterized in that the plasmid of the wherein said GM-CSF of having gene is pUMVC1-mGM-CS.

4, the method for the peptide-dna double vaccine of the said protection against Schistosoma japonicum infection of preparation claim 1 is:

1) is that the aminoterminal of AKQYNICCKFKELLD epitope peptide adds 18 lysines in sequence, obtains synthetic peptide KKKKKKKKKKKKKKKKKKAKQYNICCKFKELLD, thereby make the whole synthetic peptide lotus that becomes positively charged;

2) epitope peptide AKQYNICCKFKELLD DNA sequences encoding is inserted carrier for expression of eukaryon, construction recombination plasmid;

3) with above-mentioned synthetic peptide and the recombiant plasmid that obtains, utilizing the cationic peptide carrying method, is core with the recombiant plasmid, at the synthetic peptide of its outer wrapping, is built into the protein-nucleic acid double vaccine.

5, according to the said preparation method of claim 4, it is characterized in that step 2) specifically can be: 5 ' end of epitope peptide AKQYNICCKFKELLD DNA sequences encoding is added the SalI restriction enzyme site, add EcoR I restriction enzyme site at 3 ' end, insert among the plasmid pUMVC1-mGM-CSF preparation recombiant plasmid.

Images