CN103992408A - Preparation of blue ear disease protein engineering vaccine - Google Patents
Preparation of blue ear disease protein engineering vaccine Download PDFInfo
- Publication number
- CN103992408A CN103992408A CN201410118926.0A CN201410118926A CN103992408A CN 103992408 A CN103992408 A CN 103992408A CN 201410118926 A CN201410118926 A CN 201410118926A CN 103992408 A CN103992408 A CN 103992408A
- Authority
- CN
- China
- Prior art keywords
- vaccine
- prrsv
- days
- protein engineering
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to preparation and application of a pig blue ear disease (porcine reproductive and respiratory syndrome, PRRSV) protein engineering vaccine. The vaccine uses body fluid and cellular immune epitopes of the main structural proteins GP5 and minor structural proteins GP3 and GP4 of PRRSV as the vaccine frame structure, the proteins are connected by a flexible linker, then put into series connection with the Thelper epitope, cloned into a pRSETB vector, transformed into Escherichia coli, and subjected to fermentation, purification, and emulsification to obtain the recombinant PRRS protein the engineering vaccine with ideal immunogenicity. The invention also relates to the usage method of the vaccine. The animal experiment shows that the PRRS protein engineering vaccine has virus attack protecting force equal to that of an attenuated vaccine and higher than that of an inactivated vaccine, can produce rapid and effective immune response, and prevent porcine reproductive and respiratory syndrome virus infection.
Description
Technical field
The invention belongs to biotechnology genetically engineered field, relate generally to the preparation and application of a kind of pig blue-ear disease protein engineering vaccine.Particularly, utilize gene recombination technology, major structural protein GP3, GP4, GP5 epitope are connected and in skeleton construction, added Thelper epi-position, be cloned into escherichia coli vector, transform Host Strains, by fermentation, purifying, emulsifying process preparation, blue otopathy protein engineering vaccine and the application of this vaccine in the great Animal diseases pig blue-ear disease of prevention obtain recombinating.
Background technology
Porcine Reproductive and Respiratory Syndrome (Porcine Reporductive and Respiratory Syndrome, PRRS), claiming that again blue otopathy (Blue ear diesase) is the pig breeding and a kind of new viral infectious that breathing syndrome virus (PRRVS) causes by Arteriviridae, is a kind of to cause the breeding difficultys such as sow heating, apocleisis, premature labor, miscarriage, stillborn foetus and piglet high mortality and to be bred as pig expiratory dyspnea, the hypoevolutism new disease as feature.This disease reported first in 1987 is in the U.S., subsequently in North America, Europe and countries in Asia and regional rapid spread, become at present a kind of region prevailing disease (Dea S etal, 1991; Yin Zhen etc., 1985; LoulaT, 1991; ShimizuM etal., 1994; LindhausW etal., 1991.).1996, China Guo Baoqing is separated to virus (North America type classical strains) first, confirms that China also exists this disease (Guo Baoqing etc., 1996), China has more than 20 province report that popular (Tian K G et al., 2007 of this disease have occurred in succession afterwards; Tian Kegong etc. 2008; Jin Ningyi, 2008), especially under 2006 over the past half year, China has 25 provinces that " porcine hyperthermia " taking high-pathogenicity porcine reproductive and respiratory syndrome virus (HP-PRRSV) as main pathogen occurred.Various places highly pathogenic PRRSV variant has following characteristics: propagate rapidly, virulence strengthens, and virulence is similar; Serious to medium and small plant and peasant household's harm; Characterization of molecules is consistent, originates from same ancestors.The high-pathogenicity porcine reproductive and respiratory syndrome virus strain that all parts of the country are separated, find the HPPRRSV height homology from different pig farms by complete ORFS and the analysis of part Nsp2 Gene sequence comparison, and on Nsp2 gene, there is a disappearance of two same locis: the 483rd of Nsp2 gene and 535-563 amino acids lack (Tong Guangzhi etc., 2007; Hao Xiaofang etc., 2007).And with the Nsp2 homology of PRRSV before 2005 be only 69.886.2%.The GP5 gene of new isolated strain is also height homology (98.5%-100.0%) each other, variation is also larger compared with former PRRSV strain, especially potential think amino acid (R13 → Q13and R151 → G151) (Madsen et al., 1998 relevant to virus virulence for two; Yang et al., 1998; Allende et al., 2000).At present, this disease be there is no to effective methods for the treatment of, although vaccine immunity can alleviate the serious situation of epidemic situation to a certain extent, still have many problems selecting of vaccine; Blue otopathy has been brought huge loss to pig industry China is popular widely, and therefore effectively to control this sick vaccine be the task of top priority in development.
There are three subject matters in the exploitation of PRRSV vaccine more effectively: (1) may induce anti-phase conditioning signal for immunity system PRRSV, has great antigenic variability in structural protein, and therefore, immunoprotection is not made clear completely.(2), as shown in (1), PRRSV heterodimer GP5-M is the main inducible protein of humoral immunization and cell immune response certainly; (3) but; secondary structure albumen is also necessary (Wissink et al. for the infectivity of PRRSV virus particle; 2005); also can play a protective role; and inducing T cell protective reaction shows that it also has limited t cell epitope (Mateu and Diaz, 2008).
PRRSV comprises 3 major structural protein GP5 (E), GP6 (M) and GP7 (N) and secondary structure Protein G P2, GP3, GP4.Result of study shows, GP2 content in virus is few, and immunogenicity is poor and in actually operating, be difficult to separating-purifying; GP3 mainly induces Cellular Immunity; GP4, GP5 (E) and GP6 (M) all can induce body to produce neutralizing antibody, wherein GP5 has 6 antigenic determinants, it is the major structural protein that induction produces neutralizing antibody, virus neutralization and anti-GP5 antibody titer are remarkable dependency ((Lopez and Osorio, 2004; Tong et al., 2009), GP5 also can cell death inducing.Nucleocapsid protein (N) immunogenicity is strong, but the antibody producing is active without neutralization, is mainly used in immunodiagnosis, is the good antigen that detects antiviral antibody.The research of Yoon etc. is found, can prevent this disease (Yoon KJ et al. to the high titre neutralizing antibody of passive input in pig body, 1996), and sow can avoid occurring breeding difficulty (Osorio FA et al., 2002) in input after high titre neutralizing antibody.This explanation, monomer liquid immunity can effectively prevent PRRSV.Pig infects after PRRSV, and 7d can detect specific antibody.Ask in whole period of infection, all can detect structural protein and Nonstructural Protein (especially Nsp2) antibody (Meulenberg JJ et al., 1995; Nelson EA et al., 1994; Oleksiewica MB et al., 2002; Wu WH et al., 2001), also not illustrate completely about the immunoprotection mechanism of PRRSV, humoral immunization and cellular immunization all can play a role.
A kind of high glycosylation albumen that GP3 albumen is encoded by ORF3.GP3 albumen has 7 N-glycosylation sites, and these glycosylation sites very conservative (Gonin et al., 1998 between different isolates; Katz et al., 1995).The location comparison of GP3 in arteritis virus glycoprotein is special, and its film topological framework is also in supposition, and its constitutional features in virus particle also exists dispute (Hedges et al., 1999; Wieringa et al., 2002).GP3 is one of the poorest albumen of conservative property between the each strain of PRRSV, and GP3 may be relevant with inducing cell immunity, and pig is produced to provide protection (Plana-Duran et al., 1997).GP3 between American-European type strain, derive amino acid whose homology be 54%～60% and also most variation occur in its N-terminal, but that the N of GP3 holds potential glycosylation site and hydrophobicity to be still is conservative.In addition, compared with LV, in the GP3 of North America type strain, the derivation amino acid of C end has the disappearance of 12 residues.There is a hydrophobic hypervariable region overlap of ORF3 and ORF4, and the N of GP4 end exists such hypervariable region.It is reported, the neutralizing site that this hypervariable region of LV contains a supposition, wherein formed the core of this neutralizing site by the primitive (59-67) of 9 Amino acid profiles, sudden change herein can cause the antigenicity of GP4 albumen change (Meulenberg JJ et al., 1997).
