CN104130984A

CN104130984A - Aflatoxin oxidase acting on versicolorin A

Info

Publication number: CN104130984A
Application number: CN201410370164.3A
Authority: CN
Inventors: 刘大岭; 蒋海兰; 姚冬生; 谢春芳
Original assignee: Jinan University
Current assignee: Guangdong Fang can animal health care Co.,Ltd.
Priority date: 2014-07-30
Filing date: 2014-07-30
Publication date: 2014-11-05
Anticipated expiration: 2034-07-30
Also published as: CN104130984B

Abstract

The invention discloses aflatoxin oxidase acting on versicolorin A. a key amino acid residue at a substrate binding site of wild aflatoxin oxidase (AFO) is modified through a genetic engineering technology, and an AFO mutant with improved selectivity and compatibility on versicolorin A (Ver A). The mutant aflatoxin oxidase (Mafo555) acting on versicolorin A has the substrate Ver A selectivity improved by 18 times than that of wild AFO, has the substrate Ver A compatibility improved by 6 times than that of wild AFO, and has the Ver A specific enzyme activity improved by 4 times than that of wild AFO.

Description

Act on the aflatoxin oxydase of versicolorin

Technical field

The present invention relates to aflatoxin oxydase, specially refer to the aflatoxin oxydase that acts on versicolorin.

Background technology

Aflatoxin oxydase (Aflatoxin oxidase, AFO) be a kind of intracellular enzyme that derives from Armillariella tabescens (Armillariella tabescens), have the advantages that directly to transform in vitro gang's aflatoxin, research shows: the process that AFO transforms aflatoxin B1 (AFB1) is a redox reaction, is attended by H ₂o ₂generation, it acts on toxophore-bifuran of AFB1, causes the two bond ruptures of furans in bifuran, thereby changes into non-toxic products.

Versicolorin (Ver A) is the front extract in AFB1 biosynthetic process, in its molecular structure, also there is the bifuran identical with AFB1, utilize the research that enzyme electrodes that AFO (wild-type) makes carries out electrochemical Characterization to Ver A to find that wild-type enzyme electrode pair Ver A has response signal, but sensitivity is low, signal is not obvious.This explanation: although wild-type aflatoxin oxydase also exists transformation to VerA, act on insensitive.

Versicolorin (VerA, versicolorin A) 1,6,8-trihydroxy--2-methylol anthraquinone, aflatoxin B1 and sterigmatocystin (sterigmytocystin, ST) the important as precursors thing in anabolic process, its structure contains the toxophore-bifuran identical with AFB1 and ST.Research shows that to grain the VerA in storage monitors, can be to the forewarning function not yet detecting or only the agricultural-food such as the low-level grain that detects aflatoxin, feed play pollution.Be under original state, the positive of the VerA of certain level detects (even if AFB1 not yet detects or only low-level detecting), can point out pollution level and the Pollution risk of depositing the aflatoxin of these agricultural-food after certain hour under certain condition.Described mutant enzyme of the present invention can sensitively produce oxidizing reaction to VerA rapidly, is assembled on electrode, can access VerA is responded to sensitive biological sensor electrode.In addition, the eighties in 20th century, the preliminary study such as Wong acute toxicity and the teratogenesis sex change of VerA, its LD50 (mouse mainline) is 20mg/kg, mutagenesis dosage (Ames test) is 800ng/ ware, thereby the toxicity of versicolorin itself can not be ignored.

Owing to producing malicious mould, before producing aflatoxin B1, there will be the cumulative process of a Ver A, although wild-type AFO to Ver A is had to a certain degree Decomposition, but the AFO mutant in the present invention is sensitiveer higher with transformation efficiency to the effect of VerA, can stop and disturb in theory and produce the synthetic aflatoxin B1 of malicious mould, thereby reach the object of blocking-up or the formation of retardation aflatoxin B1.

Summary of the invention

Primary and foremost purpose of the present invention is to provide a kind of aflatoxin oxydase that acts on versicolorin.

The present invention carries out rite-directed mutagenesis to the oxidasic gene of the aflatoxin of Armillariella tabescens (being called AFO gene).The aflatoxin oxydase obtaining in Armillariella tabescens (Armillariella tabescens) AS165, be sequenced (A fungal enzyme with the ability of aflatoxin B1conversion:Purification and ESI-MS/MS identification, Microbiological Research 166 (2011) 475-483), GENBANK accession number is AY941095.The aminoacid sequence of this oxidasic maturation protein is SEQ ID NO.1.

