CN104211783B - A kind of preparation of blue otopathy subunit vaccine - Google Patents
A kind of preparation of blue otopathy subunit vaccine Download PDFInfo
- Publication number
- CN104211783B CN104211783B CN201310190308.2A CN201310190308A CN104211783B CN 104211783 B CN104211783 B CN 104211783B CN 201310190308 A CN201310190308 A CN 201310190308A CN 104211783 B CN104211783 B CN 104211783B
- Authority
- CN
- China
- Prior art keywords
- vaccine
- subunit vaccine
- blue
- blue otopathy
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6075—Viral proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/10011—Arteriviridae
- C12N2770/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/10011—Arteriviridae
- C12N2770/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Mycology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to a kind of preparation of blue otopathy subunit vaccine.The vaccine contains pig breeding and respiratory system syndrome virus PRRSV GP5 albumen dyads and purification tag.This production of vaccine stable preparation process, is adapted to large-scale production.Target animals experiment shows that recombinant subunit vaccine of the present invention can induce effective humoral immunity.
Description
Technical field
The invention belongs to biotechnology genetic engineering field, relate generally to a kind of pig blue-ear disease subunit vaccine and prepare with answering
With.Specifically, using gene recombination technology, major structural protein GP5 is connected, and is cloned into carrier, Host Strains is converted, passes through
Prepared by fermentation, purifying, emulsifying process, obtain recombinating blue otopathy subunit vaccine and the vaccine in the great Animal diseases pig of prevention
Application in blue otopathy.
Background technology
Porcine reproductive and respiratory syndrome (porcinere productive and respiratory syndrome,
PRRS it is) by porcine reproductive and respiratory syndrome virus (porcinere productive and respiratory syndrome
Virus, PRRSV) caused by porcine viral diseases, with the breathing problem and immunosupress of in-pig breeding difficulty and piglet
It is characterized with persistent infection, is to cause one of the important diseases of world's pig industry serious financial consequences (Terpstra in recent years
et al.1991).Present PRRSV is almost in all pig-raising countries popular (Bilodeau et al, 1991；Wensvoort
Et al, 1991；Albina et al, 1997).Currently for the sick prevention and control, vaccine immunity is still a main approach
One of (Liang Haoyi, 2008).
PRRSV Genome Sizes are 15kb or so, and containing 8 open reading frames (ORFs), there is cap knot its 5 ' end
There is Poly (A) tail structure, 3 ' ends.GP5 (E protein) has neutralizing epitope, is the principal immune protection type antigen of virus；
PRRSV and EAV is all equine arteritis virus section member, and GP5 biological function is extremely important, mainly in virus infection, cell
With reference to and viruses adsorption in work, be also the target spot of lymphoproliferative response.
GP5 albumen is the main membrane glycoprotein of PRRSV viruses, is important neutralization antigen (the Pirzadeh et of virus
Al., 1998；Gonin et al., 1999), body can be stimulated to produce neutralizing antibody and cellular immunity, in addition, for GP5 eggs
White monoclonal antibody is also proven to have viral neutralization activity.GP5 has 6 antigenic determinants, and 3 B cell epitopes can be induced
Body produces neutralizing antibody (Plagemann, 2004), is that neutralizing antibody most strong structure is produced in all structural proteins of PRRSV
Albumen, it is in significant correlation that the neutralize antibody titers that GP5 inductions are produced are with the protection to virus；GP5 another important work
With being that can induce Apoptosis (Fernidez et al., 2002).With expression GP5 recombinant vaccine immune swine, it can produce
Raw neutralizing antibody (Pirzadeh and Dea, 1997 for PRRSV；Zhanget al., 1998), and immune swine attacks poison
After can be effectively protected, such as alleviate viremia virusemia and mitigate pulmonary lesion (Pirzadeh et al, 1998；Xue
Et al., 2004；Qiu et al., 2005).Have GP5 of the researcher to 6 plants of " hyperpyrexia integrates disease " RRSV variants homologous
Property is contrasted, and is shown that homology is higher, is respectively positioned in same independent branch.Existing vaccine strain RespPRRS/Repro
MLV, PrimePac, IngeIvacATP and CH-1 a are located in different branches respectively.In the GP5 of high-pathogenicity blue ear disease,
39 amino acids of the antibody combining site of neutralizing epitope there occurs than more consistent mutation.And 9,16,35,39,58,94 and
185 be that amino acid there occurs than more consistent mutation, has obvious difference with previous vaccine strain and domestic epidemic strain.It is all high
13 of pathogenic PRRS separation strains and the amino acid of 151 are all R, show as strong malicious type (Ansari IH, 2006).GP5
Albumen contains multiple neutralizing epitopes, and the monoclonal antibody prepared with restructuring GP5 albumen has a neutralization activity, virus neutralization with
Anti- GP5 antibody titers are in significant correlation.Other albumen such as GP4 eggs are directed to for the neutralization activity ratio of GP5 monoclonal antibody
White monoclonal antibody is stronger.Research shows that GP5 albumen comprises at least two kinds of neutralization antigenic determinant, and some are line
Property determinant, restructuring GP5 albumino reactions that can be with Bacillus coli expression, it is conformation dependent determinant to also have some
(KreutzLC, 1997；PirzadehB, 1998；Weiland E, 1999；Zhang Y, 1998).