Stromatin (M) and GP5 glycoprotein are the main components of cyst membrane, and M and GP5 form heterodimer.From European LV strain, also isolate membrane glycoprotein GP3, but the GP3 of North America IAF-Klop strain be a kind of soluble proteins and with cyst membrane binding ability weak (Dea, S et al., 2000).The molecular weight of GP4 albumen is 31～35KD, has 4 glycosylation sites, is N-glycosylated protein, is one of viral major structural protein.GP4 albumen has an antigenic determinant that can be neutralized by monoclonal antibody, and it is between these protein extracellular 40th～79 amino acids.This region is variable at different PRRSV camber, and it may be relevant with immunoselection.The protein induced antibody of GP4 that has confirmed LV virus has neutralizing effect (Meulenberg et al., 1997), illustrate this protein have at least part be exposed to virion surface.Although GP4 albumen has neutralizing epitope, the appearance of GP4 antibody and the NAT of serum seem non-correlation (Zhang etal., 1998).Yoo etc. (2005) think that GP4 plays a role in signal transduction and the drift of mediation double-layer of lipoid.Meulenberg etc. have identified a neutral zone in the ORF4 of LV strain proteins encoded GP4, show that this protein induced antibody has neutralizing effect, but this epi-position is not conservative between North America strain and European strain.And, effective for the active monoclonal antibody not as GP5 of neutralization of the monoclonal antibody of GP4.In LV strain GP4 albumen and territory is a hydrophilic domain, near N-terminal (AA40-79), is highly to make a variation between American-European strain.Kwang is equal to the ORF4 of escherichia coli expression PRRSV North America Reference Strains, and western blot test shows, only has 65% PRRSV positive serum and this restructuring GP4 react (Gonin P etal, 1999 in America & Canada pig farm; Kwang J etal., 1994).But, in the virus of rehabilitation porcine blood serum and the antibody non-correlation of titre and anti-GP4.The GP4 albumen of insect cell expression North America strain VR-2385 for Zhang etc., 4 strain monoclonal antibodies of preparation do not neutralize activity, and they are all for conformation dependent epi-position (Zhang Y etal., 1998).Show with the neutralizing monoclonal antibody research of anti-GP4, GP4 albumen is exposed to the surface of virus particle, may and virus, cell between interaction relevant.
The biological function of GP5 is extremely important, mainly in virus infection, Cell binding and viruses adsorption, works, and is also the target spot that lymphocytosis is replied.GP5 albumen contains multiple neutralizing epitopes (Pirzadeh B etal., 1997; Pirzadeh B etal., 1998; Weiland E et al., 1999; Zhang Y etal., 1998), thering is neutralization by monoclonal antibody prepared by restructuring GP5 albumen active, virus neutralization and anti-GP5 antibody titer are remarkable dependency.For in the monoclonal antibody of GP5 and specific activity for other albumen as stronger (Weiland E et al, 1999) of the monoclonal antibody of GP4 albumen.Research shows, GP5 albumen at least comprise two types in and antigenic determinant, some are linear determinant (Pirzadeh B etal.1998), also having some is conformation dependent determinant (Weiland E et al., 1999; Zhang Y etal., 1998).People reports, no matter is natural infection or experimental infection, and the antibody of M albumen is but early than the antibody of other albumen.Because the conservative property of this albumen is better, so significant in its diagnostics (Mengeling W L et al., 1995).
PRRS from since give world's pig industry caused huge harm.Although attenuated vaccine and deactivation vaccine are applied to controlling virus infection, because the defect of itself inherence makes immune effect not very good.Living vaccine can only be protected the attack of homology virus, and to the protection effect of allos strain poor (Mengeling W Let al., 2003; Meng X J, 2000).Living vaccine can only improve the clinical symptom of part, and can not preventing infection.In addition, living vaccine also may occur that virulence returns strong danger (Opriessnig T et al., 2002).On the other hand, the effect of deactivation vaccine prevention and control disease is poorer.
Summary of the invention
The present invention is the effect in virus infection according to different structure albumen, select the epi-position of major structural protein GP5 and secondary structure Protein G P3, GP4 as vaccine skeleton construction, after connecting by flexible linker, connect with Thelper epi-position again, after being cloned into pRSETB carrier, transform intestinal bacteria, by fermentation, the technique such as purifying, emulsification, obtain and there is the blue otopathy protein engineering of desirable immunogenic restructuring vaccine.Utilize vaccine prepared by the present invention can effectively prevent the infection of pig blue-ear disease.
One of object of the present invention has been to provide a kind of new protein engineering vaccine polypeptide and the vaccine composition thereof that can be used for preventing blue otopathy; Two of object of the present invention has been to provide structure and the preparation method of described protein engineering vaccine; Three of object of the present invention has been to provide the engineering strain that can express described blue otopathy protein engineering vaccine; Four of object of the present invention has been to provide the preparation method of described blue otopathy protein engineering vaccine; Five of object of the present invention has been to provide the purposes of described protein engineering vaccine in the blue otopathy of prevention.
In first aspect, the invention provides a kind of for preventing protein engineering vaccine polypeptide and the composition thereof of blue otopathy.It contains main structural protein GP5 and secondary structure Protein G P3, GP4 is screened to the epitope and the Thelper epi-position that obtain.Described protein engineering vaccine protein or polypeptide or pharmacy acceptable salt and the needed carrier of antigen expressed epi-position.Carrier also can comprise the sequence of the each epitope of independent coding, and series connection can be undertaken by genetic engineering method.Described vaccine also comprises nonimmune active substance, be the connection portion of each polypeptide, do not there is the immunogenicity of epitope, do not there is any adjuvanticity yet, mainly contain purification tag, joint peptide, chemically modified part, N end signal peptide and C end polyadenylic acid etc.Described pharmacy acceptable salt refers to nontoxicity, stimulation and transformation reactions, is applicable to the salt of human or animal tissues.Inactive substance and pharmacy acceptable salt are well known to those skilled in the art.
