CN104130984B - Act on the aflatoxin oxidase of versicolorin - Google Patents
Act on the aflatoxin oxidase of versicolorin Download PDFInfo
- Publication number
- CN104130984B CN104130984B CN201410370164.3A CN201410370164A CN104130984B CN 104130984 B CN104130984 B CN 104130984B CN 201410370164 A CN201410370164 A CN 201410370164A CN 104130984 B CN104130984 B CN 104130984B
- Authority
- CN
- China
- Prior art keywords
- versicolorin
- aflatoxin
- oxidase
- afo
- ver
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of aflatoxin oxidase acting on versicolorin.The critical amino acid residues of wild type aflatoxin oxidase (AFO) substrate-binding site is transformed by the present invention by technique for gene engineering, it is provided that a kind of AFO mutant obtaining the selectivity to substrate versicolorin (Ver A) and affinity raising.The mutant aflatoxin oxidase (mAFO acting on versicolorin of the present invention555), the selectivity ratios wild type AFO of substrate Ver A is improved 18 times, the affinity of substrate Ver A is improved 6 times than wild type AFO；Raising 4 times to the specific enzyme activity force rate wild type AFO of Ver A.
Description
Technical field
The present invention relates to aflatoxin oxidase, be related specifically to act on the aflatoxin oxidase of versicolorin.
Background technology
Aflatoxin oxidase (Aflatoxin oxidase, AFO) it is the one endocellular enzyme that derives from Armillariella tabescens (Armillariella tabescens), have the advantages that can directly convert family's aflatoxin in vitro, research shows: it is a redox reaction that AFO converts the process of AFB1 (AFB1), is attended by H2O2Generation, it acts on the toxophore bifuran of AFB1, causes the furan double bond in bifuran to rupture, thus changes into non-toxic products.
Versicolorin (Ver A) is the front extract in AFB1 biosynthetic process, its molecular structure there is also the bifuran identical with AFB1, the enzyme electrode utilizing AFO (wild type) to make carries out the research of electrochemical Characterization and finds that wild-type enzyme electrode has response signal to Ver A Ver A, but sensitivity is low, signal is inconspicuous.This explanation: although wild type aflatoxin oxidase there is also transformation to VerA, but act on insensitive.
Versicolorin (VerA, versicolorin A) i.e. 1,6,8-trihydroxy-2-methylol anthraquinone, it is AFB1 and sterigmatocystin (sterigmytocystin, ST) the important as precursors thing in anabolic process, its structure contains the toxophore bifuran identical with AFB1 and ST.Research shows to be monitored grain VerA in storage, it is possible to not yet detection or the only agricultural product such as low-level the detection grain of aflatoxin, feedstuff are played the forewarning function of pollution.I.e. under original state, the positive detection of the VerA of certain level (even if AFB1 not yet detects or only low-level detection), it is possible to pollution level and the pollution risk of the aflatoxin of these agricultural product after certain time is deposited in prompting under certain condition.The described mutant enzyme of the present invention sensitive can produce oxidation reaction to VerA rapidly, is assembled on electrode, then can obtain the biological sensor electrode sensitive to VerA response.In addition, the eighties in 20th century, the acute toxicity of the preliminary study such as Wong VerA and teratogenesis degeneration, its LD50 (mouse mainline) is 20mg/kg, mutagenesis dosage (Ames test) is 800ng/ ware, thus the toxicity of versicolorin itself can not be ignored.
Before producing AFB1, the cumulative process of a Ver A is there will be owing to producing poison mycete, although wild type AFO has a certain degree of decomposition to Ver A, but the AFO mutant in the present invention is to the effect of VerA is sensitiveer and conversion ratio is higher, can terminate and disturb product poison mycete synthesis AFB1 in theory, thus reach the purpose blocked or retardation AFB1 is formed.
Summary of the invention
The primary and foremost purpose of the present invention is to provide a kind of aflatoxin oxidase acting on versicolorin.
