CN102240402A - Method for preparing chicken genetic engineering immunopotentiator by akirin2 gene sequence - Google Patents
Method for preparing chicken genetic engineering immunopotentiator by akirin2 gene sequence Download PDFInfo
- Publication number
- CN102240402A CN102240402A CN201110136651XA CN201110136651A CN102240402A CN 102240402 A CN102240402 A CN 102240402A CN 201110136651X A CN201110136651X A CN 201110136651XA CN 201110136651 A CN201110136651 A CN 201110136651A CN 102240402 A CN102240402 A CN 102240402A
- Authority
- CN
- China
- Prior art keywords
- chicken
- akirin2
- genetic engineering
- gene
- immunostimulant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention provides a method for preparing a chicken genetic engineering immunopotentiator by an akirin2 gene sequence, relating to a method for preparing a chicken genetic engineering immunopotentiator. The invention solves the problem that the existing genetic engineering immunoenhancement nucleic acid vaccines can not extensively improve the immunity effects of vaccines and bacterins. The method comprises the following steps of: acquiring a chicken akirin2 gene coded sequence; acquiring a recombinant pMD18-T vector containing the chicken akirin2 gene; designing a primer and enabling the 5'- terminals to have HindIII and EcoRI restriction sites, subcloning the chicken akirin2 gene in the recombinant pMD18-T vector into an expression vector to construct a recombinant expression vector; and diluting the recombinant expression vector by a sterile PBS (phosphate buffer solution). The chicken genetic engineering immunopotentiator provided by the invention can improve the expression levels of multiple immunity related factors such as IL-1, IL-6, toll-like receptors and the like, and has the characteristics of wide applicable range and the like for various vaccines and bacterins.
Description
Technical field
The present invention relates to prepare the method for chicken genetic engineering immunostimulant.
Background technology
Akirins is discovery in 2008, the nucleoprotein of high conservative between different plant species.Akirin is 201 amino acid whose albumen of coding, shows two conservative domains respectively at N-end and C-end, has nuclear localization signal between the N-end 24-29 amino acid residue.In Brachydanio rerio, Africa xenopus, people and Mus, have two homologous geness (akirin1 and akirin2), in insecticide (Apis, tenebrio beetle, anopheles costalis and fruit bat) and chicken, have only a copy (akirin2), but in plant, yeast and antibacterial, do not find this gene.Akirin2 works in immunity in fruit bat and mice and the inflammatory reaction as the necessary nuclear intrinsic factor of natural immunity reaction signal path.
The genetic engineering immunostimulant is exactly that one or more cytokine genes (gene commonly used at present has IL-1, IL-2, IL-6, IL-18 etc.) are cloned on the carrier for expression of eukaryon, the recombiant plasmid that makes up is directly imported in the body, produce and cellular immune level with the antibody that strengthens vaccine.For scientific evaluation is the genetic engineering immunostimulant of the main component immunological enhancement to the variety classes vaccine in the poultry body with the recombinant cytokine, Chinese scholars has been carried out repeatedly science and has been attempted, and has obtained immunoenhancement result preferably.
Current, continuous expansion along with the home poultry raising scale, contacts and trade is frequent day by day both at home and abroad, the chance of pathophoresis increases greatly, problems such as vaccine immunity antibody horizontal decline that the immunosuppressive disease of chicken and some other factor caused in addition and immuning failure have been brought enormous economic loss to aviculture.
The traditional vaccine immunostimulant exists reinforced effects bad at present, the preparation expense is higher, problems such as toxicity is big, and the immunoenhancement result one-sidedness problem of only utilizing the single cell factor gene to bring of existing genetic engineering immunostimulant nucleic acid vaccine, can not improve vaccine, vaccine immunization effect widely.
Summary of the invention
The objective of the invention is to exist reinforced effects bad in order to solve existing traditional vaccine immunostimulant, the preparation expense is higher, toxicity is big, and existing genetic engineering immunostimulant nucleic acid vaccine exists and can not improve the problem of vaccine, vaccine immunization effect widely, and the method for utilizing the akirin2 gene order to prepare chicken genetic engineering immunostimulant is provided.