In second aspect, the invention provides a kind of nucleic acid molecule, the blue otopathy protein engineering vaccine polypeptide of its coding described in first aspect present invention.In the present invention, Nucleotide can be rna form, DNA form, by the synthetic many epitopes tandem sequence of synthetic mode, then enters carrier through genetically engineered operation connection rear clone, be transformed into intestinal bacteria, after screening, fermentation, purifying, obtain blue otopathy protein engineering vaccine polypeptide.Can carry out conventional molecular biology operation to this nucleic acid in the present invention, as: PCR, digestion with restriction enzyme, connection etc., nucleic acid design 5 ' end and 3 ' end all add restriction enzyme site.Preferably the nucleotide sequence in the present invention is as follows:
GCAAAGTTCGTTGCAGCATGGACCCTGAAAGCAGCAGCAATCTCCGAGATCAAGGGTGTCATCGTCCACAAGATCGAGGGGATCGGTTCTGGTATAGGGCATGACCGATGTAGTGAGAACGATCATGACGAACTAGTTCACGACGGGGATAACGCCACCTTGCCTCGCCATGACAATATTGTCTTTCGGACATCAAAACCAACACCACCGCAGCATCAGGGTTCTGGTCCATGTTTCAGTTCGAGCCTTTCGGACATCAAAACCAACACCTCCGCAGCATCAGACTTCGTTGTCCTCCAGGACATCAGCTGCCTTAGGCATGGCGACTCGTCCCCTCCGACGGTTCGCAAAATCCCTCAGTGCCGCTCTGAGATGAGTGAAAAGGGATTCAAAGTGGTGTTCGGCAATGTGTCAGGCATCGTGGCTGTGTGCGTCAACTTTACCAGCTACGTCCAACACGTCAAGGAGTTTACCCAACGCTCCTTAGGTGGTGCCAACCCAAACAACAGCTCTTATTCACAGTTGATTTATAACCTGACACTATGTGAGCTGAATGGCACAGATTGGTTGGTGAAGAATTGCATGTCTTGGCGCTACTCATGTACCAGGTATACTAATTTTCTTTTAGACACCAAAGGCAAAATTTATCGTTGGCGATCACCCGTCATCATAGAGAAAGGGGGAAAAGTTGAGGTCGAGGGCCACCTCATCGACCTCAAGAGAGTTGTGCTTGATGGTTCCGCGGCTATCCCTGTAACCAAAATTTCAGCTGAGCGATGGGGTCATCCC
In the third aspect, the invention provides a kind of carrier, it is except containing the blue otopathy protein engineering of the coding vaccine nucleic acid molecule described in second aspect present invention, also contain with this nucleotide sequence is exercisable and be connected, at the required expression controlling elements of procaryotic cell expression (transcribe and translate).The most basic expression controlling elements comprises promotor, transcription terminator, enhanser, selected marker etc., and these controlling elements are known in the art.In a preferred embodiment, described expression vector is coli expression carrier.
In fourth aspect, the invention provides a kind of host cell, it contains the carrier described in third aspect present invention.Host cell is through transforming or the transfection gene order that contains proteins encoded of the present invention, then has after testing after good Inheritance and expression stability, can be used for fermentation expression and produces required blue otopathy protein engineering vaccine polypeptide.
Aspect the 5th, the invention provides a kind of preparation method of blue otopathy protein engineering vaccine, it comprises the following steps: engineering bacterium fermentation expressing protein engineered vaccine polypeptide, through thick purifying and polishing purification technique and follow-up emulsifying process, obtains needed recombiant vaccine.The method wherein relating to includes, but are not limited to the washing of bacterial cell disruption, inclusion body, centrifugal, sex change, affinity chromatography, hydrophobic chromatography, anion-exchange chromatography, reverse-phase chromatography, renaturation, emulsification etc.The preparation method who relates in the present invention is well known to those skilled in the art.
Aspect the 6th, the invention provides a kind ofly for preventing the recombinant protein engineered vaccine of pig blue-ear disease, it comprises polypeptide and pharmaceutically acceptable carrier described in first aspect present invention.Described protein engineering vaccine can prevent the outburst of pig blue-ear disease.Pharmaceutically acceptable carrier of the present invention is immunostimulant or immunological adjuvant, and preferably immunological adjuvant is import white-oil adjuvant.
Aspect the 7th, the invention provides the application of the blue otopathy protein engineering of the restructuring vaccine described in the 6th aspect.Vaccine is effective dose intramuscular injection necessarily, and intracutaneous or subcutaneous injection or intranasal vaccination injection animal, can induce the body fluid of q.s and cellular immunization that antiviral activity is provided, and watches for animals and avoid the attack of blue otopathy epidemic isolates.In addition; in embodiments of the invention; by being carried out to target animals, vaccine attacks malicious simultaneous test, laboratory safety test etc.; show that the blue otopathy protein engineering of restructuring of the present invention vaccine is safe (seeing embodiment tetra-), can watch for animals and avoid reproductive and respiratory syndrome virus infection (seeing embodiment five, six, seven, eight, nine, ten).
In addition, it is pointed out that the aspect that other have substantive distinguishing features of the present invention is apparent to the ordinary skill people of this area on the basis of the application's contextual disclosure.In addition, the present invention has also used open source literature, and their full text content is all included in and carried out reference herein.
Brief description of the drawings
Following accompanying drawing is used for illustrating specific embodiment of the invention scheme, limits and be not used in the scope of the invention being defined by claims.Fig. 1 blue otopathy protein engineering vaccine expression vector pRSETB-PRRSV (GP3/4/5) design of graphics of recombinating; Fig. 2 pRSETB-PRRSV (GP3/4/5) vector plasmid cleavage map, wherein swimming lane 1 is DNAmarker, and molecular weight is followed successively by 2000bp, 1000bp, 750bp, 500bp, 250bp from top to bottom, and swimming lane 2 is plasmid enzyme restriction figure, swimming lane 3 is cut contrast, the negative contrast of swimming lane 4 for enzyme not; Fig. 3 SDS-PAGE detects figure, wherein swimming lane 1 is albumen Marker, be followed successively by from top to bottom 97.2KD, 66.4KD, 44.3KD, 29.0KD, 20.1KD, 14.3KD, swimming lane 2 is the negative control sample of not inducing, the positive contrast of swimming lane 3, swimming lane 4 is the sample of induction, and arrow indication is the target protein of expressing; Fig. 4 Westernblot detects figure, and wherein swimming lane 1, for dying in advance marker, is followed successively by 97KD, 66KD, 43KD, 31KD, 20KD, 14KD from top to bottom, the positive contrast of swimming lane 2, and the negative contrast of swimming lane 3, swimming lane 4 is target protein.Fig. 5 is mice serum GP5 detection of specific antibody result; Fig. 6 stimulates hamster kidney cell T lymphproliferation response for PRRSV; Fig. 7 stimulates piglet PBMC T lymphproliferation response for PRRSV; Fig. 8 is PRRSV neutralizing antibody level detection result; Fig. 9 is the mean value that virus-specific (memory antigenic stimulation) produces frequency and spontaneous (background) IFN γ-SC; Figure 10 is the detected result of the spontaneous generation IL-10 of PBMC.
Embodiment
It is only exemplary description that concrete test method described in embodiment is described, and for elaborating the present invention, but does not form limitation of the scope of the invention, knows according to many those skilled in the art of being changed to of the present invention.
The structure of embodiment mono-coli expression carrier and expression strain
The peptide coding Nucleotide designing is served to extra large handsome biotech company synthetic, EcoRI (5 ' end) and HindIII (3 ' end) restriction enzyme site have been designed respectively in nucleotide fragments two ends, being cloned into respectively after this segment condense on pMD18T carrier, sequencing confirms to insert gene fragment consistent with implementation sequence (seeing sequence table).By recombinant plasmid called after pMD18T-PRRSV (GP3/4/5) respectively.With corresponding restriction enzyme, two kinds of plasmids are carried out to enzyme and cut processing, coli expression carrier is selected the pRSETB plasmid of Invitrogen company, also use identical restriction enzyme processing, enzyme tangent condition: 10 μ l reaction systems, in system, add 2 μ l plasmids, restriction enzyme is 5 activity units (New England biolabs), adds 10 × damping fluid, 1 μ l, deionized water polishing, 37 DEG C of enzymes are cut 90min.Enzyme adds 1 μ l200mM EDTA termination reaction after cutting end.In 1% agarose gel electrophoresis, electrophoresis 30 minutes.Under ultraviolet lamp, 2.88kb pRSETB plasmid and 796bp PRRSV (GP3/4/5) fragment are cut, reclaim test kit specification sheets according to Qiagen company gel and carry out glue recovery.According to carrier: the ratio of fragment=1: 2-3 by multi-epitope nucleotide fragments separately and expression vector mixing, reaction system 15 μ l, connected by T4DNA ligase enzyme, 16 DEG C of connections are spent the night, obtain recombinant plasmid called after pRSETB-PRRSV (GP3/4/5) respectively, (seeing Fig. 1), transformed competence colibacillus e. coli bl21 (DE3) pLysS.