The present invention is that the oxidasic gene of the aflatoxin to Armillariella tabescens (referred to as AFO gene) carries out rite-directed mutagenesis.By the aflatoxin oxidase obtained in Armillariella tabescens (Armillariella tabescens) AS165, it is sequenced (A fungal enzyme with the ability of aflatoxin B1conversion:Purification and ESI-MS/MS identification, Microbiological Research 166 (2011) 475 483), GENBANK accession number is AY941095.The aminoacid sequence of this oxidasic maturation protein is SEQ ID NO.1.
According to a kind of Fixedpoint mutation modified aflatoxin oxidase of the present invention, be by aminoacid sequence be SEQ ID NO.1 the aflatoxin oxidase deriving from Armillariella tabescens (Armillariella tabescens) in manufacture multiple aminoacid replacement and produce, the oxidase higher to versicolorin specificity, described aminoacid replacement is the replacement of the 404th, 410,493,497 and 501.
According to the oxidasic further feature of Fixedpoint mutation modified aflatoxin of the present invention, the described aminoacid replacement at the 404th is to replace valine with lysine；It is to use cysteine substituted lactamine at the aminoacid replacement of 410；It is to replace glutamic acid with tryptophan at the aminoacid replacement of the 493rd；It is to replace glutamic acid with tyrosine at the aminoacid replacement of the 497th；It is to replace glutamic acid with methionine at the aminoacid replacement of the 501st；The described Fixedpoint mutation modified oxidasic aminoacid sequence of aflatoxin is SEQ ID NO.2.
Mutant aflatoxin oxidase (mAFO) acting on versicolorin of the present invention, the selectivity ratios wild type AFO of substrate Ver A is improved 18 times, than wild type AFO, the affinity of substrate Ver A is improved 6 times by it.Raising 4 times to the specific enzyme activity force rate wild type AFO of Ver A.
Further, the invention provides a kind of DNA molecular, it encodes the aflatoxin oxidase acting on versicolorin of the present invention.
Preferably, the nucleotides sequence of DNA molecular of the present invention is classified as SEQ ID NO.3.
It is a further object to provide a kind of carrier, it contains DNA molecular of the present invention.
A further object of the present invention is to provide a kind of host cell, and it contains DNA molecular of the present invention, or containing carrier of the present invention.
Above-mentioned carrier and host cell can be prepared by technological means well known in the art.
Present invention also offers the oxidasic production method of aflatoxin acting on versicolorin of the present invention, including: under conditions of being suitable to aflatoxin Oxidase Expression, cultivate host cell of the present invention, and from culture medium, separate described aflatoxin oxidase.
When DNA molecular of the present invention is inserted into described carrier with suitably orientation and correct reading frame, or proceeding in described host cell, described DNA molecular can be expressed in any eucaryon or prokaryotic expression system.Many host-vector systems may serve to marking protein coded sequence.Host-vector system includes but not limited to: the antibacterial converted with phage, plasmid or cosmid；Containing the microorganism of yeast vector, such as yeast；The mammalian cell system infected by virus；The insect cell system infected by virus；The plant cell system infected with antibacterial.Currently preferred carrier includes viral vector, plasmid, cosmid or oligonucleotide.
Currently preferred host is prokaryotic system such as bacillus subtilis, it is also possible to eukaryotic expression system such as Pichia sp.；Preferred expression is escherichia coli, such as Rosetta (DE3)；Purification tag MBP also can be selected for other purification tag, such as 6 histidine.
Currently preferred protein expression method is lactose-induced expression；The solubility expression of more preferably IPTG induction.
Currently preferred method of purifying protein is can be with conventional protein chromatography technology, and such as ion-exchange chromatography and hydrophobic chromatography are combined；Preferred purification process is affinity chromatograph, such as Amylose affinity chromatograph.
Further, present invention also offers a kind of biosensor, it contains the aflatoxin oxidase acting on versicolorin of the present invention.
Invention further provides the purposes of described biosensor, i.e. for detecting the purposes of the content of the versicolorin in grain, food and raw material thereof, feedstuff.
Accompanying drawing explanation
Fig. 1 shows mAFO555Selectivity (K to Ver AAFB1m/KVerAM value).
Detailed description of the invention
Term employed in Ben Wen, except as otherwise noted, is the implication that those skilled in the art are generally understood that.The definition of some specific teries used in the present invention presented below.
