CN104178492A

CN104178492A - Sequence for coding three activated growth factors and application of sequence

Info

Publication number: CN104178492A
Application number: CN201410330202.2A
Authority: CN
Inventors: 叶景佳; 曹江; 郑丹丹; 杨蓓蓓
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2014-07-13
Filing date: 2014-07-13
Publication date: 2014-12-03
Anticipated expiration: 2034-07-13
Also published as: CN104178492B

Abstract

The invention provides a coding sequence for expressing IGF1 (Insulin-like Growth Factor 1), EGF (Epidermal Growth Factor) and FGF2 (Fibroblast Growth Factor 2) simultaneously. By utilizing the coding sequence provided by the invention, corresponding expression vectors can be constructed, and the expression vectors are led into cells for efficiently and stably secreting the IGF1, EGF and FGF2 with biological activities for various researches in which the three growth factors are needed to be added. Compared with a conventional method of adding various recombinant growth factors, the coding sequence provided by the invention has the advantages that a problem that the concentration cannot be stably kept as exogenous recombinant growth factors are added due to continuous consumption of the growth factors by cell growth is solved, and the defect that various commercial recombinant growth factors are dear is also avoided. Different cells can be transfected by virtue of the constructed expression vectors according to the needs to construct different cell co-culture systems, so that rich and flexible application is realized, working steps for adding the exogenous growth factors simultaneously and adopting the co-culture systems are greatly simplified, and the cost is also reduced.

Description

Sequence and the application thereof of three kinds of activated form somatomedins of a kind of coding

Technical field

The invention belongs to biotechnology, relate to multiple genes and express simultaneously, specifically, relate to a kind of growth factors I GF1, the EGF of the three kinds of activation that can secrete and sequence of FGF2 of can encoding on same transcript.This sequence can be for building eukaryotic expression vector, and can express above-mentioned without the processing activated three kinds of somatomedins of direct tool and be secreted into extracellular importing after eukaryotic cell in cell Simultaneous Stabilization.

Background technology

In recent years, along with stem cell related mechanism research deeply and the effort of obtaining in every way stem cell constantly obtain new achievement, the huge differentiation potential of stem cell repair and the regeneration of damaged organ aspect demonstrated application prospect widely, for the treatment of various diseases has brought hope.Stem cell is the multipotential cell that a class can be carried out self, can induce differentiation to become Various Tissues cell type under certain condition.Different according to source, by the normal differentiation ripening process of specific cells in analogue body, stem cell can be induced to differentiate into respectively the functioning cell of end differentiation eventually such as neurocyte, myocardial cell, various hemocyte, interior ear cell.The factor that affects differentiation of stem cells is a lot, and mechanism is complicated.While utilizing stem cell to carry out disease treatment, need to be by the stem cell functioning cell that directed differentiation is particular type effectively, and need certain noble cells quantity and purity, to reach good curative effect and to reduce untoward reaction as far as possible.In order to reach this purpose, conventionally need according to circumstances in culture system, to add various exogenous growth factors.In the somatomedin of adding in all external sources, type-1 insulin like growth factor (IGF1), Urogastron (EGF) and FGF2 (FGF2) are the maximum somatomedins of application.These three kinds of somatomedins are used conventionally simultaneously, and they are that strong mitogenesis is former, and acceptor is widely distributed, not only can maintain cells survival, promote cell proliferation, also participate in the atomization of various kinds of cell, regulate activity and the function of cell.

In addition, in a lot of oncology studies, the growth of primary tumor cell or clone also has in many situations needs to add above-mentioned somatomedin, is beneficial to the survival of primary tumor cell after in vitro, detects the dependency of tumour cell to corresponding somatomedin or acceptor when growing and carrying out targeted drug research.When corresponding somatomedin EGF carrys out the mechanism of action of Tumor Cell Growth Stimulated, research fibroblast growth factor receptor (FGFR) inhibitor class medicine, need to add spheroid that corresponding somatomedin is generally FGF2, research tumor stem cell characteristic forms in experiment and also need in serum-free medium, add two kinds of somatomedin EGF and FGF2 as need to be added while studying the effects anb Mechanism of EGF-R ELISA (EGFR) micromolecular inhibitor.

