CN104178492B - The sequence of three kinds of activated form somatomedin of a kind of coding and application thereof - Google Patents

Abstract

The present invention provides a kind of coded sequence simultaneously expressing tri-kinds of somatomedin of IGF1, EGF and FGF2, utilize the coded sequence that the present invention provides, corresponding expression vector can be built, secrete efficiently and stably by importing cell there are tri-kinds of somatomedin of bioactive IGF1, EGF and FGF2, for the various researchs needing to add these three somatomedin.Compared with traditional various recombinant growth factors of interpolation, solve owing to the lasting consumption of somatomedin is added external source recombinant growth factors and can not stably be maintained the problem of concentration by cell growth, also avoid the expensive shortcoming of extensive stock recombinant growth factors.The expression vector additionally built can select to transfect different cell as required, build various different co-culture of cells system, realize enriching and apply flexibly, it would be desirable to add exogenous growth factors simultaneously and use the job step of co-culture system to be greatly simplified, decreasing cost.

Description

The sequence of three kinds of activated form somatomedin of a kind of coding and application thereof

Technical field

The invention belongs to biotechnology, relate to multiple gene and express simultaneously, specifically, relating to one can transcribe same The sequence of growth factor I GF1, EGF and FGF2 of three kinds of activation that can secrete is encoded on thing.This sequence may be used for building eucaryon Fibrocyte expression vector, and can express above-mentioned without processing, directly there is work importing after eukaryotic cell Simultaneous Stabilization in cell Three kinds of somatomedin of property are also secreted into extracellular.

Background technology

In recent years, constantly take along with the effort deeply and obtaining stem cell in every way of stem cell related mechanism research New achievement, the huge differentiation potential of stem cell is before repairing and show in terms of the regeneration of damaged organ and being widely applied Scape, the treatment for multiple disease brings hope.Stem cell is the pluripotent cell that a class can carry out self renewal, at certain bar Can induce differentiation under part as Various Tissues cell type.According to source difference, by analogue body normal point of specific cells Changing maturation process, stem cell can be induced to differentiate into neurocyte, myocardial cell, various hemocyte, ear cells etc. respectively The functioning cell of terminal differentiation.The factor affecting stem cell differentiation is a lot, and mechanism is complicated.Stem cell is utilized to carry out disease treatment Time, need to be effectively directed stem cell and be divided into certain types of functioning cell, and need certain noble cells quantity And purity, to reach preferable curative effect and to reduce untoward reaction as far as possible.In order to reach this purpose, it usually needs according to circumstances exist Cultivating system adds various exogenous growth factors.In the somatomedin that all external sources are added, type-1 insulin like growth factor (IGF1), epidermal growth factor (EGF) and FGF2 (FGF2) are the somatomedin that application is most.These are three years old Planting somatomedin to use, they are that strong mitogenesis is former, and receptor is widely distributed, can not only maintain thin the most simultaneously Born of the same parents survive, and promote cell proliferation, also participate in the atomization of various kinds of cell, the activity of regulation cell and function.

It addition, in a lot of oncology studies, the growth of primary tumor cell or cell line needs in the case of also having many Add above-mentioned somatomedin, when being beneficial to primary tumor cell survival after in vitro, grow and carry out targeted drug research Detection tumor cell is to corresponding somatomedin or the dependency of receptor.Press down as studied EGF-R ELISA (EGFR) little molecule Need to add corresponding somatomedin EGF when the effect of preparation and mechanism to carry out Tumor Cell Growth Stimulated, study into fiber growth Needing to add corresponding somatomedin during the mechanism of action of factor acceptor (FGFR) inhibitor class medicine, to be usually FGF2, research swollen The spheroid of tumor stem cell properties is formed and is also required in serum-free medium in experiment add two kinds of somatomedin EGF and FGF2.

But owing to this stability in culture fluid of somatomedin was affected by its half-life, and cell grows growth The demand of the factor is again lasting, and the artificial recombinant growth factors that adds can not stably maintain it to act on, and recombinate growth because of The price of son own is the most costly.Therefore if able to express activated somatomedin by cytotostatic, then can effectively exist Incubation stably maintains the concentration of somatomedin.