" AFO " represents wild type Aflatoxin-detofizyme ADTZ, and its gene represents with italic AFO.
" mAFO " represents mutant Aflatoxin-detofizyme ADTZ, and its gene represents with mAFO.
“mAFO555" representing No. 555 mutant Aflatoxin-detofizyme ADTZs, its gene is with mAFO555Represent.
Embodiment 1: the PCR amplification of Aflatoxin-detofizyme ADTZ gene and order-checking
1, the present invention using armillariella tabescens originate Aflatoxin-detofizyme ADTZ gene (AY941095.1) sequence as reference, software Primer 5 is used to design and synthesize two oligonucleotide primers, PBA plasmid in alkaline lysis method of extracting DH-5a, by PCR method amplifying target genes AFO.
Article two, PCR primer is as follows:
Forward primer: 5 ' ATGGCCACCACAACTGTCCACCGG 3 '
Reverse primer: 5 ' CGCGGATCCTCACAATCGTCTCTCAATGAAAC 3’
Dashed part is BamH I restriction enzyme site.
PCR reaction system is as follows:
| PBA (template) | 1.6ul |
| Forward primer | 1.2ul |
| Reverse primer | 1.2ul |
| 10xKOD buffer | 4ul |
| KOD-Plus-NEO | 0.8ul |
| DNTP | 4ul |
| ddH2O | 24.8ul |
PCR program setting:
94 DEG C of denaturations 5min；
94 DEG C, 40s；55 DEG C, 40s；68 DEG C, 65S 5 circulation；
94 DEG C, 40s；62 DEG C, 40s；68 DEG C, 65S 25 circulation；
68 DEG C, 5min.
Pcr amplification product, after the agarose gel electrophoresis of 1%, reclaims test kit with DNA and carries out glue recovery, obtain the fragment of about 2.1kb.
Embodiment 2: Aflatoxin-detofizyme ADTZ gene (AFO) and the connection of expression vector pMAL-C2X
1. expression vector pMAL-C2X carries out restricted enzyme BamH I, PdmI double digestion, and mAFO genes of interest carries out restricted enzyme BamH I single endonuclease digestion, and in 37 DEG C of enzyme action 10min, enzyme action condition is as follows:
2. digestion products is separately recovered two purpose fragments after the agarose gel electrophoresis of 1%, connects with T4DNA ligase, and linked system is as follows:
| AFO digestion products | 13ul |
| PMAL-C2X digestion products | 4ul |
| T4DNA enzyme | 0.2ul |
| 10 × buffer | 2ul |
| ddH2O | 0.8ul |
| Total amount | 20ul |
3h is connected with ligase 22 DEG C, connect after product converts the amplification of Rosetta (DE3) competent cell and extract plasmid with plasmid extraction test kit, 6.6kb and 2.1kb two band is shown with running electrophoresis result after SacI/BamHII double digestion, show successful connection, by DNA sequencing, it is defined as Aflatoxin-detofizyme ADTZ gene.
Embodiment 3: rite-directed mutagenesis
1, through utilizing DS3.0 software platform that the simulation three dimensional structure of aflatoxin toxin detoxication enzyme is carried out bioinformatic analysis, we determined that the aminoacid to following site carries out Fixedpoint mutation modified:
(1) for the amino acid mutation of the 404th amino acids, design primer is as follows:
mAFOV404K
Forward mutation primer:
5’ATTTTGGCGGCCAAGAAGCCAAACGAGGAGTTAAC 3’SEQ ID NO.6
Inverse transition primer:
5’GTTAACTCCTCGTTTGGCTTCTTGGCCGCCAAAAT 3’SEQ ID NO.7
(2) for the 410th amino acids sudden change, design primer is as follows:
mAFOV404K/T410C
Forward mutation primer:
5’CAAACGAGGAGTTATGCTTCATCCATCCTGATG 3’SEQ ID NO.8
Inverse transition primer:
5’CATCAGGATGGATGAAGCATAACTCCTCGTTTG 3’SEQ ID NO.9
(3) suddenling change for the 497th and 501 amino acids, design primer is as follows:
mAFOV404K/T410C/E497Y/L501M
Forward mutation primer:
5’GAATGCTGGGCGTACACCGTAGCGATGTACTTGGTTAGC 3’SEQ ID NO.10
Inverse transition primer:
5’GCTAACCAAGTACATCGCTACGGTGTACGCCCAGCATTC 3’SEQ ID NO.11
(4) for 493 amino acids sudden changes, design primer is as follows:
mAFOV404K/T410C/E493W/E497Y/L501M
Forward mutation primer: 5 ' GTCGTCAATGGAATGGTGTCGGGCGTAC 3 ' SEQ ID NO.12
Inverse transition primer: 3 ' GTACGCCCGACACCATTCCATTGACGAC 3 ' SEQ ID NO.13
PCR program setting:
94 DEG C of denaturations 2min；
94 DEG C, 30s；63 DEG C, 30s；68 DEG C, 65S 5 circulation；
94 DEG C, 30s；59 DEG C, 30s；68 DEG C, 65S 25 circulation；
68 DEG C, 5min.
Order-checking is connected after PCR reaction.Site-directed point mutation is the method using Overlap extension PCR, suddenlys change five sites successively, and the DNA sequence finally given can be expressed as the present invention and acts on the aflatoxin oxidase of versicolorin, and this enzyme is referred to as " mAFO555”。
Embodiment 4:Rosetta (DE3)-pMAL-C2X-mAFO555Solubility induction and MBP-mAFO555The expression of fusion protein
By Rosetta (DE3)-pMAL-C2X-mAFO solubility abduction delivering condition is come fusion protein MBP-mAFO555Carry out abduction delivering.Purification tag MBP i.e. maltose-binding protein (Maltose-binding protein).Protein table is carried out as promoter with lac operon, and the most excellent with isopropylthio β-D-galactoside (Isopropylthio-β-D-galactoside, IPTG), and the latter can add and carry out successive induction expression in the medium.
(1) 10 μ LRosetta (DE3)-pMAL-C2X-mAFO are drawn555Glycerol preserve bacterium solution in 990 μ L LB fluid mediums, the most hand mixing, be then diluted to 10 with LB fluid medium4、105、106、107、108Six Concentraton gradient；
(2) 100 μ L/ plates 10 are drawn5、106、107、108The bacterium solution of five concentration is coated in the LB solid medium containing ampicillin (100 μ g/mL), is inverted overnight incubation in 37 DEG C after drying at room temperature；
(3) the preferably single bacterium colony of growing way on toothpick picking flat board, is placed in the LB fluid medium containing ampicillin (100 μ g/mL), and 37 DEG C of 150rpm/min overnight shakings are cultivated；
(4) overnight culture is seeded to containing ampicillin (100 μ g/mL) and the rich medium of glucose (0.2%) by 1:100, and 37 DEG C of 150rpm/min cultivations are 0.4～0.8 to OD600；
(5) add IPTG and carry out abduction delivering 60 hours to final concentration of 0.24mM, 20 DEG C of 150rpm/min.
(6) 2000～1000g, 4 DEG C are centrifuged, and gather in the crops thalline, and freezen protective.
Embodiment 5: fusion protein MBP-mAFO555" isolation and purification
(1) fermentation culture medium thawed at room temperature, adds 25mL Column buffer mixing, and the thalline re-suspension liquid after thawing is taken out 25mL and is placed in ice-water bath；
(2) arranging ultrasonication parameter is: intermittently 10 seconds, ultrasonic 5 seconds, power 800W.Ice-bath ultrasonic is broken until bacteria suspension becomes clear；
At (3) 4 DEG C 9,000g is centrifuged 20 minutes, take supernatant be stored in 4 DEG C standby；
(4) by 15mL Amylose Filled Dielectrics in the pillar that specification is 1.0 × 20cm.Ultra-pure water Peak Flow Rate compression leg 2h.Connect nucleic acid-protein detector, with Column buffer balance pillar to baseline stability.
(5) loading volume: every mL bed volume can be in conjunction with 3mg fused protein.