According to a kind of Fixedpoint mutation modified aflatoxin oxydase of the present invention, in the aflatoxin oxydase that derives from Armillariella tabescens (Armillariella tabescens) that is SEQ ID NO.1 by aminoacid sequence, manufacturing a plurality of aminoacid replacement produces, the oxydase stronger to versicolorin specificity, described aminoacid replacement is the replacement of the 404th, 410,493,497 and 501.

According to the oxidasic further feature of Fixedpoint mutation modified aflatoxin of the present invention, the described aminoacid replacement at the 404th is to replace α-amino-isovaleric acid with Methionin; At the aminoacid replacement of 410, be to use halfcystine substituted lactamine; Aminoacid replacement at the 493rd is to replace L-glutamic acid with tryptophane; Aminoacid replacement at the 497th is to replace L-glutamic acid with tyrosine; Aminoacid replacement at the 501st is to replace L-glutamic acid with methionine(Met); The described oxidasic aminoacid sequence of Fixedpoint mutation modified aflatoxin is SEQ ID NO.2.

The mutant aflatoxin oxydase (mAFO) that acts on versicolorin of the present invention, its selectivity ratios wild-type AFO to substrate Ver A improves 18 times, and the affinity of substrate Ver A is improved to 6 times than wild-type AFO.To the ratio enzyme activity of Ver A than 4 times of the raisings of wild-type AFO.

Further, the invention provides a kind of DNA molecular, its aflatoxin oxydase that acts on versicolorin of the present invention of encoding.

Preferably, the nucleotides sequence of DNA molecular of the present invention is classified SEQ ID NO.3 as.

Another object of the present invention is to provide a kind of carrier, and it contains DNA molecular of the present invention.

Another object of the present invention is to provide a kind of host cell, and it contains DNA molecular of the present invention, or contains carrier of the present invention.

Above-mentioned carrier and host cell can be prepared by technique means well known in the art.

The present invention also provides the oxidasic production method of aflatoxin that acts on versicolorin of the present invention, comprise: under the condition that is suitable for aflatoxin Oxidase Expression, cultivate host cell of the present invention, and the aflatoxin oxydase described in separated from substratum.

When DNA molecular of the present invention is inserted into described carrier with suitable orientation and correct reading frame, or proceed in described host cell, described DNA molecular can be expressed in any eucaryon or prokaryotic expression system.Many host-vector systems can be used for marking protein encoding sequence.Host-vector system includes but not limited to: the bacterium transforming with phage, plasmid or clay; The microorganism that contains yeast vector, as yeast; Mammalian cell system with virus infection; Insect cell system with virus infection; The vegetable cell system infecting with bacterium.The preferred carrier of the present invention comprises virus vector, plasmid, clay or oligonucleotide.

The preferred host of the present invention be prokaryotic system as subtilis, also can with eukaryotic expression system as pichia spp; Preferred expression method is intestinal bacteria, for example Rosetta (DE3); Purification tag MBP also can select other purification tag, as 6 Histidines.

The preferred protein expression method of the present invention is lactose-induced expression; The solubility expression that more preferably IPTG induces.

The preferred method of purifying protein of the present invention is can for example, with conventional protein chromatography technology, ion exchange chromatography and hydrophobic chromatography coupling; Preferred purification process is affinity chromatography, for example Amylose affinity chromatography.

Further, the present invention also provides a kind of biosensor, and it contains the aflatoxin oxydase that acts on versicolorin of the present invention.

The present invention further provides the purposes of described biosensor, for detection of the purposes of the content of versicolorin in grain, food and raw material thereof, feed.

Accompanying drawing explanation

Fig. 1 shows mAFO ⁵⁵⁵selectivity (K to Ver A ^aFB1m/K ^verAm value).

Embodiment

The term that adopted herein, except as otherwise noted, is the implication that those skilled in the art understand conventionally.The definition of some specific terms that use in the present invention is below provided.

" AFO " represents wild-type Aflatoxin-detofizyme, and its gene represents with italic AFO.