Transform: pRSETB-PRRSV (GP3/4/5) is put on ice and melted, add 2 μ l Ligature liquid, again mix, ice-water bath 30 minutes, 42 DEG C 30 seconds, then put back to rapidly ice bath 1.5 minutes, add 1ml LB nutrient solution, 37 DEG C, leave standstill and cultivate 1 hour, 4000g low-temperature centrifugation is abandoned supernatant 10 seconds, with the resuspended thalline of 200 μ lLB substratum; Bacterium liquid is evenly coated on the LB agar culture plate that contains 100 μ g/mL penbritins, be inverted in 37 DEG C of thermostat containers and cultivate 12-16 hour, until clone forms.
Qualification: the mono-clonal on picking flat board is to LB substratum, 37 DEG C, 180rpm concussion is cultivated 12 hours, extract plasmid, use respectively restriction endonuclease EcoRI and HindIII to carry out double digestion, the clone of corresponding blue-ear disease vaccine gene size fragment can be cut out for 800bp left and right, positive colony (seeing Fig. 2) can be tentatively defined as; Positive colony carries out determined dna sequence and further verifies its exactness (seeing sequence table).
Abduction delivering.By positive colony incubated overnight, by switching in 1: 100, cultivate after 3 hours morning next day, adds 0.5mM IPTG, continues to cultivate 3 hours, prepares sample; Conventional SDS-PAGE testing goal protein expression situation---at 33.8KD (seeing Fig. 3), see specific band for correct clone; Get correct clone, amplification culture, after SDS-PAGE confirms to express correctly, is used conventional Western-blot further to confirm its expression accuracy (seeing Fig. 4); After above-mentioned structure and qualification program, can carry out using the positive colony of selecting as engineering bacteria the foundation of original species word bank, bacterial classification name pRSETB-PRRSV (GP3/4/5)/BL21 (DE3, Plys).
Fermentation, purifying and the emulsification of embodiment bis-engineering bacterias
Production bacterial classification is got in fermentation, is inoculated in (containing 100 μ g/ml penbritins) in 2ml LB liquid nutrient medium, and 37 DEG C, 12 hours activated spawn of 180rpm shaking culture.With the inoculum size access shaking flask of 1: 100,37 DEG C of shaking culture, to OD600=3, can be inoculated into fermentor tank in 10% ratio again.Fermentation is semisynthetic medium with substratum, with distilled water preparation, does not wherein contain any microbiotic.Proofread and correct dissolved oxygen and pH value electrode, open tank body and stir, revolution is 300rpm, the online sterilizing of tank body, and when in tank, culture-liquid temp is down to 37.0 DEG C, demarcation pH and dissolved oxygen (OD) zero point.Leavening temperature is 37.0 ± 0.1 DEG C, dissolved oxygen is controlled at 20% left and right, pH is controlled at 7.0, after inoculation, cultivate thalline OD600=1.0～1.2 o'clock flow feeding 500ml, within after feed supplement 1 hour, add IPTG (final concentration is 0.5mM) abduction delivering, continuous induction secondary fermentation in 6 hours finishes, and SDS-PAGE calibrating expression is done in sampling.
Purifying is by the thalline of collecting, ultrasonic with carrying out after occlusion body washing lotion (1%Triton X-100,20mMTris-cl PH8.0) suspendible, 2000W ultrasonic degradation 1 hour, 4 DEG C, the centrifugal collection occlusion body of 12000rpm, uses 4M Guanidinium hydrochloride, 0.2% β-ME, 20mM Tris-cl (pH=8.00) mixes, stirring at room temperature 4 hours, 8000rpm low-temperature centrifugation 30min, discards precipitation.Metaprotein dilution in 1: 100, Tris for renaturation solution (PH8.0) buffer system, adds 0.3M arginine, and 4 DEG C are stirred renaturation 24 hours.The 20mM phosphoric acid buffer of pH=8.0 for renaturation solution, 0.5M sodium-chlor, 20mM imidazoles, affinity column in balance, with the 20mM phosphoric acid buffer of pH=8.0,0.5M sodium-chlor, 0.5M imidazoles wash-out; The blue otopathy protein engineering vaccine work in-process stoste of must recombinating.Do SDS-PAGE and the Western blot marking and examine and determine whether purified product is target protein.
Emulsification is diluted to 200 μ g/ml by the work in-process of purifying with the PBS of sterilizing.Get import white mineral oil adjuvant DUOPRIME (pharmaceutical grade) through 121 DEG C, sterilizing 15 minutes, for subsequent use.In oil phase: water=50: 50 ratio preparation, first oil phase is added in emulsion tank, start stirrer and slowly stir with the speed of 80-100r/min, slowly add water, after adding, stir again 2min, then, with 5500r/min high-speed circulating emulsification 9min, make the single-phase vaccine of water-in-oil.
The embodiment tri-blue otopathy protein engineering vaccine safety test of recombinating
1 material
1.1 vaccines: provided by the biological research and development centre of Bao Maide, lot number is 20120611,20120612,20120613.
1.2 experimental animals: 18-22g Balb/C small white mouse is purchased from Beijing China Fukang.Healthy three way cross piglet is provided by the pharmacy of Yongshun, Guangdong 30 ages in days.
2 methods
The security of 2.1 vaccines to small white mouse
Subcutaneous injection 18-22g Balb/C small white mouse, every injection 0.5ml, 5 of the every batch of vaccinations, three totally batches, inject 15 small white mouses, set 2 negative controls simultaneously, Continuous Observation 10 days, observes the healthy state of small white mouse.
The security of 2.2 vaccines to piglet
Select the healthy three way cross piglet of 30 ages in days, every blue otopathy protein engineering vaccine of posterior auricular muscle meat injection restructuring, 5 every batch, three totally batches, inject 15 piglets, set up 2 of negative controls simultaneously, every injecting normal saline emulsion 2ml, clinical observation 14 days.
3 results
The safety testing of 3.1 vaccines to small white mouse
Result is as table 1, and after immunity, the appetite of all mouse, spirit and healthy state are without extremely, consistent with control group, occurs without dead, and the blue otopathy protein engineering vaccine of recombinating is as seen safe to small white mouse, in table 1.
The safety testing result of table 1 vaccine to small white mouse
| Group | Size of animal | Body temperature | Appetite | Spirit | Healthy state | Dead quantity |
| 20120611 | 5 | Normally | Normally | Normally | Be in a good state of health | 0 |
| 20120612 | 5 | Normally | Normally | Normally | Be in a good state of health | 0 |
| 20120613 | 5 | Normally | Normally | Normally | Be in a good state of health | 0 |
| Contrast | 2 | Normally | Normally | Normally | Be in a good state of health | 0 |
The safety testing of 3.2 vaccines to piglet
Result is as table 2, in whole 14 days experimental observation phases, and the piglet of all immunity, body temperature, spirit and appetite are all normal, do not occur any clinical unusual phenomenon, after off-test, all strong living of 15 piglets.2 piglets of contrast adjuvant group are also without any untoward reaction.This explanation, the blue otopathy protein engineering vaccine of recombinating is safe to piglet.