GP5 is proved at least containing two important antigen relevant ranges using the method for deletion mutation, respectively positioned at extracellular
Aa27~41 in domain and aa180~197 at C- ends.However, the restructuring GP5 albumino reactions to virus protein and Bacillus coli expression
The GP5 albumino reactions of positive Swine serum but not with 50 amino acid residues of C- terminal deletions, it is a weight to illustrate C- ends
The antigenic determinant wanted and/or played a significant role in protein conformation is maintained.Speculate that GP5 albumen contains an extracellular structure
Domain, includes about preceding 40 amino acid (Rowland RR, 1999) of albumen.One has been identified in the centre of ectodomain
Individual main neutralizing epitope (B epitope, aa37-45) and a non-neutralizing epitope (A epitope, aa27-35).GP5 eggs
There is the region of a very hydrophobic in N- ends in vain, be used as the leader of the albumen.Also include many cross-films in GP5 albumen to dredge
Pool, these regions can be such that the GP5 albumen of translation rests in endoplasmic reticulum (ER), so as to suppress the expression of GP5 albumen.Now
Have been confirmed has two main trans-membrane regions (Osrowski M, 2002 at 14-31 and 64-134；Wissink EH,
2003；).
PRRS inactivated vaccines have safety, in the absence of spreading virus and causing the danger in the new epidemic disease sources of PRRS, be easy to storage and
Transport, it is insensitive to the interference effect of maternal antibody the advantages of, therefore people preferred inactivated vaccine prevents and controls PRRS.State
Oil adjuvant killed vaccine is made in CH-1a plants of the PRRSV of interior separation, and the strain is through the passage of Marc-145 cell lines, many time clonings
Purifying, filters out the PRRSV strains of thermophilic Marc-145 cell growths, after the cell culture fluid of the strain is inactivated through chemical reagent,
Medical oily adjuvant is equipped with, reproductive and respiratory syndrome inactivated vaccine (Guo Baoqing etc., 2000) has been made, it has also become domestic first batch of business
The PRRS vaccines of product, and 3 monthly age piglet interval 20d have been carried out 2 times be immunized, as a result 5d just can detect after first immunisation
Special viral antibody, 28d peaks, and 56d also can detect antibody after head exempts from.
PRRS attenuated vaccines have the advantages that immunity is strong, duration of immunity is long.In the U.S., Boehringer Ingleheitm
Commercialization attenuated vaccine Resp PRRSVTM are released in company NOBL laboratories in nineteen ninety-five first, have been approved to be used for 3~18 week old
The immunization campaign of piglet.But disable in the negative swinerys of PRRS, in-pig and reproduction age boar.It can be produced after Attenuate vaccine use certain
Protective effect (Sipos et al., 2003).He Xinqun etc. (2003) is prepared for PRRSV attenuated live vaccines and has carried out pig body
Experiment, as a result finds, antibody peak, and sustainable more than 3 months occurs in immune rear 20^35d or so, there is longer immunoprotection
Phase, 14d is that can detect that PRRSV neutralizing antibodies after being immunized.Mavromatis etc. (1999) confirms that live vaccine can be protected and fattened
Respiratory symptom caused by pig resistance PRRSv.But the insecurity of Attenuate vaccine, especially virulence return strong possibility as people
A subject matter being concerned about.Attenuated vaccine can also persistently disseminate vaccine virus while immunoprotection is provided so that virus
Circulate and exist in pig farm, even trigger breaking out for PRRS sometimes.It is demonstrated experimentally that the hyperplasia of PRRSV infection induction B cell is same
When, also cause these pig immunologic mjuries (Ansari IH etal, 2006；Wissink EH etal, 2004).