" mAFO " represents mutant Aflatoxin-detofizyme, and its gene represents with mAFO.

" mAFO ⁵⁵⁵" representing No. 555 mutant Aflatoxin-detofizymes, its gene is with mAFO ⁵⁵⁵represent.

Embodiment 1: the pcr amplification of Aflatoxin-detofizyme gene and order-checking

1, the present invention with armillariella tabescens source Aflatoxin-detofizyme gene (AY941095.1) sequence as a reference, adopt software Primer 5 to design and synthesize two Oligonucleolide primers, PBA plasmid in alkaline lysis method of extracting DH-5a, by PCR method amplifying target genes AFO.

Article two, PCR primer is as follows:

Forward primer: 5 ' ATGGCCACCACAACTGTCCACCGG 3 '

Reverse primer: 5 ' CGC gGATCCtCACAATCGTCTCTCAATGAAAC 3 '

Line part is BamH I restriction enzyme site.

PCR reaction system is as follows:

PBA (template)	1.6ul
		Forward primer	1.2ul
Reverse primer	1.2ul
		10xKOD damping fluid	4ul
KOD-Plus-NEO	0.8ul
		DNTP	4ul
ddH ₂O	24.8ul

PCR program setting:

94 ℃ of denaturation 5min;

94 ℃, 40s; 55 ℃, 40s; 68 ℃, 5 circulations of 65S;

94 ℃, 40s; 62 ℃, 40s; 68 ℃, 25 circulations of 65S;

68℃，5min。

Pcr amplification product, after 1% agarose gel electrophoresis, reclaims test kit with DNA and carries out glue recovery, obtains the fragment of about 2.1kb.

Embodiment 2: Aflatoxin-detofizyme gene (AFO) is connected with expression vector pMAL-C2X's

1. expression vector pMAL-C2X is carried out to restriction enzyme BamH I, PdmI double digestion, mAFO goal gene carries out restriction enzyme BamH I single endonuclease digestion, in 37 ℃ of enzymes, cuts 10min, and enzyme tangent condition is as follows:

2. enzyme is cut product and after 1% agarose gel electrophoresis, is reclaimed respectively two object fragments, with T4DNA ligase enzyme, connects, and linked system is as follows:

AFO enzyme is cut product	13ul
		PMAL-C2X enzyme is cut product	4ul
T4DNA enzyme	0.2ul
		10 * damping fluid	2ul
ddH ₂O	0.8ul
		Total amount	20ul

With 22 ℃ of ligase enzymes, connect 3h, connect after product transforms the amplification of Rosetta (DE3) competent cell and use plasmid extraction test kit extracting plasmid, with running electrophoresis result after SacI/BamHII double digestion, show 6.6kb and 2.1kb two bands, show successful connection, by DNA sequencing, be defined as Aflatoxin-detofizyme gene.

Embodiment 3: rite-directed mutagenesis

1,, through utilizing DS3.0 software platform to carry out bioinformatic analysis to the simulation three-dimensional structure of aflatoxin toxin detoxication enzyme, we are definite carries out Fixedpoint mutation modified to the amino acid in following site:

(1) for the amino acid mutation of the 404th amino acids, design primer is as follows:

mAFO ^V404K

Forward mutation primer:

5’ATTTTGGCGGCCAAGAAGCCAAACGAGGAGTTAAC?3’SEQ?ID?NO.6

Inverse transition primer:

5’GTTAACTCCTCGTTTGGCTTCTTGGCCGCCAAAAT?3’SEQ?ID?NO.7

(2) for the 410th amino acids sudden change, design primer is as follows:

mAFO ^V404K/T410C

Forward mutation primer:

5’CAAACGAGGAGTTATGCTTCATCCATCCTGATG?3’SEQ?ID?NO.8

Inverse transition primer:

5’CATCAGGATGGATGAAGCATAACTCCTCGTTTG?3’SEQ?ID?NO.9

(3) for the 497th and the sudden change of 501 amino acids, design primer is as follows:

mAFO ^{V404K/T410C/E497Y/L501M}

Forward mutation primer:

5’GAATGCTGGGCGTACACCGTAGCGATGTACTTGGTTAGC?3’SEQ?ID?NO.10

Inverse transition primer:

5’GCTAACCAAGTACATCGCTACGGTGTACGCCCAGCATTC?3’SEQ?ID?NO.11

(4) for 493 amino acids sudden changes, design primer is as follows:

mAFO ^{V404K/T410C/E493W/E497Y/L501M}

Forward mutation primer: 5 ' GTCGTCAATGGAATGGTGTCGGGCGTAC 3 ' SEQ ID NO.12

Inverse transition primer: 3 ' GTACGCCCGACACCATTCCATTGACGAC 3 ' SEQ ID NO.13

PCR program setting:

94 ℃ of denaturation 2min;

94 ℃, 30s; 63 ℃, 30s; 68 ℃, 5 circulations of 65S;

94 ℃, 30s; 59 ℃, 30s; 68 ℃, 25 circulations of 65S;

68℃，5min。

After PCR reaction, connect order-checking.Site-directed point mutation is the method that adopts overlapping extension PCR, successively five sites is suddenlyd change, and the DNA sequence dna finally obtaining can be expressed as the aflatoxin oxydase that the present invention acts on versicolorin, and this enzyme is called " mAFO ⁵⁵⁵".

Embodiment 4:Rosetta (DE3)-pMAL-C2X-mAFO ⁵⁵⁵solubility induction and MBP-mAFO ⁵⁵⁵the expression of fusion rotein

By Rosetta (DE3)-pMAL-C2X-mAFO solubility abduction delivering condition is come fusion rotein MBP-mAFO ⁵⁵⁵carry out abduction delivering.Purification tag MBP is maltose binding protein (Maltose-binding protein).With lactose operon, as promotor, carry out protein table, and more excellent with isopropylthio β-D-galactoside (Isopropylthio-β-D-galactoside, IPTG), the latter can be added on and in substratum, carry out successive induction expression.

(1) draw 10 μ LRosetta (DE3)-pMAL-C2X-mAFO ⁵⁵⁵glycerine is preserved bacterium liquid in 990 μ L LB liquid nutrient mediums, and hand mixing, is then diluted to 10 with LB liquid nutrient medium gently ⁴, 10 ⁵, 10 ⁶, 10 ⁷, 10 ⁸six concentration gradients;

(2) draw 100 μ L/ plates 10 ⁵, 10 ⁶, 10 ⁷, 10 ⁸the bacterium liquid of five concentration is coated in the LB solid medium that contains penbritin (100 μ g/mL), after drying at room temperature, in 37 ℃, is inverted overnight incubation;

(3) the good single bacterium colony of growing way on toothpick picking flat board, is placed in the LB liquid nutrient medium that contains penbritin (100 μ g/mL), and 37 ℃ of 150rpm/min overnight shakings are cultivated;

(4) overnight culture is seeded to the rich medium that contains penbritin (100 μ g/mL) and glucose (0.2%) by 1:100, and it is 0.4～0.8 that 37 ℃ of 150rpm/min are cultured to OD600;

(5) adding IPTG is 0.24mM to final concentration, and 20 ℃ of 150rpm/min carry out abduction delivering 60 hours.

(6) 2000～1000g, 4 ℃ centrifugal, results thalline, and freezing preservation.

Embodiment 5: fusion rotein MBP-mAFO ⁵⁵⁵" isolation and purification

(1) under fermenting culture room temperature, thaw, add 25mL Column buffer to mix, the resuspended liquid of the thalline after thawing is taken out to 25mL and be placed in ice-water bath;

(2) ultrasonication parameter being set is: intermittently 10 seconds, and ultrasonic 5 seconds, power 800W.Ice-bath ultrasonic fragmentation is until bacteria suspension becomes clear;

At (3) 4 ℃ 9, centrifugal 20 minutes of 000g, get supernatant be stored in 4 ℃ standby;

(4) in the pillar that is 1.0 * 20cm by 15mL Amylose Filled Dielectrics in specification.Ultrapure water Peak Flow Rate compression leg 2h.Connect nucleic acid-protein detector, use Column buffer balance pillar to baseline stability.

(5) loading volume: every mL column volume can be in conjunction with 3mg fused protein.