The safety testing result of table 2 vaccine to piglet
| Group | Size of animal | Body temperature | Appetite | Spirit | Unusual condition | Dead quantity |
| 20120611 | 5 | Normally | Normally | Normally | Nothing | 0 |
| 20120612 | 5 | Normally | Normally | Normally | Nothing | 0 |
| 20120613 | 5 | Normally | Normally | Normally | Nothing | 0 |
| Contrast | 2 | Normally | Normally | Normally | Nothing | 0 |
The grouping of the blue otopathy protein engineering of embodiment quadruple group seedling potency test animal, immunity, evaluation method
For the efficiency evaluation parameter that obtains vaccine as much as possible, the present invention has detected PRRSV and has attacked the development and change situation after poison, comprises and measures anus temperature, relative day weight gain, humoral immunization, cell immune response, virus sweep parameter and lungs and lymphoglandula are detected to pathological change.
1 experimental animal
36 90kg two-way cross Adult Pigs, male and female half and half, 5 months mean aves, detect without PRRSV, PRV and infect through IDEXX ELISA commercial kit, test pig environmental adaptation one week before starting to test.
2 vaccines
The blue otopathy protein engineering vaccine of recombinating is provided by the biological research and development centre of Bao Maide, lot number is 20120611,20120612,20120613, PRRSV deactivation vaccine (NVDC-JXA1 strain) and weak malicious seedling (JXA1-R) are so kind as to give by pharmaceutical development center, Yongshun, Guangdong, and lot number is respectively 2012015,2012033.
3 test design and method
Animal rearing, at BSL-2 insulated chamber, 5/, is guaranteed one of a group.Animal immune, attack poison, sampling according to test schedule (in table 3) carry out.Animal is divided into random 6 groups, 5 every group of weak malicious seedling and recombinant protein engineering seedling immune group, and 8 every group of deactivation vaccine immune group and control groups, slaughter 5 for 42 days, remains 3 for follow-up test.Head exempts from rear two weeks booster immunizations once, 2ml/ head.Head exempts from latter 28 days all animals with 10
5.0tCID
50in PRRSV (NVDC-JXA1) nose, approach is attacked poison.Attack poison and a few days ago record anus temperature latter 10 day every day to attacking poison, body weight detects attacks poison latter 14 days, observes infection conditions.Head exempts from rear different time, gathers serum and heparinized blood sample.Serum detects (ELISA or SVN) for serology, uses quantitative PCR (qPCR) to detect viremia.Heparinized blood samples separates the detection of PBMC (peripheral blood lymphocytes) for ELISPOT detection IFN γ secretory cell (SC).Attack latter 14 days (head exempts from latter 42 days) of poison, slaughter total Test animal, get tissue and analyze and pathology detections (lung and lymphoglandula) for qPCR (tonsilla and lung).
Table 3 vaccine potency search time table
Note: the number of days of time after exempting from headed by all described in this column (my god).
Embodiment five PRRSV attack the rear clinical observation of poison
Self tapping poison is a few days ago to attacking after poison to 14 days, every mornings 10 point measurement body weight, calculate immune group and the relative day weight gain of control animals, measure anus temperature measure of the change to attacking malicious latter 38 days.Attack poison latter 14 days, immune latter 42 days, lungs and the lymph node tissue of slaughtering animal are carried out to pathology detection (HE dyeing).
Result
1, relative day weight gain and anus temperature
Vaccine immunity target animals was attacked poison after 28 days, all there is not obvious clinical symptom in the whole all experimental animals of poison period three kind vaccine immunity group of attacking, control group shows by clinical apparent symptoms such as the thick unrest of hair, appetite stimulators gradually from attacking starting for 3 days poison, and all control animals body temperature exceedes 40 DEG C simultaneously.Attack the rear second week of poison, attacking malicious control group has 3, and body temperature exceedes 40 DEG C.5 immune group whole attack malicious process in body temperature remain normal.To attacking poison latter 14 days, control group weightening finish is starkly lower than immune group, day weight gain significant difference (P < 0.05) relatively, the relative day weight gain of deactivation vaccine immune group is lower than recombinant protein seedling sets of batches and weak malicious seedling immune group, but do not present significant difference (P >), in table 4.
Table 4 relatively day weight gain detects
| Time | 20120611 (restructuring) | 20120612 (restructuring) | 20120613 (restructuring) | 2012015 (deactivations) | 2012033 (weak poison) | Control group |
| 26 days | 0.0137±0.0011 I | 0.0141±0.0012 I | 0.0134±0.0017 I | 0.0112±0.0015 I | 0.0151±0.0012 I | 0.0138±0.0013 I |
| 27 days | 0.0128±0.0009 I | 0.0123±0.0011 I | 0.0145±0.0016 I | 0.0133±0.0013 I | 0.0143±0.0016 I | 0.0154±0.0009 I |
| 28 days | 0.0143±0.0012 I | 0.0133±0.0006 I | 0.0155±0.0015 I | 0.0135±0.0012 I | 0.0134±0.0013 I | 0.0136±0.0015 I |
| 29 days | 0.0151±0.0015 I | 0.0148±0.0013 I | 0.0121±0.0014 I | 0.0109±0.0014 I | 0.0126±0.0008 I | 0.0093±0.0008 II |
| 30 days | 0.0122±0.0010 I | 0.0132±0.0012 I | 0.0137±0.0011 I | 0.0123±0.0011 I | 0.0131±0.0014 I | 0.0054±0.0006 II |
| 31 days | 0.0138±0.0011 I | 0.0134±0.0015 I | 0.0147±0.0013 I | 0.0114±0.0011 I | 0.0149±0.0011 I | 0.0062±0.0008 II |
| 32 days | 0.0158±0.0008 I | 0.0144±0.0015 I | 0.0134±0.0011 I | 0.0131±0.0016 I | 0.0133±0.0012 I | 0.0071±0.0009 II |
| 33 days | 0.0137±0.0013 I | 0.0126±0.0012 I | 0.0135±0.0012 I | 0.0126±0.0013 I | 0.0138±0.0014 I | 0.0068±0.0013 II |
| 34 days | 0.0135±0.0013 I | 0.0138±0.0011 I | 0.0119±0.0009 I | 0.0118±0.0009 I | 0.0141±0.0013 I | 0.0075±0.0011 II |
| 35 days | 0.0129±0.0014 I | 0.0142±0.0014 I | 0.0128±0.0007 I | 0.0119±0.0012 I | 0.0146±0.0015 I | 0.0075±0.0007 II |
| 36 days | 0.0155±0.0012 I | 0.0121±0.0008 I | 0.0131±0.0012 I | 0.0102±0.0013 I | 0.0139±0.0009 I | 0.0091±0.0009 II |
| 37 days | 0.0162±0.0009 I | 0.0151±0.0011 I | 0.0142±0.0014 I | 0.0121±0.0014 I | 0.0128±0.0017 I | 0.0086±0.0005 II |
| 38 days | 0.0157±0.0010 I | 0.0133±0.0013 I | 0.0144±0.0015 I | 0.0115±0.0011 I | 0.0147±0.0016 I | 0.0079±0.0012 II |
| 39 days | 0.0163±0.0016 I | 0.0144±0.0013 I | 0.0151±0.0018 I | 0.0113±0.0015 I | 0.0137±0.0011 I | 0.0098±0.0011 II |
| 40 days | 0.0148±0.0012 I | 0.0132±0.0011 I | 0.0128±0.0011 I | 0.0108±0.0013 I | 0.0129±0.0008 I | 0.0076±0.0008 II |
| 41 days | 0.0155±0.0009 I | 0.0136±0.0008 I | 0.0133±0.0013 I | 0.0116±0.0014 I | 0.0142±0.0013 I | 0.0082±0.0010 II |
| 42 days | 0.0149±0.0014 I | 0.0128±0.0013 I | 0.0146±0.0015 I | 0.0127±0.0008 I | 0.0151±0.0012 I | 0.0091±0.0012 II |
Note: 1, mean value significant difference between I, II representative group; 2, the time be time after first immunisation (my god).