Therefore can by build can express simultaneously tri-kinds of somatomedin of activated form IGF1, EGF and FGF2 expression vector, And import in corresponding cell (as set up the engineering cell for co-culture system), obtain Simultaneous Stabilization and express three kinds of growths The cell line of the factor, for further research, as set up co-culture system with stem cell, utilizing works cell is continual and steady Secreting three kinds of somatomedin, stem cell breaks up to specific cells in induction；Co-culture with primary tumor cell, maintain its external life Deposit, grow and breed.

In eukaryotic cell, destination gene expression is mainly transcribed (including transcribing post-treatment) and translation (includes translation Post-treatment) regulation and control of two levels.At transcriptional level often through using strong promoter (such as CMV promoter) to reach high level Stable transcribing, and transcript only includes that the mRNA open reading frame of maturation is to avoid the need for extra transcribing post-treatment as far as possible (affecting the efficiency producing the transcription product being finally available for translation)；Regulation and control in translation skill then include strengthening translates Begin, pilot protein matter location (signal peptide as needed for secretion) and the same protein as far as possible reducing synthesis for embody function or Activity and demand to post translational processing

Therefore, we are according to mentality of designing as shown in Figure 1 in the present invention, by IGF1, EGF and FGF2 tri-growth because of Sub-coded sequence is connected in series, and makes them may be at when cell inner expression on same transcript, the most once transcribes Express and express three kinds of somatomedin simultaneously；In order to reduce the impact on final protein of the post translational processing efficiency, make growth Need not process the most active after the synthesis of factor protein matter, we do not use the coded sequence of complete three kind somatomedin, and It is only to have cloned to comprise activated partial coding sequence after three kinds of somatomedin processing；In order to effectively make the growth of expression Cytokine secretion is to extracellular, and we have merged human normal immunoglobulin before each somatomedinThe signal peptide of light chain；Due to Each somatomedin is the absolute coding frame of initiation codon and termination codon, therefore we three coding sequence it Between plus Internal ribosome entry site (Internal ribosome entry site, IRES), with ensure three growths because of Son all can be translated into corresponding protein by ribosome identification effectively；In order to improve the efficiency of translation initiation identification, we Kozak sequence conservative in eukaryotic cell is with the addition of before each somatomedin coded sequence initiation codon.

According to above-mentioned design, we have invented a people simultaneously encoding tri-kinds of activated growth factor of IGF1, EGF and FGF2 Operation arranges, and this sequence may be used for being building up on expression vector further, and by importing in cell, give expression to three kinds simultaneously There is bioactive somatomedin.

The present invention can be used for various needs provides the research stablizing external source IGF1, EGF and FGF2, includes but are not limited to do Cell correlational study and tumor correlational study.

Summary of the invention

It is an object of the invention to provide a kind of coded sequence simultaneously expressing tri-kinds of somatomedin of IGF1, EGF and FGF2, tool Just like the nucleotide sequence shown in SEQ ID No:1.Wherein the 7th to the 14th, the 888th to the 895th and the 1718th It is Kozak sequence to the 1725th；15th to the 77th, the 896th to the 958th and the 1726th to the 1788th is Igk signal coding sequence；297th to the 881st and the 1127th to 1711 is IRES sequence；78th to 290 is Activated form IGF1 coded sequence；959th to the 1120th is activated form EGF coded sequence；1789th to 2256 for living Change type FGF2 coded sequence.

It is a further object to provide the application of this coded sequence.This coded sequence is used for building eukaryotic expression and carries Body, after importing cell (such as 293T cell), can with stability and high efficiency express the growth of IGF1, EGF and FGF2 tri-kinds activation because of Son, for further with various researchs.