The method of utilizing the akirin2 gene order to prepare chicken genetic engineering immunostimulant is carried out according to the following steps:
One, utilizing the est database of Hongyuan chicken among the NCBI, is target with people's akirin2 gene (GenBank:NM 001007589) coded sequence (CDS), utilizes BLAST software to carry out electronic cloning, obtains chicken akirin2 full length gene coded sequence;
Two, adopt Trizol reagent to extract total RNA of 3 Japanese instar chickling skeletal muscle, adopt two step method RT-PCR technology to obtain chicken akirin2 full length gene coded sequence, purified rear clone is identified to carrier pMD18-T and order-checking, is obtained to contain the reorganization pMD18-T carrier of chicken akirin2 gene;
Three, according to chicken akirin2 full length gene coded sequence, design primer P1 and P2, and making 5 of primer P1 and P2 '-end have HindIII and EcoRI restriction enzyme site respectively, the chicken akirin2 gene sub-clone in the pMD18-T carrier of will recombinating then is built into recombinant expression carrier pcDNA-akirin in expression vector pcDNA3.0;
Four, the aseptic PBS buffer dilution recombinant expression carrier pcDNA-akirin that adopts 0.1mol/L to concentration be 1.0g/ μ l, in-20 ℃ of preservations, promptly finish and utilize the akirin2 gene order to prepare chicken genetic engineering immunostimulant;
Wherein in the step 2 chicken akirin2 full length gene coded sequence shown in SEQ ID No.1;
The nucleotides sequence of primer P1 is classified as in the step 3: 5 '-CCCAAGCTTATGGCGTGCGGCGCCACTTTG-3 ', the nucleotides sequence of primer P2 is classified as: 5 '-CGGAATTCTCATGAAACGTAACTGGCAGG-3 ';
PBS buffer in the step 4: NaCl 137mmol/L, KCl 2.7mmol/L, Na
2HPO
410mmol/L, KH
2PO
42mmol/L, pH are 7.2.
The present invention exploitation is that the genetic engineering immunostimulant of main component can improve the vaccine antibody level with chicken akirin2 gene, simultaneously, because the akirin2 gene can extensively improve panimmunity correlation factor expressions such as body IL-1, IL-6 and toll-sample receptor in theory, therefore the chicken genetic engineering immunostimulant for preparing among the present invention can avoid existing nucleic acid vaccine to utilize the one-sidedness and the lack of uniformity of monofactor immunoenhancement result, and then has characteristics such as various vaccines, vaccine are widely applicable.Inoculating the immunological enhancement difference of chicken genetic engineering immunostimulant to vaccine in different ways, is best (can make corresponding vaccine immunity antibody horizontal improve 10%～25%) with the intramuscular inoculation effect wherein; Chicken genetic engineering immunostimulant not only can be in production practices and the vaccine use in conjunction, are directly used in the production of vaccine but also can be used as vaccine immunity adjuvant, have broad application prospects; The present invention to the control of chicken immune inhibition disease, improve vaccine immunity efficient, to reduce production of vaccine cost etc. significant, for future chicken genetic engineering immunostimulant industrialization production and apply and lay a good foundation.In addition, the preparation method of chicken genetic engineering immunostimulant is simple, with low cost among the present invention, and toxicity is little, for the development and utilization of akirin2 gene immunostimulant in mammal and people provides theory and experimental basis.
Description of drawings
Fig. 1 is immunoenhancement result figure in the specific embodiment one, wherein ◆ represent the 1st group, and ■ represents the 2nd group, ▲ expression 3-1 group, ● represent the 3-2 group, * expression 3-3 group, * represents the 4th group.
The specific embodiment
Technical solution of the present invention is not limited to the following cited specific embodiment, also comprises the combination in any between each specific embodiment.