(6) by breaking cellular wall supernatant peristaltic pump with the flow velocity loading of 0.2mL/min, after end of the sample, use Column Buffer with same uniform flow eluting；
(7) observing the ultraviolet absorption value at nucleic acid-protein detector 280nm when loading starts, collect eluent when absorption value starts to raise, be eluted to during baseline stop receiving, the solution herein collected is the drip washing peak of affinity chromatograph；
(8) with Column Buffer+10mM maltose eluting fused protein.At nucleic acid-protein detector 280nm, absorption value collects eluent when starting to raise, and is eluted to during baseline stop receiving, and the solution herein collected is MBP-mAFO555。
(9) with reference to pMAL system specification (reagent handbook), 4 DEG C, the MBP-mAFO that affinity chromatograph obtains555Fusion protein was with Factor Xa enzyme action 36 hours.
The removal of embodiment 6:MBP label and destination protein mAFO555Acquisition
After protein product is carried out corresponding affinity chromatograph and enzyme action, again carry out affinity chromatograph and be achieved with the destination protein of purification.
(1) by 15mL Amylose Filled Dielectrics in the pillar that specification is 1.0 × 20cm.Ultra-pure water Peak Flow Rate compression leg 2h.Connect nucleic acid-protein detector, with Column buffer balance pillar to baseline stability.
(2) loading volume: every mL bed volume can be in conjunction with 3mg fused protein.
(3) will be containing MBP label and mAFO555Mixed solution and column-loading buffer Column Buffer mix in the ratio of 1:5, with peristaltic pump with the flow velocity loading of 0.2mL/min；
(4) use Column Buffer with same uniform flow eluting after end of the sample, the ultraviolet absorption value at nucleic acid-protein detector 280nm is observed when loading starts, collecting eluent when absorption value starts to raise, be eluted to during baseline stop receiving, the solution herein collected is containing mAFO555Component.
Embodiment 7: purpose mAFO555Character measure
1, the oxidasic property testing of aflatoxin of versicolorin is acted on:
1. mAFO is measured by the Auto-iTC200 micro-calorimeter of type isothermal titration555/ the wtAFO affinity to AFB1/Ver A.Method is as follows:
Use single titration method, using Ver A/AFB1 solution as volumetric solution, mAFO555/ wtAFO solution is as titrate, and single titration volumes is 25uL, and the persistent period is 50s, and interval time is 2000s, and feedback model is High, and temperature is 30 DEG C, and mixing speed is 700r/min.Using the deionized water in reference cell as the thermally equilibrated reference of sample cell.Separately do a blank experiment to eliminate the impact of the heat of dilution between solution simultaneously, i.e. replace sample with buffer, titrate with Ver A/AFB1 solution.During each sample titration, the sample treatment of experimental group is as shown in table 1, only substitutes sample liquid with buffer (pH7.4,20mM Tris-HCl) in matched group.
Table 1: sample treatment, unit (ul)
(m) AFO drawn from measurement result is respectively with Ver A and AFB1As kinetic constant during catalytic substrate, it is shown in Table 2.The affinity of enzyme is represented with 1/Km.
As shown in table 2, compared with wild type AFO, mAFO555The affinity (1/Km) of substrate Ver A is improve 7.53 times, and the affinity of substrate A FB1 is reduced 0.56 times.
Table 2:mAFO555Kinetic constant
MAFO is to Ver A and AFB1Selectivity as shown in Figure 1.By (1/KmVerA)/(1/KmAFB1) (i.e. KmAFB1/KmVerA) mAFO can be evaluated555Selectivity between substrate Ver A and AFB1.This value shows the most greatly mAFO555The highest to the selectivity of Ver A, this value is the least, shows mAFO555To AFB1Selectivity the highest.Result shows: mAFO555It is 19.4 times of wild type AFO to the selectivity of substrate Ver A.
2, enzyme activity determination:
With VerA as substrate, measure the amount (as shown in Equation 1) of the hydrogen peroxide that this substrate of enzyme catalysis produces.HRP in formula: horseradish peroxidase；RBG: negative viride nitens；BG: viride nitens.Under conditions of HRP exists, the hydrogen peroxide (H produced in course of reaction2O2) the most, the amount that RBG changes into BG is the most.Measure at 630nm.