The present invention compared with the existing technology has the following advantages and effect:

Utilize the coded sequence that the present invention provides, corresponding expression vector can be built, the most steady by importing cell Surely secrete and there are tri-kinds of somatomedin of bioactive IGF1, EGF and FGF2, for various need add these three growth because of The research of son.Compared with traditional various recombinant growth factors of interpolation, solve owing to somatomedin is continued by cell growth Consume and add external source recombinant growth factors and can not stably maintain the problem of concentration, also avoid extensive stockization restructuring growth The shortcoming that factor price is expensive.The expression vector additionally built can select to transfect different cell as required, builds various difference Co-culture of cells system, it is achieved abundant apply flexibly, it would be desirable to add exogenous growth factors simultaneously and employing co-cultures body The job step of system is greatly simplified, and decreases cost.

Accompanying drawing explanation

Fig. 1 is the design diagram of tri-kinds of coding sequence of IGF1, EGF and FGF2.

Fig. 2 IRES sequence, IgSignal coding sequence and the clone of activated form EGF coded sequence.

The structure of Fig. 3 slow virus carrier and qualification.

Fig. 4 slow virus infection HEK293T cell.

Fig. 5 Western blot detects growth factor expression.

Fig. 6 CCK-8 detects A549 cell proliferation.

Detailed description of the invention

The present invention combines the drawings and specific embodiments and is described further.These embodiments are merely to illustrate, but are not intended to The present invention.

Embodiment 1:IRES sequence, IgSignal coding sequence, activated form EGF, IGF1 and FGF2 coded sequence gram Grand with synthesis.

The clone of IRES sequence:

PCR method is used to clone IRES from pIRES2-EGFP plasmid.Primer is respectively

IRES-F(SEQ ID No:2): 5 '-ACTAGTGCCCCTCTCCCTCCCCCC-3 ',

IRES-R(SEQ ID No:3): 5 '-TCTAGA(underscore part is respectively for TGTGGCCATATTATCATCGTG-3 ' For introduceSpeI andXbaI restriction enzyme site).

PCR amplification condition is 94 DEG C of degeneration 5min, then 94 DEG C of degeneration 30sec, 58 DEG C of annealing 30sec, 72 DEG C of extensions 30sec, totally 30 circulations, last 72 DEG C extend 7min.Amplified production (597bp, Fig. 2 A) is reflected by 2% agarose gel electrophoresis Fixed, and carry out cutting glue recovery according to the QIAquicK Gel Extraction Kit description of QIAGEN.Take 3 μ l and cut glue recovery Product is connected, at T with pGEM-T Easy Vector₄Lower 16 DEG C of DNA ligase effect connects overnight.Connect product to be transformed into DH5In competent cell, amicillin resistance plate screening is cultivated, picking positive colony, is just identifying through EcoRI enzyme action Sequence verification after really.

Ig The clone of signal coding sequence:

PCR method is used to clone Ig from pSecTag2A plasmidSignal coding sequence.Primer is respectively Ig- F(SEQ ID No:4): 5 '-ACT AGT TAG CCA CCA(underscore part is introduce to TGG AGA CAG AC-3 'SpeI restriction enzyme site, italic thickened portion is the Kozak sequence introduced)；Ig-R(SEQ ID No:5): 5 '-GTC ACC AGT GGA ACC TGG AA-3’.Ibid, amplified fragments size is 77bp(Fig. 2 A to PCR amplification condition), ibid method is cloned also Sequence verification.

The clone of activated form EGF coded sequence:

Extract the total serum IgE of colorectal cancer cells SW620 with Trizol method, use the reverse transcription reagents M-MLV of Promega company Reverse Transcriptase reverse transcription synthesis cDNA, then with this cDNA as template, PCR amplifies EGF coded sequence.Draw Thing is respectively EGF-F(SEQ ID No:6): 5 '-TTCCAGGTTCCACTGGTGACAATAGTGACTCTGAATGTCCCC-3’ (italic thickened portion is the Ig introducedSignal peptide downstream complementary series), EGF-R(SEQ ID No:7): 5 '-TCTAGA TTA(underscore part is introduce to GCGCAGTTCCCACCACTTCA-3 'XbaI restriction enzyme site, italic thickened portion Termination codon for introducing), ibid, EGF clip size is 188bp(Fig. 2 A to PCR amplification condition), ibid method is cloned and checks order Checking.