The specific embodiment one: the method that present embodiment utilizes the akirin2 gene order to prepare chicken genetic engineering immunostimulant is carried out according to the following steps:
One, utilizing the est database of Hongyuan chicken among the NCBI, is target with people's akirin2 gene (GenBank:NM 001007589) coded sequence (CDS), utilizes BLAST software to carry out electronic cloning, obtains chicken akirin2 gene coded sequence;
Two, adopt Trizol reagent to extract total RNA of 3 Japanese instar chickling skeletal muscle, adopt two step method RT-PCR technology to obtain chicken akirin2 full length gene coded sequence, purified rear clone is identified to carrier pMD18-T and order-checking, is obtained to contain the reorganization pMD18-T carrier of chicken akirin2 gene;
Three, according to chicken akirin2 full length gene coded sequence, design primer P1 and P2, and making 5 of primer P1 and P2 '-end have HindIII and EcoRI restriction enzyme site respectively, the chicken akirin2 gene sub-clone on the pMD18-T carrier of will recombinating then is built into recombinant expression carrier pcDNA-akirin in expression vector pcDNA3.0;
Four, the aseptic PBS buffer dilution recombinant expression carrier pcDNA-akirin that adopts 0.1mol/L to concentration be 1.0 μ g/ μ l, in-20 ℃ of preservations, promptly finish and utilize the akirin2 gene order to prepare chicken genetic engineering immunostimulant;
akirin2：ATGGCGTGCGGCGCCACTTTGAAAAGGACTCTGGATTTCGACCCGCTGCTCAGCCCGGCGTCCCCGAAACGGAGGCGATGTGCGCCATTGTCAGCCCCGGCCTCGGCCGCCGCCTCCTCCTCCTCCTTCGCCTCCCCGCAGAAATACCTGCGCATGGAGCCCTCGCCCTTCGGAGAGGTGTCCTCCCGGCTCACCACAGAACAAATTCTGTACAACATAAAACAGGAGTACAAACGCATGCAGAAGAGGAGACACTTAGAAAATAGCTTCCAGCAGACAGATCCTTGTTGTTCTACTGATGCACAGCCACATGCGTTTCTTCTTACTGGACCAGCTTTGCCAGGTACTTCATCTGCAGCATCATCACCATTGAAAAAAGAACAGCCTCTGTTTACTCTCAGACAAGTTGGAATGATCTGTGAACGTTTGCTGAAAGAACGTGAAGAGAAAATCCGTGAAGAGTATGAAGAAATTTTGACCACAAAACTTGCAGAACAATACGACGCGTTTGTGAAGTTCACGCATGATCAAATCATGCGACGATATGGAGAACAGCCTGCCAGTTACGTTTCATGA；
The nucleotides sequence of primer P1 is classified as in the step 3: 5 '-CCCAAGCTTATGGCGTGCGGCGCCACTTTG-3 ', the nucleotides sequence of primer P2 is classified as: 5 '-CGGAATTCTCATGAAACGTAACTGGCAGG-3 ';
PBS buffer in the step 4: NaCl 137mmol/L, KCl 2.7mmol/L, Na
2HPO
410mmol/L, KH
2PO
42mmol/L, pH are 7.2.
Relating to the part that primer is synthetic, gene synthesizes and check order in the present embodiment finishes by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd; Present embodiment relates to use in concrete operations various reaction reagents are to buy and obtain (precious biological engineering company limited), and the by specification operation.
Adopt two step method RT-PCR technology to obtain chicken akirin2 full length gene coded sequence in the present embodiment step 2, method reference reagent description, wherein concrete PCR program is as follows: 94 ℃ of pre-degeneration 4min, 94 ℃/1min of 30 circulation, 56 ℃/1min, 72 ℃/1min, 72 ℃ are extended 10min, 4 ℃ of cessation reactions eventually.
Chicken akirin2 full length gene coded sequence in the present embodiment step 2, purified rear clone is identified to carrier pMD18-T and order-checking, picking identifies that 5 correct recombinant clones are checked order by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd at random, sequencing result shows: chicken Akirin2 gene coded sequence total length 576nt, it is in full accord that clone's institute's calling sequence and electronic cloning are predicted, 191 aminoacid of encoding are shown in SEQ ID No.2.
The present embodiment gained utilizes the akirin2 gene order to prepare the application of chicken genetic engineering immunostimulant: in the vaccine immunity animal, adopt 1ml syringe chest muscle injection inoculation 200 μ g chicken genetic engineering immunostimulants, can make corresponding vaccine immunity antibody horizontal improve 10%～25%.