(6) use peristaltic pump with the flow velocity loading of 0.2mL/min broken wall supernatant, after end of the sample, use Column Buffer with same uniform flow wash-out;

(7) when loading starts, observe the ultraviolet absorption value of nucleic acid-protein detector 280nm, collect elutriant when absorption value starts to raise, stop receiving while being eluted to baseline, the solution of herein collecting is the drip washing peak of affinity chromatography;

(8) with Column Buffer+10mM maltose wash-out fused protein.When nucleic acid-protein detector 280nm place absorption value starts to raise, collect elutriant, stop receiving while being eluted to baseline, the solution of herein collecting is MBP-mAFO ⁵⁵⁵.

(9) with reference to pMAL system specification (reagent handbook), 4 ℃, the MBP-mAFO that affinity chromatography obtains ⁵⁵⁵fusion rotein is cut 36 hours with Factor Xa enzyme.

The removal of embodiment 6:MBP label and target protein mAFO ⁵⁵⁵acquisition

Protein product is carried out after corresponding affinity chromatography and enzyme cut, again carrying out affinity chromatography and just can obtaining the target protein of purifying.

(1) in the pillar that is 1.0 * 20cm by 15mL Amylose Filled Dielectrics in specification.Ultrapure water Peak Flow Rate compression leg 2h.Connect nucleic acid-protein detector, use Column buffer balance pillar to baseline stability.

(2) loading volume: every mL column volume can be in conjunction with 3mg fused protein.

(3) will contain MBP label and mAFO ⁵⁵⁵mixing solutions and column-loading buffer Column Buffer in the ratio of 1:5, mix, with peristaltic pump with the flow velocity loading of 0.2mL/min;

(4) after end of the sample, use Column Buffer with same uniform flow wash-out, when starting, loading observes the ultraviolet absorption value of nucleic acid-protein detector 280nm, when absorption value starts to raise, collect elutriant, stop receiving while being eluted to baseline, the solution of herein collecting is and contains mAFO ⁵⁵⁵component.

Embodiment 7: object mAFO ⁵⁵⁵character measure

1, act on the oxidasic property testing of aflatoxin of versicolorin:

1. by the micro-calorimeter of Auto-iTC200 type isothermal titration, measure mAFO ⁵⁵⁵the affinity of/wtAFO to AFB1/Ver A.Method is as follows:

Adopt single titration method, using Ver A/AFB1 solution as titrating solution, mAFO ⁵⁵⁵/ wtAFO solution is as titrate, and single titration volume is 25uL, and the time length is 50s, and be 2000s interval time, and feedback model is High, and temperature is 30 ℃, and stirring velocity is 700r/min.The deionized water of usining in reference cell is as the thermally equilibrated reference of sample pool.Separately do a blank assay to eliminate the impact of the heat of dilution between solution, with damping fluid, replace sample, with the titration of Ver A/AFB1 solution simultaneously.During each sample titration, the sample preparation of experimental group is as shown in table 1, only uses damping fluid (pH7.4,20mM Tris-HCl) to substitute sample liquid in control group.

Table 1: sample treatment, unit (ul)

(m) AFO drawing from measuring result is respectively with Ver A and AFB ₁kinetic constant during as catalytic substrate, in Table 2.The affinity that represents enzyme with 1/Km.

As shown in table 2, AFO compares with wild-type, mAFO ⁵⁵⁵the affinity of substrate Ver A (1/Km) has been improved to 7.53 times, and the affinity of substrate A FB1 has been reduced to 0.56 times.

Table 2:mAFO ⁵⁵⁵kinetic constant

MAFO is to Ver A and AFB ₁selectivity as shown in Figure 1.By (1/Km ^verA)/(1/Km ^aFB1) (be Km ^aFB1/ Km ^verA) can evaluate mAFO ⁵⁵⁵selectivity between substrate Ver A and AFB1.This value shows more greatly mAFO ⁵⁵⁵selectivity to Ver A is higher, the less mAFO that shows of this value ⁵⁵⁵to AFB ₁selectivity higher.Result shows: mAFO ⁵⁵⁵to the selectivity of substrate Ver A, be 19.4 times of wild-type AFO.

2, enzyme activity determination:

Take VerA as substrate, measure the amount (as shown in Equation 1) of the hydrogen peroxide of this substrate generation of enzyme catalysis.HRP in formula: horseradish peroxidase; RBG: negative BG; BG: BG.Under the condition existing at HRP, the hydrogen peroxide (H producing in reaction process ₂o ₂) more, the amount that RBG changes into BG is more.In 630nm place, measure.