2, pathology lesion detection
5 immune group of three kinds of vaccines detect respectively, and lung's pathology pathology of animal is taking segmental bronchus peripheral lymphoid plasmocyte core histocyte and segmental bronchus interstitial pneumonia as feature, and lymph node pathological change is taking the exhaustion of lymphoglandula folliculus lymphocyte as main.Control animals lung tissue carries out pathology detection, has 1 serious pathology, 2 moderate pathologies, 2 slight pathologies, lymph node pathology lesion detection, has 3 moderate pathologies, 1 slight pathology, 1 serious pathology, compared with immune group, pathology score value difference presents significant difference.Immune group animal, except 20120212 (restructuring) group is without pathology, other restructuring lot number immune group and weak poison group all have 1 visible slight segmental bronchus interstitial pneumonia, deactivation vaccine to have 2 to occur slight pathology; In addition, except 20120613 (restructuring) group, other restructuring lot number vaccine group and weak poison group all have 1 the exhaustion of slight lymphoglandula folliculus lymphocyte to be detected, and deactivation vaccine immune group has 2 to occur pathology the results are shown in Table 5.
Table 5 experimental animal lymph node tissue pathological observation
| Grouping | 20120611 (restructuring) | 20120612 (restructuring) | 20120613 (restructuring) | 2012015 (deactivations) | 2012033 (weak poison) | Control group |
| Lung | 1／5(0.2) I | 0／5(0.0) I | 1／5(0.2) I | 2／5(0.4) I | 1／5(0.2) I | 5／5(1.8) II |
| Lymphoglandula | 1／5(0.2) I | 1／5(0.2) I | 0／5(0.0) I | 2／5(0.4) I | 1／5(0.2) I | 5／5(1.4) II |
Note: 1: the numerical value in bracket be average tissue pathology value (0, normal; 1, slight pathology; 2, moderate pathology; 3 severe pathologies); 2: mean value significant difference between I, II representative group in each row.
Embodiment six vaccine immunities produce the detection of protection to virus sweep effect
Head is exempted to RNA in rear experimental animal sample and extract, see that TiangenRNA extracts test kit operation instructions.QPCR method, by wantonly hundred bright the providing of research and development centre, adopts TaqMan probe mark, and length is 20bp, and expanding fragment length is 211bp.Primer is synthetic by Shanghai English fine horse.Wherein forward primer: 5 '-ATGTTGGGGAAATGCTTGAC-3 ', anti-phase primer: 5 '-TCGCTCAGCTGAAATTTTGG-3 ', TaqMan probe: 5 '-FAM-TCTTGACACAGTCAGCC TGG-TAMRA-3,25 μ L systems for fluorescent quantitation reverse transcription reaction, the RNA sample 5 μ l that extract make template, the each 1 μ l of probe and upstream and downstream primer, dNTP4 μ l, Taq archaeal dna polymerase 0.2 μ l, 5 × Buffer5 μ l, add DEPC H
2o to 25 μ l; Response procedures: 95 DEG C of denaturations 3 minutes, 95 DEG C of sex change 30 seconds, 60 DEG C of annealing 30 seconds, 72 DEG C are extended 40 seconds, totally 40 circulations.Use OPTICON2 quantitative real time PCR Instrument (MJ) to collect the signal of amplification, and analytical results.
Result
Attack PRRSV carrying capacity mean value in the rear serum of poison and see Fig. 5.The PRRSV quantifying PCR method that this detection is used, average susceptibility threshold value is 1.0E03 copy/ml RNA, in recombinant protein seedling immune group and weak malicious seedling immune group serum, whole attacking in the rear time of poison do not detect PRRSV always, by contrast, attack in the poison observation period of latter two weeks whole, nonimmune control group and deactivation vaccine group show as obvious viremia, at most higher than detection level 3logs (seeing Fig. 5), compared with control group, except 38 days (attacking poison latter 10 days) after exempting from head, there is the viremia (seeing Fig. 5) apparently higher than control group in deactivation vaccine group, other times inactivated vaccine group is all lower than control group, but do not show obvious difference (P > 0.05).The individual viremia value of every treated animal is in table 6.Fig. 6 is the virus load result that in (lung and tonsilla), qPCR detects in the time of butchering (attack poison latter 14 days, head exempts from latter 42 days) selected tissue.Recombinant protein vaccine and weak malicious seedling immune group PRRSV carrying capacity obviously reduce, and 4/5～5/5 animal lungs are organized and viral RNA molecule (seeing Fig. 6, table 7) do not detected.And inactivated vaccine group and control group virus load difference are not obvious, but apparently higher than recombiant vaccine group and weak malicious seedling group (P < 0.01).
Table 6qPCR detects viremia result in serum
Note: by≤10
3rNAmol/ml is defined as 0, and data do not show.
Embodiment seven serum evaluations
With commercialization ELISA (IDEXX, porland, ME) detection serum, analyze the generation of PRRSV antibody.The kinetics of ELISA sero-reaction is assessed in the situation of commercial kit S/P ratio.Virus neutralization detection: PRRSV attacks malicious antibody titers (Lelystad) and (SNV) detects with fluorescence focusing neutralization, with reference to Wu etal, and 2001, detect with serum sample use front through 56 DEG C of deactivation 30min.
Result
The generation kinetics of PRRSV specific antibody reaction detects by ELISA method, 6 experimental group the results are shown in Figure 7, recombinant protein vaccine group and immune group just show active antibody male rotary kinetics beginning from immunity.After head exempts from, 28 days PRRSV
PRRSV detected result in table 7 tissue
Note: by≤10
3rNAmol/ml is defined as 0, and data do not show.
Attack poison and start, antibody response memory enhancement in serum, do not detected.PRRSV attacks the rear antibody horizontal kept stable of poison.In addition, although carried out the booster immunization of deactivation vaccine, attack before poison, the animal of inactivated vaccine group 4/5 does not demonstrate detectable seropositive conversion.PRRSV attacks after poison, and inactivated vaccine treated animal shows as obvious increase, and with the antibody positive phase inversion ratio gradually of control group, it is more quick and tight that sun turns, and the latter is the typical initial reaction that PRRSV infects.Fig. 8 is PRRSV neutralizing antibody level detection result: (1) recombinant protein vaccine and attenuated vaccine immunity group, within 28 days after head exempts from, induce low-level NA, this induces low-level PRRSV NA response feature with previous relevant weak malicious seedling strain is identical (Meier et al., 2003).The reaction of observing with ELISA is consistent, and PRRSV can not stimulate the NA fast of memory to raise.(2) deactivation vaccine immunity has also produced faint neutralizing antibody; But, to attack after poison at PRRSV, deactivation vaccine group shows strong memory neutralizing antibody reaction, quicker and strong than control group.
The detection of embodiment eight virus-specific Interferon, rabbit (IFN γ) reaction
Attack before and after poison, the Cell regulate immune response for PRRSV that immunity excites detects (Mateu de Antonio et al., 1998 by ELISPOT method; Meier et al., 2003), to add up virus-specific IFN γ-SC in PBMC group (peripheral blood mononuclear cells), briefly, method is as follows:
1, the separation of PBMC
Pig PBMC separates from fresh venous blood, uses 5mM heparin anti-coagulating.1500r/min, 37 DEG C of centrifugal 30min, collect leukocytic cream.Twice of 15ml Hanks balanced salt washing for PBMC, RPMI substratum suspendible, add 5% calf serum (Life Technologies simultaneously, Gaithersburg, MD), 100U/ml penicillin (Sigma), 100mg/ml Streptomycin sulphate (Sigrna), 100U/ml gentamicin (Sigma), 4mM Pidolidone salt (Sigma), 1mM Sodium.alpha.-ketopropionate (Life Technologies), the nonessential amino acid of 10mM MEM (Life Technologies), and250mM2-mercaptoethanol (Sigma).