A large amount of preparations of recombinant expression carrier pcDNA-akirin in the present embodiment step 3:
Recombinant expression carrier pcDNA-akirin transformed into escherichia coli DH5 α, the positive pcDNA-akirin transformant of picking adopts the LB culture medium to carry out amplification cultivation then, adopts a large amount of extractions of alkaline lysis and purification of Recombinant plasmid pcDNA-akirin again, and is specific as follows:
(1) with positive pcDNA-akirin transformant DH5 α strain streak culture after, the single bacterium colony on the picking agar culture plate is seeded in the 2ml LB culture fluid and (contains 50 μ g/ml Amp), 37 ℃ of shaken cultivation are spent the night;
(2) get 1ml bacterium liquid to containing in the 200ml LB culture fluid triangular flask of (containing 50 μ g/ml Amp), 37 ℃ of shaken cultivation are spent the night;
(3) get bacterium liquid to the 50ml centrifuge tube, centrifugal 1 minute of 12000rpm;
(4) abandon supernatant, bacterial precipitation is suspended in the solution I (50mM glucose, 2.5mMTrisCl (pH8.0), 10mM EDTA (pH8.0), autoclaving) of 3ml ice pre-cooling, vortex vibration mixing, room temperature was shelved 5 minutes;
(5) (0.2M NaOH 1%SDS), puts upside down centrifuge tube 10-15 time with the mixed content thing, puts 5 minutes on ice to add the 6ml solution II;
(6) add 4.5ml solution III (3M potassium acetate/2M acetic acid), gentleness is put upside down 10 seconds of mixing, places on ice 5 minutes;
(7) 12000rpm, 4 ℃ centrifugal 15 minutes, get in supernatant to the new eppendorf pipe;
(8) add isopyknic phenol/chloroform/isoamyl alcohol (25: 24: 1), concuss 15 seconds;
(9) 12000rpm, 4 ℃ centrifugal 15 minutes, get in supernatant to the new eppendorf pipe;
(10) add the pre-cooling dehydrated alcohol of 2 times of volumes, put upside down mixing, placed 30 minutes for-80 ℃, 12000rpm, 4 ℃ are centrifugal 15 minutes;
(11) abandon supernatant, add 5ml 70% ethanol rinsing precipitation, 12000rpm, 4 ℃ are centrifugal 15 minutes;
(12) sterile working abandons supernatant, treats that ethanol evaporates fully, adds 500 μ l sterilized water dissolving plasmid DNA.
The present embodiment gained utilizes the akirin2 gene order to prepare the zoopery of chicken genetic engineering immunostimulant:
Adopt newcastle disease (ND) attenuated vaccine (La Sota system, Heilongjiang Province's biological product one factory's product) immune 7 Japanese instar chicklings, concrete grammar is: the blue brown laying hen in commodity sea of 60 7 ages in days is equally divided into 4 groups (10 every group), every group of chicken isolated rearing in the ferrum cage, the 1st group of chicken injection chicken genetic engineering immunostimulant; The 2nd group is the vaccine immunity group; The 3rd group of chicken adopted distinct methods inoculation chicken genetic engineering immunostimulant in vaccine immunity, promptly the 3-1 group adopts the eye dripping method, and the 3-2 group adopts nasal drip, and the 3-3 group adopts intramuscular injection; The 4th group is blank, i.e. intramuscular injection pcDNA3.0 empty carrier plasmid DNA; Below respectively organize inoculum concentration and only be 200 μ g/; After vaccination 7 days, 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, taked the serum of every group of chicken to carry out the ND blood clotting in 56 days respectively to suppress (HI buys from Harbin Veterinary Medicine Inst., China Academy of Agriculture) antibody horizontal and detect.
The result is as shown in Figure 1: 2nd, 3 groups of chickens all begin rapid rising at the antibody titer of immunity Avian pneumo-encephalitis virus (NDV) after 7 days, reach peak value to the NDV antibody horizontals of back 21 days 2,3 groups of chickens of immunity; Descend by a small margin since 28 days NDV antibody horizontals; Show from NDV antibody horizontal change curve: the whole observation process of NDV antibody horizontal of using the 3rd group of chicken of chicken genetic engineering immunostimulant all is higher than single the 2nd group of chicken with vaccine, and best with intramuscular injection path immunoprophylaxis reinforced effects in application chicken genetic engineering immunostimulant group inside, the NDV antibody horizontal of generation can reach second group 1.25 times; During the whole test, the NDV antibody horizontal of the 1st group and the 4th group contrast chicken is always below 2Log2; Above result shows: adopt the antibody generation level after muscle injection mode inoculation chicken genetic engineering immunostimulant can significantly improve the immunity of chicken NDV live vaccine.
The specific embodiment two: what present embodiment and the specific embodiment one were different is that 3 Japanese instar chicklings are the blue brown chickens in commodity sea in the step 2.Other step and parameter are identical with the specific embodiment one.