But because the stability of somatomedin basis in nutrient solution is affected by its transformation period, and Growth of Cells continues the demand of somatomedin, the artificial recombinant growth factors that adds can not stably maintain its effect, and the price of recombinant growth factors own is also very expensive.If therefore can express activated somatomedin by cytotostatic, can effectively in culturing process, stably maintain the concentration of somatomedin.

Therefore can express the expression vector of activated form IGF1, EGF and tri-kinds of somatomedins of FGF2 simultaneously and import to (as set up the engineering cell for co-culture system) in corresponding cell by building, obtain Simultaneous Stabilization and express the clone of three kinds of somatomedins, for further research, as set up co-culture system with stem cell, utilize three kinds of somatomedins of the continual and steady secretion of engineering cell, induced dry-cell breaks up to specific cells; Cultivate altogether with primary tumor cell, maintain its external existence, growth and propagation.

In eukaryotic cell, destination gene expression is mainly transcribed the regulation and control of two levels of (comprise and transcribe post-treatment) and translation (comprising translation post-treatment).At transcriptional level usually by adopting strong promoter (as CMV promotor) to reach high-caliber stable transcribing, and transcript only comprise as far as possible ripe mRNA open reading frame with avoid needs extra transcribe post-treatment (impact produces finally can supply the efficiency of transcription product translated); Comprise that in the regulation and control of translation skill can strengthen translation initiation, pilot protein matter location (as secreted required signal peptide) and reduce synthetic protein equally is as far as possible to embody function or demand active and to translation post-treatment

Therefore, we are according to mentality of designing as shown in Figure 1 in the present invention, IGF1, EGF and tri-somatomedin encoding sequences of FGF2 are connected in series, make them can be on same transcript in the time of cell inner expression, once transcribe to express and express three kinds of somatomedins simultaneously; In order to reduce the impact of translation post-treatment efficiency on final protein, after making growth factor protein matter synthetic, needn't process and have activity, we do not adopt the encoding sequence of three kinds of complete somatomedins, comprise three kinds of rear activated part encoding sequences of somatomedin processing but only cloned; In order effectively to make the somatomedin of expressing be secreted into extracellular, we have merged human normal immunoglobulin before each somatomedin the signal peptide of light chain; Because each somatomedin is the absolute coding frame of initiation codon and termination codon, therefore we add Internal ribosome entry site (Internal ribosome entry site between three factor encoding sequences, IRES), translate into corresponding protein to ensure three somatomedins all can effectively be identified by rrna; In order to improve the efficiency of translation initiation identification, we have added Kozak sequence conservative in eukaryotic cell before each somatomedin encoding sequence initiation codon.

According to above-mentioned design, we have invented the artificial sequence of simultaneously encode IGF1, EGF and tri-kinds of activation somatomedins of FGF2, this sequence can be for being further building up on expression vector, and by importing in cell, give expression to three kinds simultaneously and have bioactive somatomedin.

The present invention can be used for various needs provides the research of stablizing external source IGF1, EGF and FGF2, includes but are not limited to stem cell correlative study and Tumor-assaciated research.

Summary of the invention

The object of this invention is to provide a kind of encoding sequence of simultaneously expressing IGF1, EGF and tri-kinds of somatomedins of FGF2, there is the nucleotide sequence as shown in SEQ ID No:1.Wherein the 7th to the 14th, the 888th to the 895th and the 1718th to the 1725th is Kozak sequence; The 15th to the 77th, the 896th to the 958th and the 1726th to the 1788th is Igk signal coding sequence; The 297th to the 881st and the 1127th to 1711 is IRES sequence; The 78th to 290 is activated form IGF1 encoding sequence; The 959th to the 1120th is activated form EGF encoding sequence; The 1789th to 2256 is activated form FGF2 encoding sequence.

Another object of the present invention is to provide the application of this encoding sequence.This encoding sequence is used for building carrier for expression of eukaryon, after transfered cell (as 293T cell), can stability and high efficiency ground express the somatomedin of IGF1, EGF and tri-kinds of activation of FGF2, for further with various research.

The present invention compared with the existing technology has the following advantages and effect:

Utilize encoding sequence provided by the invention, can build corresponding expression vector, by transfered cell, secretion has bioactive IGF1, EGF and tri-kinds of somatomedins of FGF2 efficiently and stably, for the various research that need to add these three kinds of somatomedins.Compared with traditional various recombinant growth factors of interpolation, solve because Growth of Cells adds to the lasting consumption of somatomedin the problem that external source recombinant growth factors can not stable maintenance concentration, also avoided the expensive shortcoming of extensive stock recombinant growth factors.The expression vector building in addition can be selected the different cells of transfection as required, build various co-culture of cells system, realize abundant application flexibly, need to add exogenous growth factors simultaneously and adopt the algorithm of co-culture system greatly to simplify, also reduced cost.

Brief description of the drawings

Fig. 1 is the design diagram of IGF1, EGF and tri-kinds of factor encoding sequences of FGF2.

Fig. 2 IRES sequence, Ig the clone of signal coding sequence and activated form EGF encoding sequence.

The structure of Fig. 3 lentiviral vectors and qualification.

Fig. 4 slow virus infection HEK293T cell.

Fig. 5 Western blot detects growth factor expression.

Fig. 6 CCK-8 detects A549 cell proliferation.

Embodiment

The present invention is described further with specific embodiment by reference to the accompanying drawings.These embodiment only, for explanation, but do not limit the present invention.

embodiment 1: IRES sequence, Ig the clone of signal coding sequence, activated form EGF, IGF1 and FGF2 encoding sequence is with synthetic.

The clone of IRES sequence:

Adopt PCR method to clone IRES from pIRES2-EGFP plasmid.Primer is respectively

IRES-F（SEQ?ID?No:?2）:?5’- ACTAGTGCCCCTCTCCCTCCCCCC-3’，

IRES-R(SEQ ID No:3): 5 '- tCTAGA(underscore part is respectively introducing to TGTGGCCATATTATCATCGTG-3 ' spei and xbai restriction enzyme site).

Pcr amplification condition is 94 DEG C of sex change 5min, then 94 DEG C of sex change 30sec, 58 DEG C of annealing 30sec, 72 DEG C of extension 30sec, and totally 30 circulations, last 72 DEG C are extended 7min.Amplified production (597bp, Fig. 2 A) is identified by 2% agarose gel electrophoresis, and is cut glue according to the QIAquicK Gel Extraction Kit specification sheets of QIAGEN and reclaim.Get 3 μ l cut glue reclaim product be connected with pGEM-T Easy Vector, at T ₄the lower 16 DEG C of connections of DNA ligase enzyme effect are spent the night.Connect product and be transformed into DH5 in competent cell, amicillin resistance plate screening is cultivated, picking positive colony, sequence verification after EcoRI enzyme is cut qualification correctly.

Ig the clone of signal coding sequence:

Adopt PCR method to clone Ig from pSecTag2A plasmid signal coding sequence.Primer is respectively Ig -F(SEQ ID No:4): 5 '- aCT AGT tAG CCA CCA (underscore part is what introduce to TGG AGA CAG AC-3 ' spei restriction enzyme site, italic thickened portion is the Kozak sequence of introducing); Ig -R(SEQ ID No:5): 5 '-GTC ACC AGT GGA ACC TGG AA-3 '.Pcr amplification condition is the same, and amplified fragments size is 77bp(Fig. 2 A), the same method clone sequence verification.

The clone of activated form EGF encoding sequence:

Extract total RNA of colorectal cancer cells SW620 with Trizol method, adopt the synthetic cDNA of reverse transcription reagent M-MLV Reverse Transcriptase reverse transcription of Promega company, then taking this cDNA as template, pcr amplification goes out EGF encoding sequence.Primer is respectively EGF-F(SEQ ID No:6): 5 '- tTCCAGGTTCCACTGGTGAC (italic thickened portion is the Ig introducing to AATAGTGACTCTGAATGTCCCC-3 ' signal peptide downstream complementary sequence), EGF-R(SEQ ID No:7): 5 '- tCTAGA tTA (underscore part is what introduce to GCGCAGTTCCCACCACTTCA-3 ' xbai restriction enzyme site, italic thickened portion is the termination codon of introducing), pcr amplification condition is the same, and EGF clip size is 188bp(Fig. 2 A), the same method clone sequence verification.

With Ig signal peptide and EGF encoding sequence fragment are template, respectively with Ig -F(SEQ ID No:4) and EGF-R(SEQ ID No:7) for upstream and downstream primer carries out overhangPCR amplification, amplification condition is the same, 245bp Ig is obtained in amplification -EGF object fragment (Fig. 2 B), the same method clone PCR products sequence verification.

Synthesizing of activated form IGF1 and FGF2 encoding sequence:

With Kozak sequence and Ig the activated form IGF1 of signal coding sequence and FGF2 sequence are directly synthetic by company respectively, and sequence is as follows:

(296bp, underscore part is respectively introducing to IGF1 spei and xbai restriction enzyme site, italic thickened portion is the Kozak sequence of introducing, italic underscore part is the Ig introducing signal coding sequence) (SEQ ID:8):

5’- ACTAGT TAGCCACC ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC GGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGGATGCTCTTCAGTTCGTGTGTGGAGACAGGGGCTTTTATTTCAACAAGCCCACAGGGTATGGCTCCAGCAGTCGGAGGGCGCCTCAGACAGGCATCGTGGATGAGTGCTGCTTCCGGAGCTGTGATCTAAGGAGGCTGGAGATGTATTGCGCACCCCTCAAGCCTGCCAAGTCAGCTTAA TCTAGA-3’

(551bp, underscore part is respectively introducing to FGF2 spei and xbai restriction enzyme site, italic thickened portion is the Kozak sequence of introducing, italic underscore part is the Ig introducing signal coding sequence) (SEQ ID:9):

5’- ACTAGT TAGCCACC ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC GCAGCCGGGAGCATCACCACGCTGCCCGCCTTGCCCGAGGATGGCGGCAGCGGCGCCTTCCCGCCCGGCCACTTCAAGGACCCCAAGCGGCTGTACTGCAAAAACGGGGGCTTCTTCCTGCGCATCCACCCCGACGGCCGAGTTGACGGGGTCCGGGAGAAGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGGAGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATGTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGGATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTGATAA TCTAGA-3’。

embodiment 2: the structure of Lentiviral

According to the design of Fig. 1, above-mentioned acquired each fragment is connected successively and is cloned in lentiviral vectors plasmid pLVX-IRES-ZsGreen1, use restriction endonuclease ecorI and xbathe direction of I double digestion qualification Insert Fragment, when forward inserts, clip size is 8.2kb and 2280bp(Fig. 3), show to successfully construct.The correct plasmid called after pLVX-3GF inserting.

With QIAGEN Plasmid Midi Kits extraction plasmid pLVX-3GF, pMD2G and pSPAX2, respectively get 10 respectively be diluted in 1ml and do not contain in antibiotic DMEM in high glucose containing serum, softly mix, then add 30 attractene Transfection Reagent, in above-mentioned substratum, softly mixes rear room temperature and leaves standstill 20min to form transfection composite.Human Embryonic Kidney HEK 293T cell routine is incubated at containing the DMEM in high glucose of 10% foetal calf serum and trains viral nutrient solution supernatant, and with 0.45 μ m filter filtration, 4 oC save backup.

embodiment 3: the expression in HEK293T cell of three kinds of somatomedins

Inoculation HEK293T cell is (substratum is not containing microbiotic) in 3.5cm culture dish, and after 24h, (cell reaches 70% degree of converging) sucks nutrient solution, adds 500 to support in base, in 37 oC, 5% CO ₂saturated humidity incubator in cultivate.1ml is digested after HEK293T cell suspension after centrifugal and 1ml transfection composite mix gently and joined in 10cm culture dish, in 37 oC, 5% CO ₂saturated humidity incubator in cultivate, after 6-8 h, supply substratum to 10ml.After transfection 48 h and 72 h, collection contains respectively containing the upper cleer and peaceful Polybrene(stock solution 10mg/ml of virion, final concentration 8 / ml), after 6 h, supply nutrient solution, after 24h, change fresh medium, cell continues to cultivate after 48h, fluorescence microscopy Microscopic observation infection conditions (Fig. 4 A), and the cell clone (Fig. 4 B) that adopts limiting dilution assay (1 cells/well is inoculated in 96 orifice plates) screening can express the stable infection of green fluorescent protein, by the stable cell clone called after HEK293T/3GF infecting.

Utilize Western blot method to detect the expression of infecting rear target protein:

Factors check in cell: results HEK293T/3GF cell and the HEK293T control cells not infecting, PBS washed cell 3 times, centrifugal collecting cell, add lysate (25 mM Tris-HCl, pH 7.6,150 mMNaCl of ice precooling, 1% NP-40,1% Sodium desoxycholate, 0.1% SDS, containing proteinase inhibitor C omplete ^tMprotease Inhibitor Cocktail), and be placed in cracking 30min on ice, 15000r/min, 4 ° of centrifugal 15min of C collect supernatant, with DC protein quantification kit measurement protein concentration, get 20 total protein carries out transferring film after 20% SDS-PAGE gel electrophoresis, after 10% milk room temperature sealing 1h, adds respectively 4 ° of C overnight incubation of tri-kinds of antibody of EGF, FGF2 and IGF1 (1:500).TBST (TBS adds 0.1%Tween20) washes film 3 × 10min, adds two anti-(1:5000) incubated at room 2h of peroxidase labelling, washes film 3 × 10min, chemoluminescence method detection signal.

Factors check in nutrient solution: collection HEK293T/3GF cell and the each 10ml of nutrient solution of the HEK293T control cells of infection, centrifugal removal cell debris ,-80 ° of C lyophilizes, are dissolved in 500 ddH ₂o, respectively gets 20 carry out 20% SDS-PAGE, after the same transferring film, detect factor expression.

Western blot result as shown in Figure 5, target protein EGF (6. 2 kDa), IGF1 (6kDa) and FGF2 (17.2 kDa) all between 6 ~ 18 kDa, detected respectively, shown three kinds of somatomedins of HEK293T/3GF cell successful expression and somatomedin can be secreted in nutrient solution supernatant.

embodiment 4: three kinds of somatomedin Function detection

HEK293T/3GF cell and HEK293T control cells cellar culture are in containing the DMEM in high glucose substratum of 10% foetal calf serum, in 37 oC, 5% CO ₂saturated humidity incubator in cultivate.Cultivate 48h again after cell grows to 80% degree of converging after, collect supernatant, as conditioned medium.Human lung cancer cell A549's cell is with every hole 1.5 × 10 ⁴individual cell is inoculated in 96 orifice plates, and experimental group adds 50 the conditioned medium of HEK293T/3GF cell and 50 the fresh RPMI-1640 containing 10% foetal calf serum, control group adds 50 the conditioned medium of HEK293T cell and 50 the fresh RPMI-1640 containing 10% foetal calf serum.Continue to cultivate after 48h, every hole adds 10 cCK-8 reagent is hatched after 2h and is detected 450nm absorbance by microplate reader in incubator.Adopt SPSS18. 0 software to carry out statistical study, represent with means ± S.E.M., two groups of means relatively adopt t inspection; P<0.05 thinks that difference has statistical significance.

Result shows, compare with HEK293T collating condition nutrient solution, HEK293T/3GF cell conditioned medium can obviously promote the growth of A549 cell really, difference has statistical significance (P<0.05), and the somatomedin that HEK293T/3GF emiocytosis is described is the somatomedin (Fig. 6) that tool is activated, can promote A549 Growth of Cells really.

<110> Zhejiang University

Sequence and the application thereof of three kinds of activated form somatomedins of a <120> coding

<160>?9

<210>?1

<211>?2262

<212>?DNA

<213> artificial sequence

<220>

The sequence of three kinds of activated form somatomedins of <223> coding

<400>?1

actagttagc?caccatggag?acagacacac?tcctgctatg?ggtactgctg?ctctgggttc?60

caggttccac?tggtgacgga?ccggagacgc?tctgcggggc?tgagctggtg?gatgctcttc?120

agttcgtgtg?tggagacagg?ggcttttatt?tcaacaagcc?cacagggtat?ggctccagca?180

gtcggagggc?gcctcagaca?ggcatcgtgg?atgagtgctg?cttccggagc?tgtgatctaa?240

ggaggctgga?gatgtattgc?gcacccctca?agcctgccaa?gtcagcttaa?tctagtgccc?300

ctctccctcc?ccccccccta?acgttactgg?ccgaagccgc?ttggaataag?gccggtgtgc?360

gtttgtctat?atgttatttt?ccaccatatt?gccgtctttt?ggcaatgtga?gggcccggaa?420

acctggccct?gtcttcttga?cgagcattcc?taggggtctt?tcccctctcg?ccaaaggaat?480

gcaaggtctg?ttgaatgtcg?tgaaggaagc?agttcctctg?gaagcttctt?gaagacaaac?540

aacgtctgta?gcgacccttt?gcaggcagcg?gaacccccca?cctggcgaca?ggtgcctctg?600

cggccaaaag?ccacgtgtat?aagatacacc?tgcaaaggcg?gcacaacccc?agtgccacgt?660

tgtgagttgg?atagttgtgg?aaagagtcaa?atggctctcc?tcaagcgtat?tcaacaaggg?720

gctgaaggat?gcccagaagg?taccccattg?tatgggatct?gatctggggc?ctcggtgcac?780

atgctttaca?tgtgtttagt?cgaggttaaa?aaaacgtcta?ggccccccga?accacgggga?840

cgtggttttc?ctttgaaaaa?cacgatgata?atatggccac?atctagttag?ccaccatgga?900

gacagacaca?ctcctgctat?gggtactgct?gctctgggtt?ccaggttcca?ctggtgacaa?960

tagtgactct?gaatgtcccc?tgtcccacga?tgggtactgc?ctccatgatg?gtgtgtgcat?1020

gtatattgaa?gcattggaca?agtatgcatg?caactgtgtt?gttggctaca?tcggggagcg?1080

atgtcagtac?cgagacctga?agtggtggga?actgcgctaa?tctagtgccc?ctctccctcc?1140

ccccccccta?acgttactgg?ccgaagccgc?ttggaataag?gccggtgtgc?gtttgtctat?1200

atgttatttt?ccaccatatt?gccgtctttt?ggcaatgtga?gggcccggaa?acctggccct?1260

gtcttcttga?cgagcattcc?taggggtctt?tcccctctcg?ccaaaggaat?gcaaggtctg?1320

ttgaatgtcg?tgaaggaagc?agttcctctg?gaagcttctt?gaagacaaac?aacgtctgta?1380

gcgacccttt?gcaggcagcg?gaacccccca?cctggcgaca?ggtgcctctg?cggccaaaag?1440

ccacgtgtat?aagatacacc?tgcaaaggcg?gcacaacccc?agtgccacgt?tgtgagttgg?1500

atagttgtgg?aaagagtcaa?atggctctcc?tcaagcgtat?tcaacaaggg?gctgaaggat?1560

gcccagaagg?taccccattg?tatgggatct?gatctggggc?ctcggtgcac?atgctttaca?1620

tgtgtttagt?cgaggttaaa?aaaacgtcta?ggccccccga?accacgggga?cgtggttttc?1680

ctttgaaaaa?cacgatgata?atatggccac?atctagttag?ccaccatgga?gacagacaca?1740

ctcctgctat?gggtactgct?gctctgggtt?ccaggttcca?ctggtgacgc?agccgggagc?1800

atcaccacgc?tgcccgcctt?gcccgaggat?ggcggcagcg?gcgccttccc?gcccggccac?1860

ttcaaggacc?ccaagcggct?gtactgcaaa?aacgggggct?tcttcctgcg?catccacccc?1920

gacggccgag?ttgacggggt?ccgggagaag?agcgaccctc?acatcaagct?acaacttcaa?1980

gcagaagaga?gaggagttgt?gtctatcaaa?ggagtgtgtg?ctaaccgtta?cctggctatg?2040

aaggaagatg?gaagattact?ggcttctaaa?tgtgttacgg?atgagtgttt?cttttttgaa?2100

cgattggaat?ctaataacta?caatacttac?cggtcaagga?aatacaccag?ttggtatgtg?2160

gcactgaaac?gaactgggca?gtataaactt?ggatccaaaa?caggacctgg?gcagaaagct?2220

atactttttc?ttccaatgtc?tgctaagagc?tgataatcta?ga?2262

<210>?2

<211>?24

<212>?DNA

<213> artificial sequence

<220>

<223>IRES is upstream primer I RES-F for amplification

<400>?2

actagtgccc?ctctccctcc?cccc?24

<210>?3

<211>?27

<212>?DNA

<213> artificial sequence

<220>

<223>IRES amplification downstream primer IRES-R

<400>?3

tctagatgtg?gccatattat?catcgtg?27

<210>?4

<211>?26

<212>?DNA

<213> artificial sequence

<220>

<223> immunoglobulin (Ig) kappa chain signal peptide is upstream primer I gk-F for amplification

<400>?4

actagttagc?caccatggag?acagac?26

<210>?5

<211>?20

<212>?DNA

<213> artificial sequence

<220>

<223> immunoglobulin (Ig) kappa chain signal peptide amplification downstream primer Igk-R

<400>?5

gtcaccagtg?gaacctggaa?20

<210>?6

<211>?42

<212>?DNA

<213> artificial sequence

<220>

<223> activated form EGF encoding sequence amplification upstream primer EGF-F

<400>?6

ttccaggttc?cactggtgac?aatagtgact?ctgaatgtcc?cc?42

<210>?7

<211>?29

<212>?DNA

<213> artificial sequence

<220>

<223> activated form EGF encoding sequence amplification downstream primer EGF-R

<400>?7

tctagattag?cgcagttccc?accacttca?29

<210>?8

<211>?296

<212>?DNA

<213> artificial sequence

<220>

<223> is with the activated form IGF1 sequence of Kozak sequence and Igkappa signal coding sequence

<400>?8

actagttagc?caccatggag?acagacacac?tcctgctatg?ggtactgctg?ctctgggttc?60

caggttccac?tggtgacgga?ccggagacgc?tctgcggggc?tgagctggtg?gatgctcttc?120

agttcgtgtg?tggagacagg?ggcttttatt?tcaacaagcc?cacagggtat?ggctccagca?180

gtcggagggc?gcctcagaca?ggcatcgtgg?atgagtgctg?cttccggagc?tgtgatctaa?240

ggaggctgga?gatgtattgc?gcacccctca?agcctgccaa?gtcagcttaa?tctaga?296

<210>?9

<211>?551

<212>?DNA

<213> artificial sequence

<220>

<223> is with the activated form FGF2 sequence of Kozak sequence and Igkappa signal coding sequence

<400>?9

actagttagc?caccatggag?acagacacac?tcctgctatg?ggtactgctg?ctctgggttc?60

caggttccac?tggtgacgca?gccgggagca?tcaccacgct?gcccgccttg?cccgaggatg?120

gcggcagcgg?cgccttcccg?cccggccact?tcaaggaccc?caagcggctg?tactgcaaaa?180

acgggggctt?cttcctgcgc?atccaccccg?acggccgagt?tgacggggtc?cgggagaaga?240

gcgaccctca?catcaagcta?caacttcaag?cagaagagag?aggagttgtg?tctatcaaag?300

gagtgtgtgc?taaccgttac?ctggctatga?aggaagatgg?aagattactg?gcttctaaat?360

gtgttacgga?tgagtgtttc?ttttttgaac?gattggaatc?taataactac?aatacttacc?420

ggtcaaggaa?atacaccagt?tggtatgtgg?cactgaaacg?aactgggcag?tataaacttg?480

gatccaaaac?aggacctggg?cagaaagcta?tactttttct?tccaatgtct?gctaagagct?540

gataatctag?a?551

Claims

1. express an encoding sequence for IGF1, EGF and tri-kinds of somatomedins of FGF2, its nucleotide sequence is as shown in SEQ ID No:1 simultaneously, and wherein the 7th to the 14th, the 888th to the 895th and the 1718th to the 1725th is Kozak sequence; The 15th to the 77th, the 896th to the 958th and the 1726th to the 1788th is Igk signal coding sequence; The 297th to the 881st and the 1127th to 1711 is IRES sequence; The 78th to 290 is activated form IGF1 encoding sequence; The 959th to the 1120th is activated form EGF encoding sequence; The 1789th to 2256 is activated form FGF2 encoding sequence.

2. encoding sequence according to claim 1, in the application building in carrier for expression of eukaryon, is characterized in that, expresses IGF1, EGF and tri-kinds of somatomedins of FGF2, for further research at eukaryotic expression simultaneously.