2, ELISPOT determines IFN γ-SC frequency detecting in PBMC
Quantitatively (method is shown in Zuckermann et al., 1999) of IFN γ ELISPOT for the degree of different immune group and control animals PRRSV specific cell immunoreaction.In simple terms, 96 hole Immulon II TM plates are coated by 50ml/ hole 10mg/ml monoclonal antibody, and buffer system is 0.1M carbonate buffer solution (PH9.6).4 DEG C of incubated overnight, aseptic PBS washing three times for every hole then adds 5% calf serum, in 37 DEG C of CO in RPMI suspension
2in incubator, hatch 2 hours.The PBMC of control group will reach every hole 5 × 10
5individual visible cell.Confirm in all samples that by the active somatic cell colorimetric method of exclusion 98% PBMC is alive.The external anamnestic reaction for PRRSV is by the antigen activates to add PRRSV alive (Lelystad) form.Titration PBMC stimulates relevant suboptimum dosage to determine memory virus antigen dosage.This quantity is determined in the scope of multiple infection (MOI): 0.1-1.0.
PBMC is in 37 DEG C, CO
2in environment, be exposed in virus antigen 2 hours.PBST (0.05%Tween20) washing removes cell 6 times.In 50 titration holes, add the biotin labeled mAb P2C11 of 0.5mg/ml ((MateudAntonio et al., 1998)), PBST (0.05%tween20) buffer system, titer plate is at 37 DEG C, hatch 1 hour, after washing, add the antibody of HRP (Sreptavidin-horseradish peroxidase) mark, by washing, unnecessary SA-HRP traget antibody is removed, add TMB film peroxidase substrate (Kirkegaard & Perry Laboratories Gaithersburg, MD), every hole 50 μ l, after this compound hydrolysis, cause Bluepoint to occur, the amount that its size and density are combined with IFN γ is directly proportional.Virus-specific IFN γ produces cell and determines by the quantity of statistics Bluepoint.
To not be exposed to PRRSV5 × 10
5the hole of individual PBMC is as negative control group.In typical PRRSV specific reaction, the background dot that the non-PRRSV irritation cell in each hole causes should not exceed 5, and the value obtaining is from deducting the irritation cell value of acquisition separately.For the unexpected high-frequency non-PRRSV specificity IFN γ of battery of tests, celliferous generation has particularly important meaning to this control method.Equally, in order to determine that each PBMC sample produces the ability of IFN γ, 5 × 10
4pBMC/ hole is placed in 10mg/ml mitotic division unit phytohaemagglutinin and cultivates, and in all cases, observes positive reaction.
Result
Regulate immunoreactive development in order to evaluate the virus-specific that PRRS vaccine immunity causes, before and after immunity, separate by animal the PBMC coming and carry out IFN γ and produce and detect.In this detection, do not stimulate in culture and occur that IFN γ-SC represents the spontaneous background products of the non-specific cell factor.The frequency of IFN γ-SC that the PBMC culture stimulating with memory PRRS virus antigen causes shows the generation of virus-specific IFN γ-SC higher than background products.The every papova specificity of whole duration of test (0～42 day) (memory antigenic stimulation) produces the mean value of frequency and spontaneous (background) IFN γ-SC and sees Fig. 9.Weak malicious seedling group and recombinant protein seedling group immune group animal in immunity latter 28 days, detect that division yield stimulant phytohaemagglutinin has weakened virus-specific IFN gamma reaction (statistics shows apparently higher than background).Strong poison is attacked latter 7 days specific reactions of poison and is further strengthened, and within 42 days after head exempts from, starts to decline.Control group detects that negligible IFN γ produces cell, ignores the appearance of remembering virus antigen in cell culture.Comparatively speaking, the latter 21 days all animals of inactivated vaccine group of immunity have produced high-caliber cell Autocrine IFN γ (scope: 30～200IFN γ-SC/10
6pBMC).This group memory virus antigen stimulates the PBMC culture producing not produce the IFN γ SC apparently higher than control group.Inactivated vaccine immune group animal can be observed abnormal violent and unexpected IFN gamma reaction, to having determined this reaction in the follow-up study of three pigs, exempt from latter 14 days as far back as head, three pigs just show as strong spontaneous IFN gamma reaction (122 ± 69IFN γ-SC/10
6individual PBMC), within latter 21 days, peak in immunity, > 200IFN γ-SC/10
6individual PBMC, even and at still very strong (81 ± 33IFN γ-SC/10 of latter 70 days of immunity
6individual PBMC).Three of the control groups age suitable pig collect blood sample, the spontaneous IFN γ that can ignore to 0 detected.In control animal group, after immunity, 14,21,70 days blood sample collection detection Autocrine IFN γ results are respectively: 0 ± 0,4 ± 2, and 0 ± 0IFN γ-SC/10
6individual PBMC.
The detection of the spontaneous generation IL-10 of embodiment nine PBMC
The test period point of ordering in choosing, will separate part PBMC (10 in each animal sample
7individual cells/well, 24 orifice plates), in the full RPMI substratum without any stimulator, cultivate, cultivate after 48 hours, collect acellular culture, with porcine cytokine detection kit (Camarillo, CA) detection, detection method is shown in specification sheets.
Result
After head exempts from 0,21 day, we detected the spontaneous generation of immune animal PBMC cytokine, hatch and detect for 48 hours without any stimulator in the situation that.Before immunity, any animal does not all detect that PBMC produces IL-10.Under contrast, latter 21 days of immunity, detects that a large amount of IL-10 produces in inactivated vaccine immune group in the PBMC being separated to.By contrast, from the PBMC culture of recombinant protein engineered vaccine immune group only 1/5～2/5 animal IL-10 Autocrine detected, see Figure 10.Control group does not detect in PBMC culture and produces IL-10.The ability of inactivated vaccine induction PBMC Autocrine IL-10 can be determined by further three of inactivated vaccine immune group and control group pigs being carried out to follow-up study.In this research, within latter 7 days, just produce the spontaneous generation reaction of obvious IL-10 (15 ± 6pg/ml) as far back as immunity, head exempts to reach peak value (89 ± 23pg/ml) in latter 21 days, drops to 57 ± 18pg/ml level after 7 days.After immunity 0,7,21,28 days, the spontaneous generation of IL-10 that is separating the PBMC that collects blood sample from three control groups and cultivate species and detect negligible (almost nil).
Claims (7)
1. a blue otopathy protein engineering vaccine fusion rotein, its aminoacid sequence is SEQ ID No.2.
2. a nucleic acid molecule, its coding claim 1 described fusion rotein.
3. a carrier, it contains nucleic acid molecule claimed in claim 2.
4. a host cell, it contains carrier claimed in claim 3.