The definition of enzyme activity unit a: unit (U) is defined as at 30 DEG C, under conditions of pH is 5.8, per minute by Ver A convert release 1pmol H2O2 required for enzyme amount.M () AFO enzyme activity is calculated by following formula 2:
In formula 2:
XDThe AFO enzyme activity of sample diluent, unit: U/ml；
The slope of a standard curve；
A0The absorption value of sample blank group；
The absorption value of A specimen reaction group；
The intercept of b standard curve；
2 reaction volumes, unit: ml；
109Conversion factor, 1mmol=109pmol；
1000 conversion factors, 1ml=1000 μ l；
30 response time, for 30min；
It is 100 μ l that 100 sample diluents add volume.
Measurement result is as shown in table 3.
The Rate activity (substrate Ver A) of table 3. enzyme
| Enzyme | Wild type AFO (U/mg) | mAFO555(U/mg) |
| The ratio of enzyme is lived | (2.3±0.3)×103 | (9.5±0.5)×103 |
2. mAFO is measured by the Auto-iTC200 micro-calorimeter of type isothermal titration555/ the wtAFO selectivity to AFB1/Ver A.Method is as follows:
Utilize iTC technical measurement mAFO555Km value in the Ver solution A containing variable concentrations AFB1, titrate mAFO in titration process555Concentration be 10nM, the concentration of volumetric solution Ver A is 10 μMs, and the concentration of AFB1 is respectively 1/2,1/4,1/5,1/6,1/7,1/8,1/10,1/20,1/40,1/50,1/80, the 1/100 of Ver A concentration.In titration experiments, using single titration method, titration volumes is 25uL, and the persistent period is 50s, and interval time is 2000s, and feedback model is " High ", and temperature is 30 DEG C, and mixing speed is 700r/min.Using the deionized water in reference cell as the thermally equilibrated reference of sample cell.
Claims (8)
1. the aflatoxin oxidase acting on versicolorin, it is characterised in that: it is to be SEQ by aminoacid sequence
The aflatoxin oxidase deriving from Armillariella tabescens (Armillariella tabescens) of ID NO.1 manufacture multiple
Aminoacid replacement and produce, the oxidase higher to versicolorin specificity；Produced by act on versicolorin
The oxidasic aminoacid sequence of aflatoxin is SEQ ID NO.2.
2. a DNA molecular, it is characterised in that: the Aspergillus flavus poison acting on versicolorin described in its coding claim 1
Element oxidase.
DNA molecular the most according to claim 2, it is characterised in that: its nucleotides sequence is classified as SEQ ID NO.3.
4. a carrier, it is characterised in that: it contains the DNA molecular described in Claims 2 or 3.
5. a host cell, it is characterised in that: it contains the DNA molecular described in Claims 2 or 3, or wants containing having the right
Seek the carrier described in 4.
6. the oxidasic production method of aflatoxin acting on versicolorin according to claim 1, its
Being characterised by, described method includes: cultivate the place described in claim 5 under conditions of being suitable to aflatoxin Oxidase Expression
Chief cell, and from culture medium, separate described aflatoxin oxidase.
7. a biosensor, it is characterised in that: it contains the Aspergillus flavus acting on versicolorin described in claim 1
Toxin oxidase.