Summary of the invention
Effect of the present invention according to different structure albumen in virus infection, selection major structural protein GP5 is used as vaccine
Frame structure, through techniques such as everfermentation, purifying, emulsifications after two GP5 series connection, obtains the blue ear of the restructuring with Desirable immunogenic
Sick subunit vaccine.The vaccine prepared using the present invention can effectively prevent the infection of pig blue-ear disease.
An object of the present invention be the provision of a kind of new subunit vaccine polypeptide that can be used to prevent blue otopathy and
Its vaccine combination.
The second object of the present invention is the provision of the structure and preparation method of the subunit vaccine.
The third object of the present invention, which is the provision of, can express the engineering strain of the blue otopathy subunit vaccine.
The fourth object of the present invention is the provision of the preparation method of the blue otopathy subunit vaccine.
The fifth object of the present invention is the provision of purposes of the subunit vaccine in the blue otopathy of prevention.
In a first aspect, the invention provides a kind of subunit vaccine polypeptide for being used to prevent blue otopathy and combinations thereof.
It contains main structural proteins GP5 dyads.Described subunit vaccine protein or polypeptide or pharmaceutically acceptable salt with
And the carrier required for expression epitope protein.Carrier can also include the sequence of separately encoded each epitope, and series connection can
To be carried out by genetic engineering method.The vaccine also includes nonimmune active material, and the coupling part of as each polypeptide does not have
Have the immunogenicity of epitope, also without any adjuvanticity, mainly have purification tag, joint peptide, chemical modification part,
N-terminal signal peptide and C-terminal polyadenylic acid etc..The pharmaceutically acceptable salt refers to non-toxic, stimulation and allergy, is applicable
In the salt of human or animal tissues.Inert matter and pharmaceutically acceptable salt are well known to those skilled in the art.
In second aspect, the invention provides a kind of nucleic acid molecule, it encodes the blue ear described in first aspect present invention
Sick subunit vaccine polypeptide.Nucleotide of the present invention can be rna form, and DNA form is synthesized by artificial synthesized mode and resisted more
Former epitope tandem sequence and molecule adjuvant sequence, then enter carrier by genetic engineering operation connection rear clone, are transformed into large intestine
Bacillus, screening, after purification fermentation, the blue otopathy subunit vaccine polypeptide of acquisition.The nucleic acid can be carried out in the present invention conventional
Molecular biology manipulations, such as：PCR, digestion with restriction enzyme, connection etc., the end of nucleic acid design 5 ' and 3 ' ends add digestion
Site.It is preferred that the nucleotide sequence in the present invention is as follows：
TTGGGGAAATGCTTGACCGCGGGCTGTTGCTCGCAATTGTTTTTTTTGTGGTGTATCGTGCCGTCTTGT
TTTGTTGCGCTCGTCAGCGCCAACAGCAACAGCAGCTCAAATTTACAGCTGATTTACAACTTGACGCTATGTGAGCT
GAATGGCACAGATTGGCTAGCTAATAAATTTGACTGGGCAGTGGAGTGTTTTGTCATTTTTCCTGTGTTGACTCACA
TTGTCTCTTATGGTGCCCTCACTACTAGCCATTTCCTTGACACAGTCGGTCTGGTCACTGTGTCTACCGCCGGATTT
GTTCACGGGCGGTATGTTCTGAGTAGCATCTACGCGGTCTGTGCCCTGGCTGCGTTGATTTGCTTCGTCATTAGGCT
TGCGAAGAATTGCATGTCCTGGCGCTACTCATGTACCAGATATACCAACTTTCTTCTGGACAGTAAGGGCAGACTCT
ATCGTTGGCGGTCGCCTGTCATCATAGAGAAAAGGGGCAAAGTTGAGGTCGAAGGTCAACTGATCGACCTCAAAAGA
GTTGTGCTTGATGGTTCCGCGGCAACCCCTGTAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCTTTGGGGAAATG
CTTGACCGCGGGCTGTTGCTCGCAATTGTTTTTTTTGTGGTGTATCGTGCCGTCTTGTTTTGTTGCGCTCGTCAGCG
CCAACAGCAACAGCAGCTCAAATTTACAGCTGATTTACAACTTGACGCTATGTGAGCTGAATGGCACAGATTGGCTA
GCTAATAAATTTGACTGGGCAGTGGAGTGTTTTGTCATTTTTCCTGTGTTGACTCACATTGTCTCTTATGGTGCCCT