With IgSignal peptide and EGF coding sequence fragment are template, respectively with Ig-F(SEQ ID No:4) and EGF-R (SEQ ID No:7) is that upstream and downstream primer carries out overhangPCR amplification, and ibid, amplification obtains 245bp Ig to amplification condition The fragment (Fig. 2 B) of-EGF mesh, ibid method clone PCR products sequence verification.

Activated form IGF1 and the synthesis of FGF2 coded sequence:

With Kozak sequence and IgActivated form IGF1 and the FGF2 sequence of signal coding sequence are direct by company respectively Synthesis, sequence is as follows:

(296bp, underscore part is respectively introducing to IGF1SpeI andXbaI restriction enzyme site, italic thickened portion is for drawing The Kozak sequence entered, italic underscore part is the Ig introducedSignal coding sequence) (SEQ ID:8):

5’-ACTAGT TAGCCACC ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTT CCACTGGTGAC GGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGC TTTTATTTCAACAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGCTG CTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTTAATCTAGA- 3’

(551bp, underscore part is respectively introducing to FGF2SpeI andXbaI restriction enzyme site, italic thickened portion is for drawing The Kozak sequence entered, italic underscore part is the Ig introducedSignal coding sequence) (SEQ ID:9):

5’-ACTAGT TAGCCACC ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTT CCACTGGTGAC GCAGCCGGGAGCATCACCACGCTGCCCGCCTTGCCCGAGGATGGCGGCAGCGGCGCCTTCCCGCCC GGCCACTTCAAGGACCCCAAGCGGCTGTACTGCAAAAACGGGGGCTTCTTCCTGCGCATCCACCCCGACGGCCGAGT TGACGGGGTCCGGGAGAAGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCA AAGGAGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATGTGTTACGGATGAG TGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGC ACTGAAACGAACTGGGCAGTATAAACTTGGATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGT CTGCTAAGAGCTGATAATCTAGA-3’。

Embodiment 2: the structure of Lentiviral

According to the design of Fig. 1, above-mentioned each fragment acquired is sequentially connected with and is cloned into slow virus carrier plasmid In pLVX-IRES-ZsGreen1, use restriction endonucleaseEcoRI andXbaI double digestion identifies the direction of Insert Fragment, and forward inserts time slice Duan great little is 8.2kb and 2280bp(Fig. 3), show to successfully construct.The named pLVX-3GF of plasmid being correctly inserted into.

Extract plasmid pLVX-3GF, pMD2G and pSPAX2 with QIAGEN Plasmid Midi Kits, respectively take 10 It is diluted in the DMEM in high glucose that 1ml does not contains antibiotic without serum, softly mixes, add 30 Attractene Transfection Reagent is in above-mentioned culture medium, and the soft mixing gentle and quiet 20min that puts of rear chamber is to form transfection composite.People Embryonic kidney HEK293T cell routine is incubated at the culture fluid supernatant of the DMEM in high glucose training virus containing 10% hyclone, with 0.45 μm filter Device filters, and 4 C save backup.

The expression in HEK293T cell of 3: the three kinds of somatomedin of embodiment

Inoculation HEK293T cell is (culture medium does not contains antibiotic) in 3.5cm culture dish, and after 24h, (cell reaches 70% remittance Right) suck culture fluid, add 500 and support in base, in 37 C, 5% CO₂Saturated humidity incubator in cultivate.1ml is digested HEK293T cell suspension after Li Xin and 1ml transfection composite join in 10cm culture dish after mixing gently, in 37 C, 5% CO₂Saturated humidity incubator in cultivate, supply culture medium after 6-8 h to 10ml.Respectively after transfection 48 h and 72 h, collect ContainUpper cleer and peaceful Polybrene(stock solution 10mg/ml containing virion, final concentration 8/ ml), supply cultivation after 6 h Liquid, changes fresh medium after 24h, after cell continues to cultivate 48h, and fluorescence microscopy Microscopic observation infection conditions (Fig. 4 A), and adopt The cell gram of the stable infection of green fluorescent protein can be expressed with limiting dilution assay (1 cells/well is inoculated in 96 orifice plates) screening Grand (Fig. 4 B), by the named HEK293T/3GF of cell clone of stable infection.

The expression of destination protein after utilizing the detection of Western blot method to infect:

Factors check in cell: results HEK293T/3GF cell and the HEK293T compared with control cells being uninfected by, PBS washing is thin Born of the same parents 3 times, centrifugal collecting cell, add ice pre-cooling lysate (25 mM Tris-HCl, pH 7.6,150 mMNaCl, 1% NP-40,1% NaTDC, 0.1% SDS, containing proteinase inhibitor C omplete^TM Protease Inhibitor Cocktail), it is placed in cracking 30min, 15000r/min, 4 ° of C on ice and is centrifuged 15min collection supernatant, try with DC protein quantification Agent box measures protein concentration, takes 20Total protein carries out transferring film after 20% PAGE gel electrophoresis, and 10% milk room temperature closes 1h After, it is separately added into EGF, FGF2 and IGF1 4 ° of C overnight incubation of tri-kinds of antibody (1:500).TBST (TBS adds 0.1%Tween20) Wash film 3 × 10min, add two anti-(1:5000) incubated at room 2h of peroxidase labelling, wash film 3 × 10min, chemiluminescence Method detection signal.

Factors check in culture fluid: collect HEK293T/3GF cell and the culture fluid of HEK293T compared with control cells being uninfected by Each 10ml, centrifugal segregation cell debris ,-80 ° of C lyophilizations, it is dissolved in 500 ddH₂O, respectively takes 20Carry out 20% SDS- PAGE, ibid after transferring film, detecting factor is expressed.

Western blot result is as it is shown in figure 5, all detect destination protein EGF respectively (6. between 6 ~ 18 kDa 2 kDa), IGF1 (6kDa) and FGF2 (17.2 kDa), show three kinds of somatomedin of HEK293T/3GF cell successful expression can Somatomedin is secreted in culture fluid supernatant.

4: three kinds of somatomedin Function detection of embodiment

HEK293T/3GF cell and HEK293T compared with control cells cellar culture are cultivated in the DMEM in high glucose containing 10% hyclone In base, in 37 C, 5% CO₂Saturated humidity incubator in cultivate.Receive after being further cultured for 48h after cell length to 80% degree of converging Collection supernatant, as conditioned medium.Human lung cancer cell A549's cell is with every hole 1.5 × 10⁴Individual cell is inoculated in 96 orifice plates, experiment Group addition 50The conditioned medium of HEK293T/3GF cell and 50Fresh containing 10% hyclone 1640 cultivations Liquid, matched group adds 50The conditioned medium of HEK293T cell and 50Fresh containing 10% hyclone 1640 trainings Nutrient solution.After continuing to cultivate 48h, every hole adds 10CCK-8 reagent, by microplate reader detects 450nm after hatching 2h in incubator Absorbance.Using SPSS18. 0 software to carry out statistical analysis, represent with means ± S.E.M., two groups of means compare employing t Inspection；P < 0.05 thinks that difference is statistically significant.

Result shows, compares with HEK293T collating condition culture fluid, and HEK293T/3GF cell conditioned medium really can Enough it is obviously promoted the growth of A549 cell, difference statistically significant (P < 0.05), the life of HEK293T/3GF emiocytosis is described The long factor is strictly somatomedin (Fig. 6) active, that A549 cell can be promoted to grow.

<110>Zhejiang University

<120>a kind of sequence encoding three kinds of activated form somatomedin and application thereof

<160> 9

<210> 1

<211> 2262

<212> DNA

<213>artificial sequence

<220>

<223>sequence of three kinds of activated form somatomedin is encoded

<400> 1

actagttagc caccatggag acagacacac tcctgctatg ggtactgctg ctctgggttc 60

caggttccac tggtgacgga ccggagacgc tctgcggggc tgagctggtg gatgctcttc 120

agttcgtgtg tggagacagg ggcttttatt tcaacaagcc cacagggtat ggctccagca 180

gtcggagggc gcctcagaca ggcatcgtgg atgagtgctg cttccggagc tgtgatctaa 240

ggaggctgga gatgtattgc gcacccctca agcctgccaa gtcagcttaa tctagtgccc 300

ctctccctcc ccccccccta acgttactgg ccgaagccgc ttggaataag gccggtgtgc 360

gtttgtctat atgttatttt ccaccatatt gccgtctttt ggcaatgtga gggcccggaa 420

acctggccct gtcttcttga cgagcattcc taggggtctt tcccctctcg ccaaaggaat 480

gcaaggtctg ttgaatgtcg tgaaggaagc agttcctctg gaagcttctt gaagacaaac 540

aacgtctgta gcgacccttt gcaggcagcg gaacccccca cctggcgaca ggtgcctctg 600

cggccaaaag ccacgtgtat aagatacacc tgcaaaggcg gcacaacccc agtgccacgt 660

tgtgagttgg atagttgtgg aaagagtcaa atggctctcc tcaagcgtat tcaacaaggg 720

gctgaaggat gcccagaagg taccccattg tatgggatct gatctggggc ctcggtgcac 780

atgctttaca tgtgtttagt cgaggttaaa aaaacgtcta ggccccccga accacgggga 840

cgtggttttc ctttgaaaaa cacgatgata atatggccac atctagttag ccaccatgga 900

gacagacaca ctcctgctat gggtactgct gctctgggtt ccaggttcca ctggtgacaa 960

tagtgactct gaatgtcccc tgtcccacga tgggtactgc ctccatgatg gtgtgtgcat 1020

gtatattgaa gcattggaca agtatgcatg caactgtgtt gttggctaca tcggggagcg 1080

atgtcagtac cgagacctga agtggtggga actgcgctaa tctagtgccc ctctccctcc 1140

ccccccccta acgttactgg ccgaagccgc ttggaataag gccggtgtgc gtttgtctat 1200

atgttatttt ccaccatatt gccgtctttt ggcaatgtga gggcccggaa acctggccct 1260

gtcttcttga cgagcattcc taggggtctt tcccctctcg ccaaaggaat gcaaggtctg 1320

ttgaatgtcg tgaaggaagc agttcctctg gaagcttctt gaagacaaac aacgtctgta 1380

gcgacccttt gcaggcagcg gaacccccca cctggcgaca ggtgcctctg cggccaaaag 1440

ccacgtgtat aagatacacc tgcaaaggcg gcacaacccc agtgccacgt tgtgagttgg 1500

atagttgtgg aaagagtcaa atggctctcc tcaagcgtat tcaacaaggg gctgaaggat 1560

gcccagaagg taccccattg tatgggatct gatctggggc ctcggtgcac atgctttaca 1620

tgtgtttagt cgaggttaaa aaaacgtcta ggccccccga accacgggga cgtggttttc 1680

ctttgaaaaa cacgatgata atatggccac atctagttag ccaccatgga gacagacaca 1740

ctcctgctat gggtactgct gctctgggtt ccaggttcca ctggtgacgc agccgggagc 1800

atcaccacgc tgcccgcctt gcccgaggat ggcggcagcg gcgccttccc gcccggccac 1860

ttcaaggacc ccaagcggct gtactgcaaa aacgggggct tcttcctgcg catccacccc 1920

gacggccgag ttgacggggt ccgggagaag agcgaccctc acatcaagct acaacttcaa 1980

gcagaagaga gaggagttgt gtctatcaaa ggagtgtgtg ctaaccgtta cctggctatg 2040

aaggaagatg gaagattact ggcttctaaa tgtgttacgg atgagtgttt cttttttgaa 2100

cgattggaat ctaataacta caatacttac cggtcaagga aatacaccag ttggtatgtg 2160

gcactgaaac gaactgggca gtataaactt ggatccaaaa caggacctgg gcagaaagct 2220

atactttttc ttccaatgtc tgctaagagc tgataatcta ga 2262

<210> 2

<211> 24

<212> DNA

<213>artificial sequence

<220>

<223>IRES amplification upstream primer I RES-F

<400> 2

actagtgccc ctctccctcc cccc 24

<210> 3

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223>downstream primer IRES-R is used in IRES amplification

<400> 3

tctagatgtg gccatattat catcgtg 27

<210> 4

<211> 26

<212> DNA

<213>artificial sequence

<220>

<223>immunoglobulin kappa signal peptide amplification upstream primer I gk-F

<400> 4

actagttagc caccatggag acagac 26

<210> 5

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>downstream primer Igk-R is used in the amplification of immunoglobulin kappa signal peptide

<400> 5

gtcaccagtg gaacctggaa 20

<210> 6

<211> 42

<212> DNA

<213>artificial sequence

<220>

<223>forward primer EGF-F is used in the amplification of activated form EGF coded sequence

<400> 6

ttccaggttc cactggtgac aatagtgact ctgaatgtcc cc 42

<210> 7

<211> 29

<212> DNA

<213>artificial sequence

<220>

<223>downstream primer EGF-R is used in the amplification of activated form EGF coded sequence

<400> 7

tctagattag cgcagttccc accacttca 29

<210> 8

<211> 296

<212> DNA

<213>artificial sequence

<220>

<223>with the activated form IGF1 sequence of Kozak sequence and Igkappa signal coding sequence

<400> 8

actagttagc caccatggag acagacacac tcctgctatg ggtactgctg ctctgggttc 60

caggttccac tggtgacgga ccggagacgc tctgcggggc tgagctggtg gatgctcttc 120

agttcgtgtg tggagacagg ggcttttatt tcaacaagcc cacagggtat ggctccagca 180

gtcggagggc gcctcagaca ggcatcgtgg atgagtgctg cttccggagc tgtgatctaa 240

ggaggctgga gatgtattgc gcacccctca agcctgccaa gtcagcttaa tctaga 296

<210> 9

<211> 551

<212> DNA

<213>artificial sequence

<220>

<223>with the activated form FGF2 sequence of Kozak sequence and Igkappa signal coding sequence

<400> 9

actagttagc caccatggag acagacacac tcctgctatg ggtactgctg ctctgggttc 60

caggttccac tggtgacgca gccgggagca tcaccacgct gcccgccttg cccgaggatg 120

gcggcagcgg cgccttcccg cccggccact tcaaggaccc caagcggctg tactgcaaaa 180

acgggggctt cttcctgcgc atccaccccg acggccgagt tgacggggtc cgggagaaga 240

gcgaccctca catcaagcta caacttcaag cagaagagag aggagttgtg tctatcaaag 300

gagtgtgtgc taaccgttac ctggctatga aggaagatgg aagattactg gcttctaaat 360

gtgttacgga tgagtgtttc ttttttgaac gattggaatc taataactac aatacttacc 420

ggtcaaggaa atacaccagt tggtatgtgg cactgaaacg aactgggcag tataaacttg 480

gatccaaaac aggacctggg cagaaagcta tactttttct tccaatgtct gctaagagct 540

gataatctag a 551

Claims (2)

1. express a coded sequence for tri-kinds of somatomedin of IGF1, EGF and FGF2, its nucleotide sequence such as SEQ ID simultaneously Shown in No:1, wherein the 7th to the 14th, the 888th to the 895th and the 1718th are Kozak sequence to the 1725th；The 15 to the 77th, the 896th to the 958th and the 1726th are Igk signal coding sequence to the 1788th；297th It is IRES sequence to the 881st and the 1127th to 1711；78th to 290 is activated form IGF1 coded sequence；959th It is activated form EGF coded sequence to the 1120th；1789th to 2256 is activated form FGF2 coded sequence.

Coded sequence the most according to claim 1 is used for building carrier for expression of eukaryon, it is characterised in that for thin at eucaryon Born of the same parents express tri-kinds of somatomedin of above-mentioned IGF1, EGF and FGF2.