The blue brown chicken in the commodity of 3 ages in days sea in the present embodiment, Avian pneumo-encephalitis virus (NDV) average antibody titre is all less than 2Log2, available from the Northeast Agricultural University hatchery before the immunity.
Claims (2)
1. utilize the akirin2 gene order to prepare the method for chicken genetic engineering immunostimulant, it is characterized in that the method for utilizing the akirin2 gene order to prepare chicken genetic engineering immunostimulant carries out according to the following steps:
One, utilizing the est database of Hongyuan chicken among the NCBI, is target with people's akirin2 gene coded sequence, utilizes BLAST software to carry out electronic cloning, obtains chicken akirin2 full length gene coded sequence;
Two, adopt Trizol reagent to extract total RNA of 3 Japanese instar chickling skeletal muscle, adopt two step method RT-PCR technology to obtain chicken akirin2 full length gene coded sequence, purified rear clone is identified to carrier pMD18-T and order-checking, is obtained to contain the reorganization pMD18-T carrier of chicken akirin2 gene;
Three, according to chicken akirin2 full length gene coded sequence, design primer P1 and P2, and making 5 of primer P1 and P2 '-end have HindIII and EcoRI restriction enzyme site respectively, the chicken akirin2 gene sub-clone in the pMD18-T carrier of will recombinating then is built into recombinant expression carrier pcDNA-akirin in expression vector pcDNA3.0;
Four, the aseptic PBS buffer dilution recombinant expression carrier pcDNA-akirin that adopts 0.1mol/L to concentration be 1.0 μ g/ μ l, in-20 ℃ of preservations, promptly finish and utilize the akirin2 gene order to prepare chicken genetic engineering immunostimulant;
Wherein in the step 2 chicken akirin2 full length gene coded sequence shown in SEQ ID No.1;
The nucleotides sequence of primer P1 is classified as in the step 3: 5 '-CCCAAGCTTATGGCGTGCGGCGCCACTTTG-3 ', the nucleotides sequence of primer P2 is classified as: 5 '-CGGAATTCTCATGAAACGTAACTGGCAGG-3 ';
PBS buffer in the step 4: NaCl 137mmol/L, KCl 2.7mmol/L, Na
2HPO
410mmol/L, KH
2PO
42mmol/L, pH are 7.2.
2. the akirin2 of utilization gene order according to claim 1 prepares the method for chicken genetic engineering immunostimulant, it is characterized in that 3 Japanese instar chicklings are the blue brown chicken in commodity sea in the step 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110136651XA CN102240402A (en) | 2011-05-25 | 2011-05-25 | Method for preparing chicken genetic engineering immunopotentiator by akirin2 gene sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110136651XA CN102240402A (en) | 2011-05-25 | 2011-05-25 | Method for preparing chicken genetic engineering immunopotentiator by akirin2 gene sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102240402A true CN102240402A (en) | 2011-11-16 |
Family
ID=44958760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110136651XA Pending CN102240402A (en) | 2011-05-25 | 2011-05-25 | Method for preparing chicken genetic engineering immunopotentiator by akirin2 gene sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102240402A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103114094A (en) * | 2012-11-07 | 2013-05-22 | 山东大学 | Amphioxus endonuclear protein, and expression gene and application thereof |
| CN103333243A (en) * | 2013-06-17 | 2013-10-02 | 武汉新华扬生物股份有限公司 | Immune protein Akirin2 and gene and application thereof |
| CN104099332A (en) * | 2014-05-12 | 2014-10-15 | 河南农业大学 | Pig akirin2 gene promoter and application thereof |
| CN105671081A (en) * | 2015-12-02 | 2016-06-15 | 肇庆大华农生物药品有限公司 | Method of preparing chicken Akirin2 protein through insect cell expression system |
| CN106177993A (en) * | 2016-07-06 | 2016-12-07 | 华南农业大学 | Infectious bursal disease virus DNA vaccination and construction method thereof |
| CN109942694A (en) * | 2019-04-03 | 2019-06-28 | 河南师范大学 | Grass carp Akirin1 gene, coding albumen and its application |
-
2011
- 2011-05-25 CN CN201110136651XA patent/CN102240402A/en active Pending
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103114094A (en) * | 2012-11-07 | 2013-05-22 | 山东大学 | Amphioxus endonuclear protein, and expression gene and application thereof |
| CN103333243A (en) * | 2013-06-17 | 2013-10-02 | 武汉新华扬生物股份有限公司 | Immune protein Akirin2 and gene and application thereof |
| CN103333243B (en) * | 2013-06-17 | 2015-12-02 | 武汉新华扬生物股份有限公司 | A kind of immune protein Akirin2 and gene thereof and application |
| CN104099332A (en) * | 2014-05-12 | 2014-10-15 | 河南农业大学 | Pig akirin2 gene promoter and application thereof |
| CN104099332B (en) * | 2014-05-12 | 2016-10-26 | 河南农业大学 | One boar akirin2 gene promoter and application thereof |
| CN105671081A (en) * | 2015-12-02 | 2016-06-15 | 肇庆大华农生物药品有限公司 | Method of preparing chicken Akirin2 protein through insect cell expression system |
| CN105671081B (en) * | 2015-12-02 | 2018-12-21 | 肇庆大华农生物药品有限公司 | Utilize the method for insect cell expression system preparation chicken akirin2 albumen |
| CN106177993A (en) * | 2016-07-06 | 2016-12-07 | 华南农业大学 | Infectious bursal disease virus DNA vaccination and construction method thereof |
| CN106177993B (en) * | 2016-07-06 | 2020-01-14 | 华南农业大学 | Infectious bursal disease virus DNA vaccine and construction method thereof |
| CN109942694A (en) * | 2019-04-03 | 2019-06-28 | 河南师范大学 | Grass carp Akirin1 gene, coding albumen and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102240402A (en) | Method for preparing chicken genetic engineering immunopotentiator by akirin2 gene sequence | |
| RU2009149378A (en) | CLOSTRIDIAL TOXIN NETB | |
| CN109078178B (en) | Clostridium perfringens β toxin recombinant subunit vaccine and production method thereof | |
| CN101899418A (en) | Avian influenza virus (AIV) as well as kit and vaccine used for detecting and preventing same | |
| CN101508978A (en) | Separation identification and purification process for chicken source H9N2 avian influenza virus strain and uses thereof | |
| CN114524862B (en) | Construction and application of avian influenza (H5 + H7) trivalent DNA vaccine | |
| CN113603754B (en) | Waterfowl H5N8 subtype influenza virus HA recombinant protein and preparation method and application thereof | |
| CN102816246A (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN102796200B (en) | Hybrid peptide bursin adjuvant and preparation method and application thereof | |
| CN114507272A (en) | Bovine akabane virus vaccine | |
| CN109395071A (en) | A kind of Mermaid luminous bacillus extracellular protein EF-Tu | |
| CN102746389A (en) | Streptococcus adhesion antigen GAPDH and preparation method thereof | |
| CN102533629B (en) | Preparation method of avian encephalomyelitis virus VP1 protein subunit vaccine | |
| CN102277374A (en) | Preparation and application of genetic engineering subunit vaccine for infectious bursal disease | |
| CN103013929B (en) | Avian influenza virus, and detection kit and vaccine thereof | |
| CN103233013A (en) | Nile tilapia transforming growth factor TGF-beta 1 gene, related protein and application | |
| CN102533775A (en) | Full-length complementary deoxyribonucleic acid (cDNA) sequence of Paralichthys olivaceus pattern recognition Toll-like receptor TLR21 and applications thereof | |
| CN102675433A (en) | Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof | |
| CN115850404A (en) | Recombinant erysipelothrix rhusiopathiae surface protection antigen A with tandem dominant epitopes and application thereof | |
| CN102311928B (en) | Recombinant yeast engineering strain coexpressed by proteins of chicken anaemia viruses VP1 and VP2, construction method thereof and application thereof | |
| CN109293769A (en) | A kind of QX type avian infectious bronchitis virus positive serum and preparation method thereof | |
| CN111138553B (en) | Fusion protein, toxoplasma subunit vaccine and vaccine composition thereof | |
| CN110092840B (en) | Chicken infectious laryngotracheitis and egg drop syndrome bigeminal multi-epitope vaccine | |
| CN100467591C (en) | Recombinant fowl influenza virus strain, its preparation method and the vaccine obtained therefrom | |
| CN109439633B (en) | Newcastle disease virus recombinant vaccine strain inserted with HA protein of H7N9 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20111116 |