CACTACTAGCCATTTCCTTGACACAGTCGGTCTGGTCACTGTGTCTACCGCCGGATTTGTTCACGGGCGGTATGTTC
TGAGTAGCATCTACGCGGTCTGTGCCCTGGCTGCGTTGATTTGCTTCGTCATTAGGCTTGCGAAGAATTGCATGTCC
TGGCGCTACTCATGTACCAGATATACCAACTTTCTTCTGGACAGTAAGGGCAGACTCTATCGTTGGCGGTCGCCTGT
CATCATAGAGAAAAGGGGCAAAGTTGAGGTCGAAGGTCAACTGATCGACCTCAAAAGAGTTGTGCTTGATGGTTCCG
CGGCAACCCCTGTAACCAGAGTTTCAGCGGAACAATGGGGTCGTCCT
In the third aspect, the invention provides a kind of carrier, it is except blue containing the coding described in second aspect of the present invention
Otopathy subunit vaccine nucleic acid molecule, also containing with the exercisable connection of the nucleotide sequence, procaryotic cell expression (transcription
And translation) needed for expression control element.Most basic expression control element includes promoter, transcription terminator, enhancer, choosing
Selecting property mark etc., these controlling elements are known in the art.In a preferred embodiment, the expression vector is large intestine bar
Bacterium expression vector.
In fourth aspect, the invention provides a kind of host cell, it contains the carrier described in third aspect present invention.Place
Chief cell is inverted or transfects the gene order containing encoding proteins of the present invention, then has good heredity after testing
After expression stability, the blue otopathy subunit vaccine polypeptide needed for being produced available for fermentation expression.
At the 5th aspect, the invention provides a kind of preparation method of blue otopathy subunit vaccine, it comprises the following steps：
Engineering bacterium fermentation expresses subunit vaccine polypeptide, by thick purifying and polishing purification technique and follow-up emulsifying process, obtains institute
The polypeptide needed.The method being directed to includes but is not limited to bacterial cell disruption, inclusion body washing, centrifugation, denaturation, affine layer
Analysis, hydrophobic chromatography, anion-exchange chromatography, reverse-phase chromatography, renaturation, emulsification etc..The preparation method being related in the present invention is ability
Known to field technique personnel.
At the 6th aspect, the invention provides a kind of recombinant subunit vaccine for being used to prevent pig blue-ear disease, it includes this
Polypeptide and pharmaceutically acceptable carrier described in invention first aspect.The subunit vaccine can prevent pig blue-ear disease
Outburst.Pharmaceutically acceptable carrier of the present invention is immunopotentiator or immunologic adjuvant, and preferably immunologic adjuvant is import
White-oil adjuvant.
At the 7th aspect, the invention provides the application of the blue otopathy subunit vaccine of the restructuring described in the 6th aspect.Vaccine
Can necessarily effective dose intramuscular injection, it is intracutaneous or be subcutaneously injected or intranasal vaccination injection animal, the IFN of sufficient amount can be expressed
Antiviral activity, attack of the protection animal from the popular strain of blue otopathy are provided.In addition, in embodiments of the invention, leading to
Cross and malicious contrast test, laboratory safety experiment etc. are attacked to vaccine progress target animals, show the blue otopathy of restructuring of the present invention
Subunit vaccine is safe (see example IV), and animal can be protected to be infected from reproductive and respiratory syndrome virus (see embodiment five).
In addition, it is necessary to which, it is noted that on the basis of the disclosure of the context of the application, other of the invention have
The aspect of substantive distinguishing features is obvious for the ordinary skill people of this area.In addition, the present invention which also uses disclosure
Document, their entire contents are included to be referred to herein.
Brief description of the drawings
Drawings below is used to illustrate specific embodiments of the present invention, rather than limits what is be defined by the claims
The scope of the invention.
