CN103388008A - Ungulate animal cell line for inductively expressing pluripotent maintenance gene and construction thereof - Google Patents
Ungulate animal cell line for inductively expressing pluripotent maintenance gene and construction thereof Download PDFInfo
- Publication number
- CN103388008A CN103388008A CN2012101408574A CN201210140857A CN103388008A CN 103388008 A CN103388008 A CN 103388008A CN 2012101408574 A CN2012101408574 A CN 2012101408574A CN 201210140857 A CN201210140857 A CN 201210140857A CN 103388008 A CN103388008 A CN 103388008A
- Authority
- CN
- China
- Prior art keywords
- ungulate
- cell
- egfp
- oct4
- inoblast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an ungulate animal cell line for an inductively expressed pluripotent maintenance gene and construction thereof. The ungulate animal fibroblast cell line for expressing and maintaining pluripotent key gene oct4 by an inducible system (tet-on) is established by the invention. The cell line has the characteristics of low virus copy number, obviously up-regulated oct4 expression and high purity for cell single cell source. The cell line is used as donor cell for nuclear transplantation; and the expression of oct4 is induced by drug doxycycline, thereby facilitating reprogramme of egg cells after the nuclear transplantation is facilitated and finally achieving the object of establishing embryonic stem cells of the ungulate animals, so as to breed various transgenic animals.
Description
Technical field
The invention belongs to the genetically engineered field; More specifically, the present invention relates to inducible expression's versatility and keep ungulate clone and the structure thereof of gene.
Background technology
Pig is a kind of common domestic animal, with the mankind, very large similarity is arranged on immunology and physiology.The organ of pig is very close with the mankind aspect anatomical structure and physio-biochemical characteristics, and its size also is similar to people's organ, and it is very little that take a disease the altogether possibility of disease of people pig occurs.So pig is the first-selected organ donor animal of present xenotransplant.The mean lifetime of pig is 20 years, and long life cycle has also been created favourable condition for particular studies.Therefore, for a long time, pig is all very useful laboratory animal in the various fields of the biological medicine researchs such as various diseases and new drug safety evaluation.
Embryonic stem cell (embryonic stem cells, ESCs) refers to derive from a class cell of Mammals blastaea inner cell mass.This class cell has the ability of infinite multiplication, self, can forever go down to posterity in the environment of vitro culture, and keep normal karyotype; Embryonic stem cell also has " totipotency ", still external environment in vivo no matter, and they can be divided into the biological all cell types of adult.
The traditional genetic modification method of ungulate mainly contains two kinds at present.The problems such as non-fixed point transgenosis is radom insertion, and the controllability of exogenous gene expression is poor, usually produces gene silencing, and expression amount is low, foreign gene may destroy the normal expression of host gene simultaneously, will have influence on host's growth and survival.Somatocyte fixed point transgenic technology is that somatic cell gene is practiced shooting and combined with nuclear transplantation (cloned animal), and its problem is at first to carry out homologous recombination difficulty very in somatocyte.And for embryonic stem cell line, genetic modification is very ripe, and embryonic stem cell is the fix a point optimum cell materials of genetic modification of transgenic animal, and this has obtained sufficient demonstration on the model animals mouse.Except this, ESCs can also be fitted to body early embryo, thereby make in the various tissues of filial generation animal of chimeric embryo and organ, has all comprised the cell that derives from two kinds of different genes backgrounds.Based on the These characteristics of embryonic stem cell, set up and utilize the embryonic stem cell of macrofauna machine-processed for the genesis and development of inquiring into the mankind, drug screening, and regenerative medicine has extremely important meaning.Therefore, the embryonic stem cell line of setting up pig is extremely important.Except the efficiency that can increase substantially clone pig, can also utilize homologous recombination technique to carry out genetic manipulation to the ES cell, thereby reach Gene targeting or knock out, can produce in higher efficiency high-quality transgenic pig.
Up to the present, the species of having set up embryonic stem cell line truly only have mouse, people, rhesus monkey and rat., although scientist has passed through long-term unremitting effort, still fail to set up the embryonic stem cell line of real pig and other ungulates.
Summary of the invention
The object of the present invention is to provide inducible expression's versatility to keep ungulate clone and the structure thereof of gene.
In a first aspect of the present invention, a kind of method of expressing the oct4 gene in the ungulate inoblast is provided, comprising:
(1) provide slow virus plasmid 1, wherein contain the element (5 ' → 3 ') that following operability connects: ef1 α, rtta, IRES, (wherein ef1 α is transcribing of the initial rtta of promotor and eGFP to EGFP, eGFP is by the translation process of the independent initial albumen of IRES, and rtta and eGFP have identical promotor ef1 α, but has independently terminator); And slow virus plasmid 2, wherein contain the element (5 ' → 3 ') that following operability connects: ef1 α, EGFP, TRE, (wherein the promotor of eGFP is ef1 α to Oct4, the promotor of oct4 is TRE, but TRE need to pass through the expression in conjunction with rear initial oct4 with rtta in the situation that DOX exists, and eGFP and oct4 have separately independently terminator);
(2) with slow virus plasmid 1 and the common transfection ungulate inoblast of slow virus plasmid 2, select the cell of the EGFP positive, this cell is the ungulate inoblast that can express the oct4 gene.