5. nucleic acid molecule claimed in claim 2, its concrete sequence is as follows:
gcaaagttcgttgcagcatggaccctgaaagcagcagcaatctccgagatcaagggtgtcarcgtccacaagatcgaggggatcggttctggtatagggcatgaccgatgtagtgagaacgatcatgacgaactagttcacgacggggataacgccaccttgcctcgccatgacaatattgtctttcggacatcaaaaccaacaccaccgcagcatcagggttctggtccatgtttcagttcgagcctttcggacatcaaaaccaacacctccgcagcatcagacttcgttgtcctccaggacatcagctgccttaggcatggcgactcgtcccctccgacggttcgcaaaatccctcagtgccgctctgagatgagtgaaaagggattcaaagtggtgttcggcaatgtgtcaggcatcgtggctgtgtgcgtcaactttaccagctacgtccaacacgtcaaggagtttacccaacgctccttaggtggtgccaacccaaacaacagctcttattcacagttgatttataacctgacactatgtgagctgaatggcacagattggttggtgaagaattgcatgtcttggcgctactcatgtaccaggtatactaattttcttttagacaccaaaggcaaaatttatcgttggcgatcacccgtcatcatagagaaagggggaaaagttgaggtcgagggccacctcatcgacctcaagagagttgtgcttgatggttccgcggctatccctgtaaccaaaatttcagctgagcgatggggtcatccc
6. for preventing a vaccine for high-pathogenicity blue ear disease, it comprises fusion rotein claimed in claim 1 and pharmaceutically acceptable carrier.
7. the application of fusion rotein claimed in claim 1 in the blue otopathy protein engineering vaccine of preparation restructuring.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410118926.0A CN103992408A (en) | 2014-03-24 | 2014-03-24 | Preparation of blue ear disease protein engineering vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410118926.0A CN103992408A (en) | 2014-03-24 | 2014-03-24 | Preparation of blue ear disease protein engineering vaccine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103992408A true CN103992408A (en) | 2014-08-20 |
Family
ID=51306769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410118926.0A Pending CN103992408A (en) | 2014-03-24 | 2014-03-24 | Preparation of blue ear disease protein engineering vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103992408A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104497148A (en) * | 2014-12-17 | 2015-04-08 | 广州谱泰生物技术有限公司 | Preparation method for recombinant ubiquitin blue ear disease vaccine |
| CN105002195A (en) * | 2015-08-01 | 2015-10-28 | 吉林农业大学 | Porcine reproductive and respiratory syndrome recombinant vaccine |
| CN107922462A (en) * | 2015-06-23 | 2018-04-17 | 梅里亚股份有限公司 | The recombinant viral vector and its manufacture method and purposes of the secondary albumen containing PRRSV |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845083A (en) * | 2009-06-17 | 2010-09-29 | 中牧实业股份有限公司 | Synthetic peptide vaccine for treating porcine reproductive and respiratory syndrome and preparation method thereof |
| CN102107004A (en) * | 2011-01-05 | 2011-06-29 | 重庆大学 | Porcine reproductive and respiratory syndrome virus-like particle vaccine and preparation method thereof |
| CN102731661A (en) * | 2012-07-12 | 2012-10-17 | 重庆业为基生物科技有限公司 | Multi-epitope fusion antigen for detecting virus serum antibody of porcine reproductive and respiratory syndrome and kit prepared with multi-epitope fusion antigen |
| CN103421817A (en) * | 2012-10-15 | 2013-12-04 | 华中农业大学 | Synthetic mMEP of PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) and application thereof |
-
2014
- 2014-03-24 CN CN201410118926.0A patent/CN103992408A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101845083A (en) * | 2009-06-17 | 2010-09-29 | 中牧实业股份有限公司 | Synthetic peptide vaccine for treating porcine reproductive and respiratory syndrome and preparation method thereof |
| CN102107004A (en) * | 2011-01-05 | 2011-06-29 | 重庆大学 | Porcine reproductive and respiratory syndrome virus-like particle vaccine and preparation method thereof |
| CN102731661A (en) * | 2012-07-12 | 2012-10-17 | 重庆业为基生物科技有限公司 | Multi-epitope fusion antigen for detecting virus serum antibody of porcine reproductive and respiratory syndrome and kit prepared with multi-epitope fusion antigen |
| CN103421817A (en) * | 2012-10-15 | 2013-12-04 | 华中农业大学 | Synthetic mMEP of PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) and application thereof |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104497148A (en) * | 2014-12-17 | 2015-04-08 | 广州谱泰生物技术有限公司 | Preparation method for recombinant ubiquitin blue ear disease vaccine |
| CN104497148B (en) * | 2014-12-17 | 2018-05-18 | 青岛明勤生物科技有限公司 | A kind of preparation for recombinating ubiquitination blue-ear disease vaccine |
| CN107922462A (en) * | 2015-06-23 | 2018-04-17 | 梅里亚股份有限公司 | The recombinant viral vector and its manufacture method and purposes of the secondary albumen containing PRRSV |
| US9981033B2 (en) | 2015-06-23 | 2018-05-29 | Merial Inc. | PRRSV minor protein-containing recombinant viral vectors and methods of making and use thereof |
| US10751407B2 (en) | 2015-06-23 | 2020-08-25 | Boehringer Ingelheim Animal Health USA Inc. | PRRSV minor protein-containing recombinant viral vectors and methods of making and use thereof |
| CN107922462B (en) * | 2015-06-23 | 2022-03-18 | 勃林格殷格翰动物保健美国公司 | Recombinant virus vector containing PRRSV minor protein and its production process and use |
| CN105002195A (en) * | 2015-08-01 | 2015-10-28 | 吉林农业大学 | Porcine reproductive and respiratory syndrome recombinant vaccine |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103172749B (en) | Preparation of African swine fever protein engineering vaccine | |
| CN104248762B (en) | A kind of pig epidemic diarrhea vaccine combination and its preparation method and application | |
| CN104628865B (en) | A kind of pseudo- mad dog epitope polypeptide recombinant vaccine | |
| US11607448B2 (en) | Whole avian-origin reverse genetic system and its use in producing H7N9 subtype avian influenza vaccine | |
| CN103450355B (en) | recombinant bovine alpha interferon and application thereof | |
| CN103992408A (en) | Preparation of blue ear disease protein engineering vaccine | |
| CN104628871B (en) | A kind of preparation for recombinating bursal disease protein engineering vaccine | |
| CN106279431A (en) | A kind of pig circular ring virus subunit inactivated vaccine | |
| CN103539839A (en) | Neutralizing epitope peptide of enterovirus 71-type VP2 antigen and application thereof | |
| CN102406929B (en) | Co-expressed molecular adjuvant enhanced divalent foot and mouth disease protein engineering vaccine | |
| CN104804099B (en) | A kind of reinforced polyepitope vaccines of recombination H9N2 subtype avian influenza | |
| CN104830811A (en) | NS1 gene deleted and live-attenuated vaccine candidate strain of H9N2 subtype avian influenza virus and its establishing method and application | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN107287268A (en) | A kind of adjuvant of the nucleic acid vaccine immunity originality of enhancing HIV 1 | |
| CN102134278A (en) | Preparation of subunit vaccine for mucosal immune in circovirus genetic engineering and application thereof | |
| CN102847168B (en) | The design of a kind of nucleic acid vaccine PV-Fn preventing bovine mastitis and structure thereof | |
| CN104497148B (en) | A kind of preparation for recombinating ubiquitination blue-ear disease vaccine | |
| CN109517044B (en) | Porcine epidemic diarrhea virus genetic engineering antigen and antibody | |
| CN103614329A (en) | Construction method and application of DNA (Deoxyribonucleic Acid) vaccine for avian leukosis virus subgroup J | |
| CN109021115A (en) | A kind of pig circular ring virus trivalent subunit vaccine | |
| CN104211783B (en) | A kind of preparation of blue otopathy subunit vaccine | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
| CN102321180B (en) | Polypeptide fragment composition and application in preparation of porcine reproductive and respiratory syndrome vaccine thereof | |
| CN105218679A (en) | Human metapneumovirus multi-epitope antigen and application thereof | |
| CN110092840A (en) | A kind of infectious laryngotracheitis of chicken, egg drop syndrome bigeminy polyepitope vaccines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140820 |
|
| RJ01 | Rejection of invention patent application after publication |