The blue otopathy subunit expression carrier pRSETB-PRRSVGP52 of Fig. 1 restructuring builds figure；
Fig. 2 pRSETB-PRRSVGP52 vector plasmid cleavage maps, wherein swimming lane 1 are DNAmarker, from top to bottom molecule
Amount is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp, and swimming lane 2 is negative control, and swimming lane 3 is that plasmid does not cut figure；
Fig. 3 SDS-PAGE detection figures, wherein swimming lane 1,4 is do not induce negative control, and swimming lane 2 is purifying destination protein (arrow
Head is signified), swimming lane 3 is albumen marker, be followed successively by from top to bottom 97.2KD, 66.4KD, 44.3KD, 29.0KD, 20.1KD,
14.3KD, swimming lane 5,6 induces for thalline；
Fig. 4 Westernblot detection figure, wherein swimming lane 1 be pre-dyed marker, be followed successively by from top to bottom 97.2KD,
66.4KD, 44.3KD, 29.0KD, 20.1KD, 14.3KD, swimming lane 2 are negative control, and swimming lane 3 is purpose albumen (arrow is signified).
Embodiment
Specific test method description described in embodiment is only exemplary description, for elaborating the present invention, but simultaneously
It is not meant to limit the scope of the invention, many changes according to the present invention are well known to those skilled in the art.
The structure of the coli expression carrier of embodiment one and expression bacterial strain
Designed polypeptide-coding nucleotide is served into extra large handsome biotech company's synthesis, nucleotide fragments two ends difference
BamH I (5 ' end) and HindIII (3 ' end) restriction enzyme site are devised, is cloned into respectively after this fragment is synthesized
On pMD18T carriers, sequencing confirms that insertion genetic fragment is consistent with implementation sequence (see sequence table).Recombinant plasmid is distinguished
It is named as pMD18T-PRRSVGP52.Two kinds of plasmids are subjected to digestion processing, Escherichia coli table with corresponding restriction enzyme
The pRSETB plasmids of Invitrogen companies are selected up to carrier, also using identical restriction enzyme ferment treatment, digestion condition：10
2 μ l plasmids are added in μ l reaction systems, system, restriction enzyme is 5 active units (New England biolabs),
Add the μ l of 10 × buffer solution 1, deionized water polishing, 37 DEG C of digestions 1.5 hours.Digestion adds 1 μ l 200mM EDTA after terminating whole
Only react.In 1% agarose gel electrophoresis, electrophoresis 30 minutes.By 2.9kb pRSETB plasmids and 1194bp under uviol lamp
PRRSVGP52 fragments are cut, and glue reclaim is carried out according to Qiagen companies gel reclaims kit specification.According to carrier：Fragment
1：2-3 ratio individually mixes multi-epitope nucleotide fragments with expression vector, and the μ l of reaction system 15 are entered by T4 DNA ligases
Row connection, 16 DEG C of connections are stayed overnight, and are obtained recombinant plasmid and are respectively designated as pRSETB-PRRSVGP52, (see Fig. 1), transformed competence colibacillus
E. coli bl21 (DE3) pLysS.
Conversion：PRSETB-PRRSVGP52 is put and melted on ice, 2 μ l Ligature liquid is added, mixes again, ice-water bath 30
Minute, 42 DEG C 30 seconds, ice bath is then put back to rapidly 1.5 minutes, add 1ml LB nutrient solutions, 37 DEG C, quiescent culture 1 hour,
4000g low-temperature centrifugations abandon supernatant in 10 seconds, and thalline is resuspended with 200 μ lLB culture mediums；Bacterium solution is spread evenly across containing 100 μ g/
On the LB agar plates of mL ampicillins, it is inverted in 37 DEG C of insulating boxs and cultivates 12-16 hours, until Clone formation.
Identification：Monoclonal on picking flat board is into LB culture mediums, 37 DEG C, 180rpm concussion and cultivates 12 hours, extracts matter
Grain, carries out double digestion using restriction endonuclease BamH I and HindIII respectively, can cut out corresponding blue-ear disease vaccine gene size fragment
Clone, 1200bp can be primarily determined that as positive colony (see Fig. 2)；Positive colony carries out determined dna sequence and further verifies it
Correctness (see sequence table).
Induced expression.I.e. by positive colony incubated overnight, morning next day, by 1: 100 switching, after cultivating 3 hours, adds
0.5mM IPTG, continue to cultivate 3 hours, prepare sample；Conventional SDS-PAGE testing goals protein expression situation --- in 49KD
(see Fig. 3), it is correct clone to see specific band；Correct clone is taken, amplification is cultivated, after SDS-PAGE verification tables reach correctly,
Further confirm that it expresses accuracy using conventional Western-blot (see Fig. 4)；, can after above-mentioned structure and evaluation program
The positive colony selected is carried out to the foundation of original species word bank, strain name pRSETB-PRRSVGP52/BL21 as engineering bacteria
(DE3, Plys).