The definition of enzyme activity unit: Yi Ge unit (U) is defined as at 30 ℃, under the condition that pH is 5.8, per minute transforms by Ver A the needed enzyme amount of 1pmol H2O2 that discharges.(m) AFO enzyme activity calculates by following formula 2:

In formula 2:

X _d---the AFO enzyme activity of sample diluent, unit: U/ml;

The slope of a---typical curve;

A ₀---the absorption value of sample blank group;

A---the absorption value of specimen reaction group;

The intercept of b---typical curve;

2---reaction volume, unit: ml;

10 ⁹---conversion factor, 1mmol=10 ⁹pmol;

1000---conversion factor, 1ml=1000 μ l;

30---the reaction times is 30min;

100---it is 100 μ l that sample diluent adds volume.

Measuring result is as shown in table 3.

The ratio vigor of table 3. enzyme (substrate Ver A)

Enzyme	Wild-type AFO (U/mg)	mAFO ⁵⁵⁵(U/mg)
			The specific activity of enzyme	(2.3±0.3)×10 ³	(9.5±0.5)×10 ³

2. by the micro-calorimeter of Auto-iTC200 type isothermal titration, measure mAFO ⁵⁵⁵the selectivity of/wtAFO to AFB1/Ver A.Method is as follows:

Utilize iTC technical measurement mAFO ⁵⁵⁵km value in the Ver A solution that contains different concns AFB1, titrate mAFO in titration process ⁵⁵⁵concentration be 10nM, the concentration of titrating solution Ver A is 10 μ M, the concentration of AFB1 is respectively 1/2,1/4,1/5,1/6,1/7,1/8,1/10,1/20,1/40,1/50,1/80,1/100 of Ver A concentration.In titration experiments, adopt single titration method, titration volume is 25uL, and the time length is 50s, and be 2000s interval time, and feedback model is " High ", and temperature is 30 ℃, and stirring velocity is 700r/min.The deionized water of usining in reference cell is as the thermally equilibrated reference of sample pool.

Claims

1. an aflatoxin oxydase that acts on versicolorin, it is characterized in that: in the aflatoxin oxydase that derives from Armillariella tabescens (Armillariella tabescens) that it is SEQ ID NO.1 by aminoacid sequence, manufacture a plurality of aminoacid replacement and produce, the oxydase stronger to versicolorin specificity, described aminoacid replacement is the replacement of the 404th, 410,493,497 and 501.

2. the aflatoxin oxydase that acts on versicolorin according to claim 1, is characterized in that: the described aminoacid replacement at the 404th is to replace α-amino-isovaleric acid with Methionin; At the aminoacid replacement of 410, be to use halfcystine substituted lactamine; Aminoacid replacement at the 493rd is to replace L-glutamic acid with tryptophane; Aminoacid replacement at the 497th is to replace L-glutamic acid with tyrosine; Aminoacid replacement at the 501st is to replace L-glutamic acid with methionine(Met); The described oxidasic aminoacid sequence of Fixedpoint mutation modified aflatoxin is SEQ ID NO.2.

3. a DNA molecular, is characterized in that: its aflatoxin oxydase that acts on versicolorin claimed in claim 2 of encoding.

4. DNA molecular according to claim 3, is characterized in that: its nucleotides sequence is classified SEQ ID NO.3 as.

5. a carrier, is characterized in that: it contains the DNA molecular described in claim 3 or 4.

6. a host cell, is characterized in that: it contains the DNA molecular described in claim 3 or 4, or contains carrier claimed in claim 5.

7. the oxidasic production method of aflatoxin that acts on versicolorin according to claim 1, it is characterized in that, described method comprises: under the condition that is suitable for aflatoxin Oxidase Expression, cultivate host cell claimed in claim 6, and the aflatoxin oxydase described in separated from substratum.

8. a biosensor, is characterized in that: it contains the aflatoxin oxydase that acts on versicolorin claimed in claim 1.

9. biosensor according to claim 8 is for detection of the purposes of the content of the versicolorin in grain, food and raw material thereof, feed.