Biosensor the most according to claim 7 is for detecting the variegated aspergillosis in grain, food and raw material thereof, feedstuff
The purposes of the content of element.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410370164.3A CN104130984B (en) | 2014-07-30 | 2014-07-30 | Act on the aflatoxin oxidase of versicolorin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410370164.3A CN104130984B (en) | 2014-07-30 | 2014-07-30 | Act on the aflatoxin oxidase of versicolorin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104130984A CN104130984A (en) | 2014-11-05 |
| CN104130984B true CN104130984B (en) | 2016-09-28 |
Family
ID=51803838
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410370164.3A Active CN104130984B (en) | 2014-07-30 | 2014-07-30 | Act on the aflatoxin oxidase of versicolorin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104130984B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104611305B (en) * | 2014-12-30 | 2017-11-17 | 暨南大学 | The Aflatoxin-detofizyme that trypsin-resistant improves |
| CN112760300B (en) * | 2021-01-29 | 2022-08-30 | 潍坊康地恩生物科技有限公司 | Aflatoxin degrading enzyme mutant and production strain thereof |
| CN117887681B (en) * | 2024-03-13 | 2024-05-24 | 潍坊新希望六和饲料科技有限公司 | Application of horseradish peroxidase in preparation of mildew-removed feed |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1113098C (en) * | 1998-06-30 | 2003-07-02 | 广东药学院 | Process for extracting detoxicating enzyme for aflatoxin B1 |
| CN1294255C (en) * | 2004-08-17 | 2007-01-10 | 广州科仁生物工程有限公司 | Toxicide enzyme with aflatoxin activity conversion and gene for coding the enzyme |
-
2014
- 2014-07-30 CN CN201410370164.3A patent/CN104130984B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104130984A (en) | 2014-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6322279B2 (en) | Novel glucose oxidase mutant | |
| CN101535476A (en) | Modified flavine-adenine-dinucleotide-dependent glucose dehydrogenase | |
| HILL et al. | Purification of Escherichia coli acetohydroxyacid synthase isoenzyme II and reconstitution of active enzyme from its individual pure subunits | |
| JP6526572B2 (en) | Flavin-binding glucose dehydrogenase with improved thermal stability | |
| CN104774813B (en) | A kind of leucine dehydrogenase and its preparation method and application | |
| CN110066777B (en) | Endo-inulase and application thereof in production of fructo-oligosaccharide | |
| CN104130984B (en) | Act on the aflatoxin oxidase of versicolorin | |
| CN108588061B (en) | Low-temperature alkaline pectinase mutant with improved specific enzyme activity and thermal stability | |
| CN101591664A (en) | The gene of a kind of high antimer selective epoxidation thing lytic enzyme and coding thereof | |
| JP7084867B2 (en) | Flavin-bound glucose dehydrogenase variant | |
| CN106282205A (en) | A kind of high than L-GLOD gene multisite mutant alive and its preparation method and application | |
| Linares et al. | Tyramine biosynthesis in Enterococcus durans is transcriptionally regulated by the extracellular pH and tyrosine concentration | |
| CN107446902B (en) | Zearalenone toxin degrading enzyme ZENdease-N2 and encoding gene and application thereof | |
| CN107217046A (en) | A kind of zearalenone toxin degradation enzyme ZENdease N1 and its encoding gene and application | |
| CN107858337A (en) | A kind of heat-resisting mutant lipase and preparation method and application | |
| JP6460513B2 (en) | Protein with flavin adenine dinucleotide-dependent glucose dehydrogenase activity | |
| WO2003091430A1 (en) | GLUCOSE DEHYDROGENASE β-SUBUNIT AND DNA ENCODING THE SAME | |
| CN107502602A (en) | The preparation and its application for the hot rod bacterium xylanase mutant that two heat resistances improve | |
| JP6455430B2 (en) | Xanthine oxidase gene and the amino acid sequence encoding it | |
| CN102864132A (en) | Xylosidase with high heat resistance as well as coding gene and applications of xylosidase | |
| CN105734027B (en) | A kind of xanthine dehydrogenase and its encoding gene and application | |
| US10865405B2 (en) | Maltooligosyl trehalose synthase mutant with improved thermal stability | |
| CN103290039B (en) | Alpha-amylase derived from animal feces metagenome and gene of the alpha-amylase | |
| CN106929491B (en) | (S)-carbonyl reductase heteromer and its application in the more benzene ring compounds of catalysis | |
| CN110438055A (en) | A kind of whole-cell catalyst containing phenylpyruvate decarboxylase mutant and the application in production benzyl carbinol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210813 Address after: 529339 Building 1, No. 5, Huanxin Road, biaohai Industrial Zone, Shatang Town, Kaiping City, Jiangmen City, Guangdong Province Patentee after: Guangdong Fang can animal health care Co.,Ltd. Address before: 510632 No. 601, Whampoa Avenue, Tianhe District, Guangdong, Guangzhou Patentee before: Jinan University |
|
| TR01 | Transfer of patent right |