Fermentation, purifying and the emulsification of the engineering bacteria of embodiment three
Fermentation takes production strain, is inoculated in 2ml LB fluid nutrient mediums and (contains 100 μ g/ml ampicillins), 37 DEG C,
12 hours activated spawns of 180rpm shaken cultivations.Shaking flask, 37 DEG C of shaken cultivations to OD600=are accessed with 1: 100 inoculum concentration again
3, it can be inoculated with 10% ratio into fermentation tank.Fermentation is semisynthetic medium with culture medium, is prepared with distilled water, wherein not containing
Any antibiotic.Dissolved oxygen and pH value electrode are corrected, tank body stirring is opened, revolution is 300rpm, and tank body sterilizes online, training in tank is treated
When nutrient solution temperature is down to 37.0 DEG C, demarcation pH and dissolved oxygen (OD) zero point.Fermentation temperature is 37.0 ± 0.1 DEG C, and dissolved oxygen control exists
20% or so, pH control flow feeding 500ml when cultivating thalline OD600=1.0~1.2 after 7.0, inoculation, 1 hour after feed supplement
IPTG (final concentration of 0.5mM) induced expression is added, 6 hour after fermentation of continuous induction terminate, SDS-PAGE calibratings are done in sampling
Expression.
The thalline that will be collected into is purified, it is mixed with occlusion body washing lotion I (1%Triton X-100,20mMTris-cl PH8.0)
Ultrasound, 2000W ultrasonic degradations 1 hour are carried out after outstanding.4 DEG C, 12000rpm is collected by centrifugation occlusion body, and with occlusion body washing lotion II
(1%DOC, 4M urea, 20mMTris-cl PH8.0) suspension twice ultrasonic washs occlusion body, and secondary low-temperature centrifugation is collected and included
Body.Occlusion body precipitation 8M urea, 0.3% β-ME, 20mM Tris-cl (pH=8.00) are mixed, are stirred at room temperature 4 hours,
8000rpm low-temperature centrifugation 30min, discard precipitation.Albuminate 1: 100 dilutes, renaturation solution Tris (PH8.0) buffer system,
0.3M arginine is added, 4 DEG C are stirred renaturation 24 hours.Renaturation solution pH=8.0 20mM phosphate buffers, 0.5M sodium chloride,
Affinity column in 20mM imidazoles, balance, with pH=8.0 20mM phosphate buffers, 0.5M sodium chloride, the elution of 0.5M imidazoles；
Produce the blue otopathy subunit vaccine semi-finished product stoste of restructuring.Do SDS-PAGE and Western blot markings calibrating purified product
Whether it is target protein (Fig. 4).
The semi-finished product of purifying are diluted to 200 μ g/ml by emulsification with the PBS of sterilizing.Take import white mineral oil adjuvant
DUOPRIME (pharmaceutical grade) sterilizes 15 minutes through 121 DEG C, standby.By oil phase: aqueous phase=50: 50 proportions, first by oil phase
Add in emulsion tank, start mixer and be slowly stirred with 80-100r/min speed, be slowly added into aqueous phase, be stirred for after adding
2min, then emulsifies 9min with 5500r/min high-speed circulatings, the single-phase vaccine of Water-In-Oil is made.
The blue otopathy subunit vaccine safety testing of example IV restructuring
Security of the vaccine to small white mouse
18~22g Balb/C small white mouses, every injection 0.5ml, every batch of vaccine injection 5, totally three batches is subcutaneously injected
It is secondary, 15 small white mouses are injected, 2 negative controls are concurrently set, Continuous Observation 10 days observes the health status of small white mouse.
Security of the vaccine to piglet
Select the healthy three way cross piglet of 30 ages in days, every blue otopathy subunit vaccine of posterior auricular muscle meat injection restructuring, every batch
Secondary 5, totally three batches, inject 15 piglets, while negative control 2 is set up, every injecting normal saline white oil emulsion
2ml, clinical observation 10 days.