In a preference, described method also comprises step:
(3) the ungulate inoblast that utilizes doxycycline (doxycycline, Dox) treatment step (2) to obtain, induce the ungulate inoblast to express the oct4 gene.
In another preference, the consumption of doxycycline is 0.5-6ug/mL; Be preferably 1-4ug/mL.
In another preference, described method also comprises step:
(4) from the EGFP positive cell that step (3) obtains, select the ungulate inoblast of oct4 gene high expression.
In another preference, utilize polymerase chain reaction to determine the fibroblastic oct4 gene expression amount of described ungulate.
In another preference, described slow virus plasmid 1 and slow virus plasmid 2 are with (1～2): mix (1～2).
In another preference, described slow virus plasmid 1 and slow virus plasmid 2 infect the ungulate inoblast take MOI (infection multiplicity) 1.5-3 (preferably as 2).
In another preference, described ungulate is pig.
In another aspect of this invention, but provide a kind of ungulate inoblast of abduction delivering oct4 gene, described transit cell dyes slow virus plasmid 1, wherein contain the element (5 ' → 3 ') that following operability connects: ef1 α, rtta, IRES, EGFP; And slow virus plasmid 2, wherein contain the element (5 ' → 3 ') that following operability connects: ef1 α, EGFP, TRE, Oct4.
In another preference, described ungulate inoblast is prepared by the foregoing method of power.
In another preference, in described ungulate inoblast, the copy number that virus is inserted is consistent, and cell is that individual cells is initial.
In another aspect of this invention, provide described ungulate fibroblastic purposes, be used for the donorcells as nuclear transplantation.
Other side of the present invention, due to the disclosure of this paper, is apparent to those skilled in the art.
Description of drawings
Fig. 1, be the structure iron of lentiviral vectors Lv-ef1 α-EGFP-TRE-Oct4/dsRed.
Fig. 2, be the structure iron of lentiviral vectors and Lv-ef1 α-rtta-IRES-EGFP.
Fig. 3, be the fluorescence microscopy result of coinfection Lv-ef1 α-EGFP-TRE-Oct4 and Lv-ef1 α-rtta-IRES-EGFP pig ear inoblast 48h.Bright: the cellular form under light field; EGFP: the EGFP under blue-fluorescence expresses.
Fig. 4, be the result that infects the pig ear inoblast FACS sorting EGFP positive cell after slow virus.Left figure is the inoblast eGFP expression of uninfecting virus, and middle figure is the inoblast eGFP expression after infection virus, and right figure is retest cell eGFP expression after sorting is completed.
Fig. 5, be the cell microscopy result of the EGFP positive that obtains of sorting.
Fig. 6, be the pig ear inoblast that infects after slow virus after, the doxycyclin that adds different concns processed after 3 days, utilized Real-time PCR to detect the analytical results that external source oct4 expresses under the regulation and control of different concns doxycyclin.Wherein 0.1 * DOX concentration is 0.1ug/ml, and 1 * DOX concentration is 1ug/ml, and 4 * DOX concentration is 4ug/ml.C is control group, does not add doxycyclin.Ordinate zou is the expression amount with respect to control group external source oct4.
Fig. 7, be the microscopy result that the positive pig ear of the EGFP that obtains of sorting inoblast mono-clonal forms.
Fig. 8, be that after the positive pig ear of the EGFP that obtains of sorting inoblast builds up monoclonal cell system, the doxycyclin that adds 1ug/ml processed after 3 days, utilized Real-time PCR to detect the analytical results that external source oct4 expresses.The contrast of each clone is the clone that does not add doxycyclin.Ordinate zou represents that each clone adds the medicine experimental group and compares accordingly the relative expression quantity of external source oct4, wherein the expression amount unit of being made as 1 of control group.
Embodiment
In view of the technical barrier that the embryonic stem cell line of ungulate in prior art is difficult to set up, the inventor, through studying for a long period of time, finds that the oct4 expression regulation is one of comparatively crucial factor.Therefore, but the inventor has set up utilization inducible system (tet-on) and has expressed the ungulate fibroblast of keeping versatility key gene oct4, this clone has that viral copy number is low, and the oct4 up-regulated is obvious, the high characteristics of the unicellular source of cell purity.Utilize the donorcells of this clone as nuclear transplantation, the expression of inducing oct4 with the medicine doxycycline, can help the reprogrammed of ovum after nuclear transplantation,, finally to reach the purpose of setting up the ungulate embryonic stem cell, carries out the breeding of various transgenic animal.
Term
As used herein, described " ungulate " refers to the Mammals of using toe point (hoof is generally arranged) to carry out body support.Preferably, described ungulate is selected from horse, zebra, donkey, ox, rhinoceros, camel, river horse, goat, pig, sheep, giraffe, deer, tapir, antelope or gazelle.Best, described ungulate is pig.
As used herein, described " operability connection " refers to functional spatial disposition of two or more nucleic acid region or nucleotide sequence.For example: promoter region is placed in the specific position with respect to the goal gene nucleotide sequence, make transcribing of nucleotide sequence be subject to the guiding of this promoter region, thereby promoter region is " operably connected " on this nucleotide sequence.
As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... form ", " basically by ... form " and " by ... form "; " mainly by ... form ", " basically by ... form " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".
The gene expression system that tsiklomitsin is induced
The present invention has adopted gene expression system (tet-on) that tsiklomitsin is induced to express and has kept versatility key gene oct4.
The transcriptional activation system that tsiklomitsin is induced comprises Tet-off and two systems of Tet-on.The Tet gene expression system has 2 crucial plasmids: one is the plasmid of expressing transcriptional regulation protein, and transcription modulin of the present invention is transcription inhibitor rtTA (by rTetR and VP16, merged and formed); Another is the reaction plasmid of expression alien gene (being oct4 in the present invention), characteristics are that its promotor lacks enhanser, can not start separately exogenous gene expression, this plasmid upstream is tsiklomitsin controlling element (tetracycline responsive element, TRE).When doxycycline did not exist, rtTA can not be in conjunction with TRE, and the TRE-PminCMV downstream gene expression is closed; When having doxycycline, rtTA conformational change, rtTA are in conjunction with TRE, and the TRE-PminCMV downstream gene expression is opened.
Express the method for oct4 gene
The invention provides a kind of method of expressing the oct4 gene in the ungulate inoblast, comprising: (1) provides slow virus plasmid 1, wherein contains the element (5 ' → 3 ') that following operability connects: ef1 α, rtta, IRES, EGFP; And slow virus plasmid 2, wherein contain the element (5 ' → 3 ') that following operability connects: ef1 α, EGFP, TRE, Oct4; (2) with slow virus plasmid 1 and the common transfection ungulate inoblast of slow virus plasmid 2, select the cell of the EGFP positive, this cell is the ungulate inoblast that can express the oct4 gene.
More preferably, described method also comprises step: the ungulate inoblast that (3) utilize doxycycline (doxycycline, Dox) treatment step (2) to obtain, and induce the ungulate inoblast to express the oct4 gene.
More preferably, described method also comprises step: (4) from the EGFP positive cell that step (3) obtains, select the ungulate inoblast of oct4 gene high expression.Preferably, the method for employing airflow classification (FACS) sub-elects the inoblast of the EGFP positive.
In the present invention, the principle of the gene expression system tet-on that the setting of the element that described operability connects is induced based on tsiklomitsin, make oct4 express under controlled condition.As optimal way of the present invention, described lentiviral vectors is Lv-ef1a-EGFP-TRE-oct4 (namely at 3 ' end at EGFP on Lv-ef1 α-GFP skeleton plasmid basis, adding successively TRE, oct4 encoding gene) and Lv-ef1a-rtta-IRES-EGFP (namely adding rtta and IRES encoding sequence between the ef1 α of Lv-ef1 α-EGFP skeleton plasmid and EGFP element).
The inventor finds under study for action, although the higher expression amount that can improve significantly gene of virus infection plural number, but but there is fatal defect in it, namely be easy to make the genome of zooblast to change, cause the animal embryonic stem cell of follow-up preparation to change, and then cause obtaining animal or animal deformity.Therefore, need to optimize the virus infection plural number, make virus be present in cell with low copy and do not affect follow-up embryonic stem cell preparation and animal preparation, but can have higher oct4 expression amount.Therefore, as optimal way of the present invention, described slow virus plasmid 1 and slow virus plasmid 2 infect the ungulate inoblast take MOI (infection multiplicity) 1.5-3 (preferably as 2).
Before entering transfection, two kinds of slow virus plasmids need to be carried out mixing for standby use.As optimal way of the present invention, described slow virus plasmid 1 and slow virus plasmid 2 are with (1～2): mix (1～2); More preferably, described slow virus plasmid 1 and slow virus plasmid 2 mixed with 1: 1.
At present, known dna sequence, it is routine techniques in this area that this target DNA sequence is incorporated in various known dna molecules (as carrier) and cell, as long as general personnel, according to prompting of the present invention, can operate easily.In addition, various forms of sudden changes being incorporated in various DNA moleculars is also technology well known in the art.Also routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell., when the host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical method such as microinjection, electroporation, liposome packing etc.The transformant that obtains can be cultivated with ordinary method, expresses desired polypeptides.
After cotransfection, can obtain the cell of the EGFP positive, it is for expressing the ungulate inoblast of oct4 gene.Give this cell doxycycline, thereby open the expression of oct4.As optimal way of the present invention, the consumption of doxycycline is 0.5-6ug/mL; Be preferably 1-4ug/mL.
Further, can select the high clone of oct4 gene expression amount to be used for follow-up work.The height of measuring gene expression amount is this area technology commonly used, and various measuring methods all can be applicable to the present invention., as optimal way of the present invention, utilize polymerase chain reaction to determine the fibroblastic oct4 gene expression amount of described ungulate.
Preferably, the fibroblast of the described EGFP positive is prepared to unicellular initial cell.
The fibroblast of the EGFP positive
But the present invention also provides a kind of ungulate inoblast of abduction delivering oct4 gene, and described transit cell dyes slow virus plasmid 1, wherein contains the element (5 ' → 3 ') that following operability connects: ef1 α, rtta, IRES, EGFP; And slow virus plasmid 2, wherein contain the element (5 ' → 3 ') that following operability connects: ef1 α, EGFP, TRE, Oct4.
Inducibility that the present invention obtains express versatility keep the hoof class animal fibroblast clone of important gene oct4 can be under the inducing of medicine, express efficiently oct4, and the virus of introducing is few, cell state is good, can be used as the donor of nuclear transplantation, under the help of oct4, complete reprogrammed by ovum, finally reach the purpose of the embryonic stem cell line of setting up ungulate.
, below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only are not used in and limit the scope of the invention for explanation the present invention.The experimental technique of unreceipted actual conditions in the following example, write according to normal condition such as J. Pehanorm Brooker etc. usually, molecular cloning experiment guide, Science Press, the condition described in 2002, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
I. materials and methods
In following examples, the substratum of using has:
The substratum of 293T cell (10%D-MEM) specifically consists of: the D-MEM nutrient solution of 89% (v/v) (available from Invitrogen, 11965); The foetal calf serum of 10% (v/v) (available from Hyclone, SH30396.03); 1mM Pidolidone (available from Invitrogen, 25030); The nonessential amino acid of 1% (v/v) (available from Invitrogen, 11140050).
The substratum of setting up the mono-clonal fibroblast in following examples after sorting is to contain the D-MEM of 15% (v/v) FBS of 1.5ug/mlbFGF (available from Invitrogen, 11965), FBS (available from Hyclone, SH30396.03), bFGF (available from Invitrogen).
The slow virus initial carrier Lv-ef1 α-EGFP that uses in following examples, available from Invitrogen company, has ammonia benzyl resistance.
Lv-ef1 α-rtta-IRES-EGFP construction process is as follows:
Original plasmid Lv-ef1 α-EGFP is upper by giving over to carrier after EGFP under BamHI and SalI double digestion.Obtain the IRES-EGFP fragment from original Plasmid pIRES 2-EGFP (available from clontech) is upper by pcr amplification, be connected to after BamH1 and Sal1 enzyme are cut on the Lv-ef1 α that downcuts EGFP-EGFP carrier and obtain Lv-ef1 α-IRES-EGFP.
IRES-EGFP amplimer sequence is:
5’-gcgcGGATCCAAGATACACCTGCAAAGGCGGC-3’(SEQ?ID?NO:1)；
5’-gcgcGCGGCCGCTTACTTGTACAGCTCGTCCATGCC-3’(SEQ?ID?NO:2)；
Rtta is increased out by PCR from original plasmid pRevTet-OnTM (available from Clontech, Catalog No.631007) is upper, restriction enzyme site BamHI and BglII are introduced in two ends.
The amplimer sequence of Rtta is:
5’-gcgGGATCCATGTCTAGATTAGATAAAAGTAAAGTGATTAACAG-3’(SEQ?ID?NO:3)；
5’-ggcAGATCTTACCCACCGTACTCGTCAATTC-3’(SEQ?ID?NO:4)；
Be connected into after cutting with BamH1 and Bgl II enzyme after pcr amplification on Lv-ef1 α with the BamH1 single endonuclease digestion-IRES-EGFP carrier, after identifying, order-checking obtains Lv-ef1 α-rtta-IRES-EGFP.
Schematic diagram such as Fig. 2 of the plasmid that obtains.
Lv-ef1 α-EGFP-TRE-Oct4 construction process is as follows:
Go out the TRE sequence from original plasmid pRevTRE (available from clontech) is upper by pcr amplification.Primer sequence is:
5’-ccggCTGCAGCGAGTTTACCACTCCCTATCAGTG-3’(SEQ?ID?NO:5)；
5’-ccggCTCGAGGGATCCCCGGGTACCGAGCTC-3’(SEQ?ID?NO:6)；
The PCR product is connected in Lv-ef1 α-EGFP carrier after Mul1 and BamH1 enzyme are cut, obtains Lv-ef1 α-EGFP-TRE.
According to oct4 gene design primer, the cDNA sequence of amplification oct4, primer sequence is:
5’-ggggGGATCCgccaccatggcgggacacctggcttc-3’(SEQ?ID?NO:7)；
5’-gcgcGTCGACtcagtttgaatgcatgggag-3’(SEQ?ID?NO:8)；
Take people's cDNA as template, cut with BamHI and SalI enzyme after pcr amplification, be connected on carrier LV-EF1 α-EGFP-TRE, can obtain LV-EF1 α-EGFP-TRE-oct4.
Schematic diagram such as Fig. 1 of the plasmid that obtains.
Plasmid LV-EF1 α-EGFP-TRE-DsRed construction process is with LV-EF1 α-EGFP-TRE-oct4, and the DsRed fragment is obtained by pcr amplification by original plasmid pDsred1-N1 (available from clontech), and primer sequence is:
5’-gcgcGAATTCGCCACCATGGCCTCCTCCGAGAACGTC-3’(SEQ?ID?NO:9)；
5’-ggggGTCGACCTACAGGAACAGGTGGTGGCG-3’(SEQ?ID?NO:10)；
Restriction enzyme site is BamHI and SalI.
II. specific embodiment
1, the viral amplification with plasmid of bag and concentrated and purified
Carrier Lv-ef1 α-EGFP-TRE-Oct4 and Lv-ef1 α-rtta-IRES-EGFP are identified that through order-checking correct plasmid transformed competence colibacillus bacterium GBE180 (available from Si Dansai biotech firm) increases, take out test kit (AxyPrep plasmid Maxiprep Kit) in the production of use Axygen company the lentiviral vectors plasmid is carried out middle amount extracting.
The plasmid that extracting is obtained carries out purifying in super clean bench concentrated.The concentrated step of purifying is: take out the NaAC (3M) of rear plasmid 1/10 volume in 1) adding, then add the dehydrated alcohol of 2 times of volumes, mix; 2) the centrifugal 20min of 13000rpm, sop up supernatant, with the ethanol rinsing of 75% (v/v) once, sops up dehydrated alcohol; 3) after drying in super clean bench, use distilled water with the plasmid resolution of precipitate; 4) use spectrophotometer to determine the concentration of the concentrated rear plasmid of purifying, and confirm to obtain quality and the concentration of plasmid with the agarose-gel electrophoresis of 0.7% (w/v).
2, infect packing with virus
Use Fugene transfection reagent (Roche company) with the slow virus plasmid and the common transfection 293T cell of packaging plasmid pVSVG (available from clontech), delta8.91 (available from clontech) that obtain in step " 1 ".
Take transfection in the T75 Tissue Culture Flask as example, concrete steps are:
1) the second day cell can grow to 80-90% density, does not need to change substratum at T75 middle berth 1,000 ten thousand 293T cells the day before yesterday in transfection.
2) mix plasmid, transfection reagent and medium solution according to following scheme:
Slow virus plasmid: 10 μ g; PVSVG:5 μ g; Delta 8.91:7.5 μ g; Adopt opti MEM to complement to 1ml.
The ratio of each composition in system: slow virus plasmid DNA: pVSVG:delta 8.91=4:2:3;
Total DNA:opti MEM=2 μ g:100 μ l;
Total DNA:Fugene=2 μ g:5 μ l;
3) 12-24h after transfection, can be at fluorescence microscopy Microscopic observation fluorescent brightness and transfection efficiency., if the transfection success, sop up the substratum in T75, add the fresh 10%D-MEM of 10ml.
4) collect viral supernatant respectively at 48h and these two periods of 72h, the virus of collecting is put 4 ℃ of short-term preservations of refrigerator.
3, infect titer determination with viral Lv-ef1 α-EGFP-TRE-Oct4
1) digestion 293T cell, every hole paving 150,000 cells in 24 orifice plates.
2) the centrifugal 5min of virus-4 000rpm that aforementioned " 2 " is obtained, make cell debris centrifugal to managing at the end, then uses 0.45 μ m membrane filtration.
3) get respectively in two holes in viral supernatant to 24 orifice plate of 2 μ l and 5 μ l, add helping of 1/1000 volume to turn reagent polybrene, shake up and be placed in incubator.
4) can add up its titre at the fluorescence microscopy Microscopic observation after 48h, wherein, virus titer (TU/ml)=green fluorescence cell accounts for total cell count ÷ 2 (or 5) * 1.5 * 10
5* 10
3.
4, infect titer determination with viral Lv-ef1 α-rtta-TRE-EGFP
4.1293T-ETD the foundation of clone
1) with the 293T cell dissociation, counting, infect slow virus lv-ef1a-eGFP-TRE-dsRed take multiplicity of infection (MOI is as 5), after infecting 24h,, with trysinization 293T cell, goes down to posterity, and with the ratio of each 10cm culture dish of 1000 cells, goes down to posterity.
2) approximately after 7 days, the 293T cell, by the unicellular cell clone that grows, is selected the cell clone of the eGFP positive under fluorescent microscope in the 10%DMEM cultivation, sets up single cell clone system, and by name is 293T-ETD clone.This clone can be stable expression eGFP, and in the situation that there are the expression of initial deRed in rtta and DOX, fluorescence takes on a red color under green glow.
4.2 the mensuration of virus titer
1) digestion 293T-ETD cell, every hole paving 80,000 cells in 24 orifice plates.
2), with the viral Lv-ef1 α of aforementioned acquisition-centrifugal 5min of rtta-TRE-EGFP 4000rpm, make cell debris centrifugal to managing at the end, then use 0.45 μ m membrane filtration.
3) get respectively in two holes in viral supernatant to 24 orifice plate of 2 μ l and 5 μ l, what add 1/1000 volume helps transduction reagent polybrene, shakes up and is placed in incubator.
4) after 24h, substratum is changed into 10%DMEM (1ug/ml doxcycline), can account at fluorescence microscopy Microscopic observation red fluorescence cell the ratio of total cell after 72h, thereby add up its titre, wherein, virus titer (TU/ml)=red fluorescence cell accounts for total cell count ÷ 2 (or 5) * 8 * 1.5 * 10
5* 10
3.
1,293T cell
The cultivation of 293T cell and 293T-ETD, while going down to posterity under the condition of 37 ℃ with the trypsin digestion cell 5min of 0.25% (w/v), use the D-MEM that contains 10%FBS to stop digestion reaction, with cell mass blow and beat into unicellular after by going down to posterity at 1: 8 or frozen.
2, pig fibroblast
The pig fibroblast is taken from the ear inoblast of a month large piggy, and culture condition is the D-MEM of 10%FBS.While going down to posterity under the condition of 37 ℃ with 0.25% trypsin digestion cell 5min, use the D-MEM that contains 10%FBS to stop digestion reaction, with cell mass blow and beat into unicellular after by going down to posterity at 1: 4 or frozen.
Concrete steps are as follows:
1) spread in advance gelatin in the T25 bottle, then every hole kind enters 500,000 pig ear inoblasts.
2) slow virus Lv-ef1 α-EGFP-TRE-Oct4 and the Lv-ef1 α-rtta-IRES-EGFP of embodiment 1 packing are mixed in 1: 1 (with viral pfu), with MOI (infection multiplicity) 2 infected pigs ear inoblasts.
3) infect rear second day and change liquid, at the cell proportion of the fluorescence microscopy Microscopic observation EGFP positive.
Result such as Fig. 3, the cell proportion that obtains the EGFP positive is about 15%.
The pig ear inoblast of the rear EGFP positive of virus is infected in embodiment 4, FACS sorting
The cell amplification to 300 ten thousand (approximately amount that T75 covers with) that obtains will be infected in embodiment 3, after 37 ℃ of digestion 5min of 0.25% pancreatin of 2ml, the neutralization of 4ml substratum, repeatedly blow and beat to cell and dispel, the cell in rear use 100 μ M apertures shone cell one time, then used the centrifugal 3min of 1200rpm, removed supernatant, rear with 1ml PBS re-suspended cell, cell suspension is transferred to the cell that carries out the sorting EGFP positive in the sorting pipe of 5ml.
Result such as the Fig. 4 of pig ear inoblast FACS sorting EGFP positive cell after the infection slow virus.Left figure is the inoblast eGFP expression of uninfecting virus, and middle figure is the inoblast eGFP expression after infection virus, and right figure is retest cell eGFP expression after sorting is completed.
Cell microscopy result such as Fig. 5 of the EGFP positive that sorting obtains.
The cell that sorts out is added two anti-amplifications of cultivating with the D-MEM of 15% (v/v) serum.
Be taped against respectively in six orifice plates after the cell amplification of the EGFP positive that sorting in embodiment 4 is obtained, every hole paving 15 complete cells, each 2 hole of sample paving, one of them is control wells, cultivate with 10%DMEM, another hole is experimental port, with 10%DMEM (1ug/mL doxycycline), cultivates, and changes every other day liquid, use 0.25% trysinization 5min after 4 days, extract RNA after centrifugal collecting cell, then counter-rotating obtains cDNA, is finally Real-time PCR and detects the expression of oct4 gene.
1, the extraction of the fibroblastic RNA of pig ear
1) will receive cell that the doxycyclin of sample processes and control cells with the abundant cracking of 1mlTrizol, immediately concuss or with rifle, blow and beat to tissue block and disappear.
2) add 200 μ l chloroforms in 1ml Trizol sample, arm concuss 15s, room temperature is placed 2-3min.
3) room temperature, in the centrifugal 15min of 12000rpm, this moment pipe, liquid divides three layers (upper strata is water white transparency RNA extraction liquid, the pink Trizol of lower floor, thin intermediate is albumen), carefully supernatant liquid is drawn in new EP pipe, this step should note not being drawn onto albumen and the Trizol of lower floor.
4) add 500 μ l Virahols in the EP pipe that fills the RNA extraction liquid, softly put upside down and mix, room temperature is placed 10min.
5) room temperature, the centrifugal 10min of 12000rpm, white precipitate appears in the pipe end.
6) abandon supernatant, add 1ml75% ethanol, precipitation is suspended.
7) room temperature, the centrifugal 10min of 12000rpm, abandon supernatant, then be placed in whizzer tube wall liquid is got rid of down, with the lancet head, liquid in pipe blotted as far as possible.
8) mouth of pipe opens wide and places 10min, and precipitation is dried, and sees and precipitates transparent the getting final product that become colorless.
9) add 15 μ l DEPC to process water, 55 ℃ of water-bath 10min.
10) get 1 μ l RNA solution electrophoresis, the 7%Agarose gel of handy new configuration during electrophoresis, and the electrophoretic buffer that more renews.
11) get 1 μ l RNA solution dilution in ultrapure water to final volume 70 μ l, survey OD.
2, the acquisition of fibroblastic cDNA
1) get the RNA (concentration conversion that records according to the OD instrument becomes volume) that obtains in 5ug aforementioned " 1 ", processing water with DEPC-mends to 11 μ l, add 1 μ l primer (Random hexamer primer), mix, 70 ℃ of water-bath 5min, place coolingly on ice, on whizzer, drop on tube wall is got rid of down.
2) add successively 4 μ l 5 * reaction buffers, 1 μ l RNA enzyme inhibitors, 2 μ l 10mM dNTP, mix, and on whizzer, the tube wall drop got rid of down 25 ℃ of water-bath 5min.
3) add RevertAid M-MuLV Reverse Transcriptase1 μ l, mix 42 ℃ of water-bath 1h.
4) on whizzer, the tube wall drop is got rid of down after reaction is completed, 70 ℃ of 10min termination reactions, gained cDNA sample is put-20 ℃ of preservations.
3, Real-time PCR detects the expression of each clone external source oct4
Reaction system is as follows:
Flick the pipe end solution is mixed, 6000rpm is of short duration centrifugal.Each sample is set up two parallel holes.Use G3PDH as internal reference.Primer sequence is:
G3PDH：
F-primer sequence: ACCTGCCGCCTGGAGAAACC (SEQ ID NO:11);
R-primer sequence: GACCATGAGGTCCACCACCCTG (SEQ ID NO:12);
Exo-oct4：
F-primer sequence: AGAAGGATGTGGTCCGAGTGTG (SEQ ID NO:13);
R-primer sequence: CAGAGTGGTGACAGAGACAGGG (SEQ ID NO:14).
Reaction conditions is: 45 ℃ 5 minutes, then 95 ℃ 2 minutes, last 94 ℃ of 15s, 66 ℃ of 10s, 72 ℃ of 15s totally 40 circulations.
Result such as Fig. 6, under visible condition adding 1ug/mL, 4ug/mL concentration doxycycline, but high expression level oct4.
The pig ear inoblast of the EGFP positive that sorting is obtained is with 0.25% trysinization 5min, in 10%DMEM and rear counting, goes down to posterity in the 9cm culture dish of preincubate gelatin 10min, and each ware passes 1000 cells.Substratum changes 15%DMEM (+1.5ng/mL bFGF) into, changes liquid once in every 3 days, the every ware of 9ml.
After about 1 week, in culture dish, cell, by the unicellular cell clone that grows up to, starts the picking clone.at first at microscopically, the clone is carried out mark, and then in operator's console, substratum is drawn to the every ware of residue 1ml with sucking pump, then utilize clone's ring of sterilizing 8cm diameter to dip silica gel, circle is lived cell clone, and compress, prevent the bottom leakage, finally the pancreatin of 0.25% (w/v) is added in clone's ring, put into 37 ℃ of incubators and hatch 5min, then neutralize with the 10%DMEM of 2 times of volumes, with reaching in hole of 96 orifice plate after 200 μ l rifle head piping and druming for several times, the amplification of 15%DMEM (+1.5ng/ml bFGF) culture condition, obtain the pig ear fibroblast of the EGFP positive in unicellular source.
Microscopy result such as Fig. 7 that the positive pig ear of EGFP inoblast mono-clonal forms.
The outer rim oct4 that utilizes the Real-time round pcr to detect the pig ear fibroblast of each EGFP positive that obtains in embodiment 4 expresses, and filters out the highest clone of expression amount.
After the positive pig ear of the EGFP that sorting obtains inoblast builds up monoclonal cell system, the doxycyclin that adds 1ug/mL processed after 3 days, utilize Real-time PCR to detect analytical results such as Fig. 8 that external source oct4 expresses, result can be found out, in the cell of the eGFP positive that sorts out, exist the cell monoid with different oct4 expression amounts, it is widely different that each monoclonal is expressed oct4, and we only screen the clone of 2 plant height efficient expression oct4 genes.
The inoblast of the described regulatable expression oct4 that obtains is for after adding the medicine doxycycline, and with not adding medicine relatively, the expression of oct4 detects and can raise 50 times of left and right by real-time PCR.
All quote in this application as a reference at all documents that the present invention mentions, just as each piece document is quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. a method of expressing the oct4 gene in the ungulate inoblast, is characterized in that, comprising:
(1) provide slow virus plasmid 1, wherein contain the element that following operability connects: ef1 α, rtta, IRES, EGFP; And slow virus plasmid 2, wherein contain the element that following operability connects: ef1 α, EGFP, TRE, Oct4;
(2) with slow virus plasmid 1 and the common transfection ungulate inoblast of slow virus plasmid 2, select the cell of the EGFP positive, this cell is the ungulate inoblast that can express the oct4 gene.
2. method as claimed in claim 2, is characterized in that, also comprises step:
(3) the ungulate inoblast that utilizes doxycycline treatment step (2) to obtain, induce the ungulate inoblast to express the oct4 gene.
3. method as claimed in claim 2, is characterized in that, also comprises step:
(4) from the EGFP positive cell that step (3) obtains, select the ungulate inoblast of oct4 gene high expression.
4. method as claimed in claim 3, is characterized in that, utilizes polymerase chain reaction to determine the fibroblastic oct4 gene expression amount of described ungulate.
5. the method for claim 1, is characterized in that, described slow virus plasmid 1 and slow virus plasmid 2 are with (1～2): mix (1～2).
6. the method for claim 1, is characterized in that, described slow virus plasmid 1 and slow virus plasmid 2 infect the ungulate inoblast with MOI 1.5-3.
7. the method for claim 1, is characterized in that, described ungulate is pig.
8. but the ungulate inoblast of an abduction delivering oct4 gene, is characterized in that, described transit cell dyes slow virus plasmid 1, wherein contains the element that following operability connects: ef1 α, rtta, IRES, EGFP; And slow virus plasmid 2, wherein contain the element that following operability connects: ef1 α, EGFP, TRE, Oct4.
9. ungulate inoblast as claimed in claim 8, is characterized in that, it is prepared by the arbitrary described method of claim 1-7.
10. the fibroblastic purposes of ungulate claimed in claim 8, be used for the donorcells as nuclear transplantation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101408574A CN103388008A (en) | 2012-05-08 | 2012-05-08 | Ungulate animal cell line for inductively expressing pluripotent maintenance gene and construction thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101408574A CN103388008A (en) | 2012-05-08 | 2012-05-08 | Ungulate animal cell line for inductively expressing pluripotent maintenance gene and construction thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103388008A true CN103388008A (en) | 2013-11-13 |
Family
ID=49532430
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101408574A Pending CN103388008A (en) | 2012-05-08 | 2012-05-08 | Ungulate animal cell line for inductively expressing pluripotent maintenance gene and construction thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103388008A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624194A (en) * | 2016-02-16 | 2016-06-01 | 广东省农业科学院农业生物基因研究中心 | Conditional Cas9 expression induced swine trophoblastic cell line and establishment method and application thereof |
| CN108315304A (en) * | 2017-01-16 | 2018-07-24 | 南京医科大学 | The construction method of one boar naive embryonic stem cell lines |
-
2012
- 2012-05-08 CN CN2012101408574A patent/CN103388008A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624194A (en) * | 2016-02-16 | 2016-06-01 | 广东省农业科学院农业生物基因研究中心 | Conditional Cas9 expression induced swine trophoblastic cell line and establishment method and application thereof |
| CN108315304A (en) * | 2017-01-16 | 2018-07-24 | 南京医科大学 | The construction method of one boar naive embryonic stem cell lines |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chojnacka-Puchta et al. | Primordial germ cells (PGCs) as a tool for creating transgenic chickens | |
| CN105274140A (en) | Method for building muscle cell-specific expression mCherry fluorescent protein zebra fish family | |
| CN102187845B (en) | Transgenic method for improving silk yield | |
| CN102199624B (en) | Method for efficiently producing recombinant proteins in mammary glands by utilizing artificial chromosomes | |
| Min et al. | Generation of antiviral transgenic chicken using spermatogonial stem cell transfected in vivo | |
| CN105238742A (en) | Inducing method for danio-rerio inductivity multi-potential stem cells and inductive culture medium and iPS culture medium used for the same | |
| CN108779441A (en) | The manufacturing method of cardiac progenitor cell and cardiac muscle cell is manufactured by multipotential stem cell | |
| CN104099371A (en) | Application of KAP26.1 gene as exogenous gene introduced into cashmere goat cells and used for improving wool fineness | |
| Pu et al. | Development of pseudotyped retroviral system for effective gene transfer and expression in penaeid shrimp cells | |
| CN103388008A (en) | Ungulate animal cell line for inductively expressing pluripotent maintenance gene and construction thereof | |
| CN103695466B (en) | The carrier of the reversible immortalization of a kind of induced animal cell in vitro and application thereof | |
| CN110747199B (en) | Bee stress-resistance related gene NF-Y and application thereof | |
| CN107858449A (en) | A kind of dog interferon alpha biological activity detection method | |
| CN107858450A (en) | A kind of chicken interferon α biological activity detection methods | |
| CN108795874B (en) | Method for reprogramming fibroblast into Sertoli cell in vitro and application thereof | |
| CN106256909A (en) | Express the transgenic chicken breeding method of duck RIG-I albumen | |
| CN103421781A (en) | Promoters of pig muscle tissue specific expression gene myf6 and use thereof | |
| CN102747104A (en) | Non-exogenous induced factor integrated porcine induced pluripotent stem cell and its construction method | |
| CN102899293A (en) | Mesenchymal stem cells genetically modified with angiopoietin 1 gene and construction method and application thereof | |
| CN104212837A (en) | Lentiviral vector for expression of human serum albumin and construction method thereof | |
| CN107018955A (en) | A kind of transgene pig of the type of resisting porcine circovirus 2 | |
| CN107177630A (en) | A kind of anti-PCV2 transgene pigs preparation method without exogenous marker gene | |
| CN104450781B (en) | A kind of cell line of overexpression CIAPIN1 albumen and its preparation method and application | |
| CN101993895A (en) | Construction and application method of efficient double promoter PLEGFP-N1-spMyoD1 green fluorescence retrovirus vector | |
| WO2020006675A1 (en) | Method for in vitro reprogramming of fibroblasts into sertoli cells and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131113 |