As a result
Safety testing of the vaccine to small white mouse
As a result such as table body temperature of animal subject second day of 1,20110903 immune group 2 slightly has rise, recovers within the 3rd day normal,
Appetite and health status are without exception, consistent with control group, no dead generation, it is seen that the blue otopathy subunit vaccine of restructuring is to small white mouse
It is safe, is shown in Table 1.
Safety testing result of the vaccine of table 1 to small white mouse
| Group | Size of animal | Body temperature | Appetite | Health status | The dead quantity |
| 20110903 | 5 | 2 body temperature rises, other are normal. | Normally | It is in a good state of health | 0 |
| 20110904 | 5 | Normally | Normally | It is in a good state of health | 0 |
| 20110905 | 5 | Normally | Normally | It is in a good state of health | 0 |
| Control | 2 | Normally | Normally | It is in a good state of health | 0 |
Safety testing of the vaccine to piglet
As a result such as table 2, in whole 10 days experimental observation phases, all immune piglets, body temperature and appetite are normal, do not go out
What incumbent clinical anomaly, after off-test, 15 piglets are good for and lived.2 piglets of adjuvant group are compareed also without any bad
Reaction.This explanation, the blue otopathy subunit vaccine of restructuring is safe to piglet.
Safety testing result of the vaccine of table 2 to piglet
| Group | Size of animal | Body temperature | Appetite | Unusual condition | The dead quantity |
| 20110903 | 5 | Normally | Normally | Nothing | 0 |
| 20110904 | 5 | Normally | Normally | Nothing | 0 |
| 20110905 | 5 | Normally | Normally | Nothing | 0 |
| Control | 2 | Normally | Normally | Nothing | 0 |
The immune efficacy contrast test of embodiment quintet indigo plant otopathy subunit vaccine and traditional vaccine
This experimental selection tradition inactivated vaccine and Attenuate vaccine are as control seedling, with the blue otopathy of recombinant subunit vaccine co-immunization
Viral feminine gender piglet, each seedling is immune 5, while setting control group 2.Immune group posterior auricular muscle meat is injected, 1ml/ heads, before being immunized
0d, it is immune after 14,28,56d collection blood samples and survey antibody.Physiological saline emulsion, 1ml/ heads is immunized in blank control group.
As a result：The blue otopathy subunit vaccine of restructuring and Attenuate vaccine prepared by the present invention, immune effect quite, are significantly better than
Inactivated vaccine group, antibody level rises very fast.28 days after immune, the antibody positive rate of all vaccines reaches 100%, extremely immune
56 days afterwards, the antibody level positive rate of inactivated vaccine declined, and other two groups of antibody positive rates keep 100%.
Antibody level is detected after the different vaccine immunities of table 1
| Group | 0d | 14d | 28d | 42d | 56d |
| Recombinant subunit seedling group | 0 | 4 (80%) | 5 (100%) | 5 (100%) | 5 (100%) |
| Inactivated vaccine group | 0 | 3 (60%) | 5 (100%) | 5 (100%) | 3 (60%) |
| Attenuate vaccine group | 0 | 4 (80%) | 5 (100%) | 5 (100%) | 5 (100%) |
| Blank control group | 0 | 0 | 0 | 0 | 0 |
Claims (5)
1. a kind of nucleic acid molecules, specific composite sequence is SEQ ID No.1, it encodes a kind of vaccine protein amino acid sequence.
2. the amino acid sequence described in claim 1, specific composite sequence is SEQ ID No.2.
3. a kind of carrier, it contains the nucleic acid molecules described in claim 1.
4. a kind of host cell, it contains the carrier described in claim 3.
5. a kind of vaccine for being used to prevent pig blue-ear disease, it includes the vaccine protein described in claim 1 and can pharmaceutically connect
The carrier received.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310190308.2A CN104211783B (en) | 2013-05-22 | 2013-05-22 | A kind of preparation of blue otopathy subunit vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310190308.2A CN104211783B (en) | 2013-05-22 | 2013-05-22 | A kind of preparation of blue otopathy subunit vaccine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104211783A CN104211783A (en) | 2014-12-17 |
| CN104211783B true CN104211783B (en) | 2017-11-07 |
Family
ID=52093719
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310190308.2A Active CN104211783B (en) | 2013-05-22 | 2013-05-22 | A kind of preparation of blue otopathy subunit vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104211783B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104840954A (en) * | 2015-04-13 | 2015-08-19 | 华中农业大学 | Tilapia Streptococcus agalactiae GapA protein subunit vaccine, preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101730742A (en) * | 2007-05-30 | 2010-06-09 | 惠氏有限责任公司 | Express the raccoonpox virus of Swine virogene |
| CN101940787A (en) * | 2010-09-03 | 2011-01-12 | 朱善元 | Adjuvant for improving effect of porcine reproductive and respiratory syndrome inactivated vaccine, preparation method thereof and application thereof |
-
2013
- 2013-05-22 CN CN201310190308.2A patent/CN104211783B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101730742A (en) * | 2007-05-30 | 2010-06-09 | 惠氏有限责任公司 | Express the raccoonpox virus of Swine virogene |
| CN101940787A (en) * | 2010-09-03 | 2011-01-12 | 朱善元 | Adjuvant for improving effect of porcine reproductive and respiratory syndrome inactivated vaccine, preparation method thereof and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Expression and purification of a chimeric protein consisting of the ectodomains of M and GP5 proteins of porcine reproductive and respiratory syndrome virus (PRRSV);Jianzhong Hu et al.;《Journal of Chromatography B》;20121212;第911卷;第48页左栏结论部分和第44页2.1部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104211783A (en) | 2014-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103172749B (en) | Preparation of African swine fever protein engineering vaccine | |
| CN113943714B (en) | Callicarpa virus strain and application thereof | |
| CN108823218A (en) | Chicken infectivity bursa of Fabricius virus VP 2 gene, its expression product, its subunit vaccine and application | |
| CN104628865B (en) | A kind of pseudo- mad dog epitope polypeptide recombinant vaccine | |
| CN104628871B (en) | A kind of preparation for recombinating bursal disease protein engineering vaccine | |
| CN109467606A (en) | A kind of escherichia coli enterotoxin STa-LTB-STb fusion protein and its encoding gene and application | |
| CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN109021115A (en) | A kind of pig circular ring virus trivalent subunit vaccine | |
| CN117431200A (en) | Recombinant bacillus subtilis for displaying Newcastle disease virus HN protein on spore surface, construction method and application | |
| CN102406929B (en) | Co-expressed molecular adjuvant enhanced divalent foot and mouth disease protein engineering vaccine | |
| CN102134278A (en) | Preparation of subunit vaccine for mucosal immune in circovirus genetic engineering and application thereof | |
| CN104211783B (en) | A kind of preparation of blue otopathy subunit vaccine | |
| CN108410784B (en) | Streptococcus suis delta CPS/SsnA-mSly (P353L) -SC19 engineering bacteria and application thereof in vaccines | |
| CN110229234A (en) | A kind of haemophilus parasuis fusion protein CdtB-OppA with immune protective | |
| CN103992408A (en) | Preparation of blue ear disease protein engineering vaccine | |
| CN102847168B (en) | The design of a kind of nucleic acid vaccine PV-Fn preventing bovine mastitis and structure thereof | |
| CN105602981B (en) | Preparation method and application of porcine epidemic diarrhea virus genetic engineering subunit oral combined vaccine | |
| CN104497148B (en) | A kind of preparation for recombinating ubiquitination blue-ear disease vaccine | |
| CN107129527A (en) | A kind of Malian drainage protective antigens HP0623 and preparation method thereof | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
| CN113827714A (en) | H7N9 subtype avian influenza virus-like particle vaccine preparation and application thereof | |
| CN102372766A (en) | O-type foot-and-mouth disease multi-epitope vaccine with cross immunity protective efficiency | |
| CN106397602A (en) | A molecular adjuvant enhanced type protein engineered vaccine for chicken Marek's disease | |
| CN105907776B (en) | The subunit vaccine of the immune response for pig blue-ear disease poison can be induced | |
| CN110240657A (en) | A kind of haemophilus parasuis fusion protein AfuA-OppA2 with immune protective |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 266061 Shandong City, Laoshan Province, Zhuzhou Road, No. 153, high-level personnel entrepreneurship center, building, room 1, unit B702 Applicant after: QINGDAO MINGQIN BIOLOGICAL TECHNOLOGY CO., LTD. Address before: 266061 Shandong City, Laoshan Province, Zhuzhou Road, No. 153, high-level personnel entrepreneurship center, building, room 1, unit B702 Applicant before: Qingdao Hongqiao Mingqin Biological Technology Co., Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |