CN104109658B - A kind of creatine hydrolytic enzyme and encoding gene thereof and application - Google Patents
A kind of creatine hydrolytic enzyme and encoding gene thereof and application Download PDFInfo
- Publication number
- CN104109658B CN104109658B CN201410359141.2A CN201410359141A CN104109658B CN 104109658 B CN104109658 B CN 104109658B CN 201410359141 A CN201410359141 A CN 201410359141A CN 104109658 B CN104109658 B CN 104109658B
- Authority
- CN
- China
- Prior art keywords
- creatine
- hydrolytic enzyme
- enzyme
- cre
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/03—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amidines (3.5.3)
- C12Y305/03003—Creatinase (3.5.3.3), i.e. creatine amidinohydrolase
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of creatine hydrolytic enzyme and encoding gene thereof and application, belong to biomedical diagnostics technical field.Creatine hydrolase gene nucleotide sequence provided by the invention is such as shown in SEQ ID NO.1, aminoacid sequence is such as shown in SEQ ID NO.2, by construction recombination plasmid pET20b-cre, this genetic engineering bacterium for entering E. coli BL21 by recombinant plasmid transformed, obtain the genetic engineering bacterium of high efficient expression creatine hydrolytic enzyme, apply this strain and can realize the efficient production of creatine hydrolytic enzyme.In the present invention success of engineering bacteria be configured to reduce creatine hydrolytic enzyme production cost and expand range of application lay the foundation.
Description
Technical field
The present invention relates to a kind of creatine hydrolytic enzyme and encoding gene thereof and the method that this encoding gene recombination bacillus coli prepares creatine hydrolytic enzyme.The invention belongs to technical field of bioengineering, the present invention recombinate preparation creatine hydrolytic enzyme product belong to medical diagnosis compound, it is possible to be used for detecting human kidney function.
Background technology
The muscle of the mankind and the energy of brain consumption mostly come from the hydrolysis of phosphagen.Phosphagen and ADP can form ATP under the effect of enzyme, are simultaneously generated creatine, and the creatine formed is converted to creatinine in vivo the most at last.Additionally, phosphagen also can directly slough phosphoric acid in vivo generates creatinine, creatinine is excreted by blood entrance urine through the filtration of kidney.This function of healthy kidney can ensure constantly to be excreted by the creatinine formed in metabolic process and make the creatinine in blood remain at a relatively low level.If kidney generation pathological changes, it is impossible to effectively remove the creatinine formed and cause creatinine to accumulate in blood.Therefore the creatinine content of blood and urine can reflect the excretory function of kidney.Creatinine assay mainly has chemical method and enzyme process.Chemical method has multiple, but all originates from greatly the Jeffe alkaline picrate method set up in one's early years, and its advantage is that cost is low, simple to operate.Although this method is economical, but the interference of the non-specific material (false creatinine) being subject in sample, and sensitivity is poor.
Enzymatic method is that sample passes through creatininase (creatinineamidohydrolase, E.C.3.5.2.10), creatine hydrolytic enzyme (E.C.3.5.3.3), sarcosine oxidase (sareosineoxidase, E.C.1.5.3.1) continuous conversion, creatinine is degraded completely, and the method has the features such as the specificity of enzymatic reaction is strong, highly sensitive, easy, quick.
Creatine hydrolytic enzyme is requisite a kind of enzyme in enzymatic detection method, is mainly derived from microorganism.Nineteen thirty-seven finds that creatinine can be degraded by microorganisms first.The bacterial strain being subsequently found some genus can pass through induce generation creatine hydrolytic enzyme and accumulate in cell.These antibacterials have Rhodopseudomonas (Pseudomonas), clostridium (Clostridium), Flavobacterium (Flavobacterium), bacillus (Bacillus), Alcaligenes (Alcaligenes), paracoccus (Paracoccus) etc..The external research for kreatinase is mainly in the following aspects: (1) original bacteria produces the condition of enzyme production of kreatinase；(2) expression of the kreatinase gene of several separate sources；(3) kreatinase purification and zymologic property research.Abroad having produced creatinine detection reagent box at present, and China starts late in the research of creatine hydrolytic enzyme, application clinically still relies primarily on import.
Summary of the invention
The invention provides a kind of creatine hydrolytic enzyme and efficiently produce the method with purification.In the present invention, it is provided that with technique for gene engineering, clone obtains described creatine hydrolase gene, engineering bacteria and the production method thereof of Recombinant protein expression creatine hydrolytic enzyme are built.
The present invention relates to clone and obtain the full-length gene order of creatine hydrolytic enzyme, relate to building the method that described creatine hydrolase gene engineering height efficient expression prepares creatine hydrolytic enzyme, also relate to creatine hydrolytic enzyme of the present invention as hydrolytic enzyme application in medical treatment as herein described.
The invention provides a kind of creatine hydrolytic enzyme deriving from arthrobacterium, its aminoacid sequence is such as shown in SEQIDNO.1.
Present invention also offers the gene encoding described creatine hydrolytic enzyme, its nucleotide sequence is such as shown in SEQIDNO.2.
The scope of protection of present invention is fallen within containing the plasmid of creatine hydrolase gene described in claim 2.
Genetic engineering bacterium or transgenic cell line containing above-mentioned recombiant plasmid or the gene of creatine hydrolytic enzyme belong to the scope of protection of present invention.
The gene clone of heretofore described creatine hydrolytic enzyme (CRE) obtains and recombination and preparation is as follows:
The clone of creatine hydrolytic enzyme CRE full-length gene described in 1 obtains.
The structure of creatine hydrolytic enzyme CRE gene recombined escherichia coli expression vector described in 2.Utilize primer CREF, CRER to expand the creatine hydrolytic enzyme CRE gene in described preparation method 1, adopt digestion with restriction enzyme, be connected to colibacillus expression plasmid pET20b (+), build recombinant expression plasmid pET20b-cre.
Recombinant expression pET20b-cre described in preparation method 2 is proceeded in E.coliBL21 competence by 3 through chemical transformation.The LB flat board being added with ampicillin (0.1 μ g/mL) screens positive recombinant, and with specific primer CREF, CRER, positive coliform is dropped into performing PCR checking creatine hydrolytic enzyme CRE gene recombinaton E.coliBL21 (pET20b-cre) success.
The method that present invention also offers a kind of fermenting and producing restructuring creatine hydrolytic enzyme: by the inoculum concentration of 0.4%, described engineering bacteria being accessed 20mL/250mL triangular flask, Clothoid type shaking speed 200rpm from glycerol pipe, cultivation temperature is 37 DEG C, cultivates 12h.Fermentation culture: being seeded in 50mL/500mL triangular flask by the inoculum concentration of 1% (v/v) by cultured seed culture fluid and cultivate, cultivation temperature is 37 DEG C, shaking speed 200rpm；Treat OD600=0.6, add the IPTG abduction delivering of final concentration of 0.6mmol/L, cultivate 10h.
By restructuring creatine hydrolytic enzyme prepared by said method, E.coliBL21 (pET20-cre) fermentation liquid carries out creatine hydrolytic enzyme activities detection, adopts colorimetry to detect.
The present invention is by molecular biological means, it is provided that a kind of new creatine hydrolase gene.In addition, construct a plant height and produce the Recombinant organism of creatine hydrolytic enzyme, apply this strain and produce creatine hydrolytic enzyme, there is the plurality of advantages such as production technology is simple, product yield is high, maximum output can reach 32U/mL, it is contemplated that can solve application escherichia coli and produce the commercial Application problem of creatine hydrolytic enzyme.The present invention is the research of creatine hydrolytic enzyme, exploitation, production work is laid a good foundation, and is also that the application in fields such as medical diagnosiss of the creatine hydrolytic enzyme provides conveniently.
Accompanying drawing explanation
Fig. 1 show recombination bacillus coli and compares with the crude enzyme liquid enzyme work of original bacteria shake flask fermentation product creatine hydrolytic enzyme.
Fig. 2 show protein purification SDS-PAGE electrophoresis result (M, the protein standard marker of restructuring creatine hydrolytic enzyme；1, E.coliBL21/pET20b comparison breaking cellular wall supernatant；2, recombinant bacterium breaking cellular wall supernatant；3,60-80% ammonium sulfate saturation albumen；4, the restructuring creatine hydrolase protein of purification).
Detailed description of the invention
Materials and methods
Creatine hydrolysis activity unit definition: the reaction when 37 DEG C and pH7.0, the enzyme amount needed for 1 μm of ol weld of generation per minute is a unit (U).
Colorimetric method for determining creatine hydrolytic enzyme enzyme is lived: creatine is decomposed into sarcosine and carbamide under the effect of creatine hydrolytic enzyme, and carbamide and paradime thylaminobenzaldehyde produce weld in acid condition, and the growing amount of weld is directly proportional to the vigor of kreatinase.
Implement example 1: creatine hydrolytic enzyme
In the present invention, the aminoacid sequence of creatine hydrolytic enzyme is such as shown in SEQIDNO.1, and the mode that nucleotide obtains is:
By the comparison of the creatine hydrolase gene sequence to separate sources, design primer (CREF:GAAAGAACATATGACTACCGCCAACATCGCCACCA；CRER:TTCTCTCGAGTTACGCGTCGATGATGTTGTTCTCC), with nicotianae (Arthrobacternicotianae23710) genome for template, being successfully obtained the fragment of about 1200bp, check order, nucleotide sequence is such as shown in SEQIDNO.2.
Creatine hydrolytic enzyme of the present invention, the information of its aminoacid sequence SEQIDNO.1 is as follows:
Creatine hydrolytic enzyme of the present invention, the information of its nucleotide sequence SEQIDNO.2 is as follows:
atgactaccgccaacatcgccaccaatgtttccgaactggcccgactgaagaccctgcacaacggcgccaaggagcagctgaccttctcggatgccgagttcgagcgccgcctggccggcctgcgccagatcatggccgcgaagtcgctggacgcggtcatcctgaccagctaccacggcatcaagtactactcggacttcctgtacaccaccttcggccgcaactacgcgctggtggtcaccgccagcaactccaccaccgtcaccgcgaacatcgatgccggcatgccatggcgcaccagctacggcgacaacatcgtgtacaccgactggaagcgcgacaacttcttctacggcctgcaggaagcacttaagcgcgacggcgtgaaggcaacccggatcggcgtggaagacgacttcctgccgggccgcacccgccagcagatcgccgacaccttcgacggcgcaaccctggtggatgtctcgcaggacgccatgcgccagcgcatgatcaagtccgccgaggaaatcgaggtcatcaagcacggtgcacgcatcggcgacctgggcggcgaagccatcaaggcagcgatccgcgaaggcatcagcgaatacgaggtcgcactgatcggcaccgaggccatggtgcacgagatcgccaagaccttcccacaccgcgaagtgcgcgacacctgggtctggttccagtccggcatcaacaccgacggcgcccacaactgggccaccacccgcaagcttcagcgcggcgacatcctgtcgctgaactgcttccccatgacttccggctactacaccgcactggagcgcaccctgttcctgggcgagccggatgcccgcagcctggaactgtggaacatcaacgtcgaggtgcacaagcgcggcctggagctgatcaagcccggtgctgtctgcaaggacatcgccgccgagctgaacgagatctacatcgcccacggcctgctgccgaaccgcaccttcggctacggccactccttcggcgtgctctcgcactactacggacgtgaagccggtctggagctgcgcgaggacattgagactgtcctggagccaggcatggtcgtctcgatggaaccgatgatcaccgtcatggacggcgagccaggtgccggcggctaccgcgagcacgacatcctggtcatcggcgaggataacaccgttgagaacatcaccaagttcggtttcggtccggagaacaacatcatcgacgcgtaa
Implement example 2: containing the structure of the expression system of creatine hydrolase gene
Heretofore described expression vector be pET20b (+), choosing upstream restriction enzyme site according to carrier is NdeI, and downstream restriction enzyme site is XhoI.By obtain containing creatine hydrolase gene (cre) cloning vehicle pMD19-T and expression vector pET20b (+) carry out double digestion respectively, after 37 DEG C of enzyme action 40min, gel electrophoresis is verified and reclaims digestion products.The expression vector and the genes of interest that obtain recovery are attached, and connect liquid and are transformed into expressive host E.coliBL21, and recombinant clone is correct through PCR checking.
Implement example 3: recombination bacillus coli heterogenous expression creatine hydrolytic enzyme
Glycerol pipe: glycerol concentration is 20%；Seed culture medium consists of (g/L): peptone 10, yeast extract 5, NaCl10, pH7.0,100 μ g/mL ammonia benzyl mycins；Fermentation medium consists of (g/L): peptone 12, yeast extract 24, glycerol 4, KH2PO42.31, K2HPO416.43,100 μ g/mL ammonia benzyl mycins.Seed culture: accessing 20mL/250mL triangular flask, Clothoid type shaking speed 200rpm by the inoculum concentration of 0.4% from glycerol pipe, cultivation temperature is 37 DEG C, cultivates 12h.Fermentation culture: being seeded in 50mL/500mL triangular flask by the inoculum concentration of 1% (v/v) by cultured seed culture fluid and cultivate, cultivation temperature is 37 DEG C, shaking speed 200rpm.Treat OD600=0.6, add the IPTG abduction delivering of final concentration of 0.6mmol/L, cultivate 10h, creatine hydrolytic enzyme yield is up to 32U/mL.
Implement example 4: the enzyme activity determination of recombinant production creatine hydrolytic enzyme
Creatine is hydrolyzed generation sarcosine and carbamide under the catalysis of creatine hydrolytic enzyme, and carbamide and p-dimethylaminobenzaldehyde act on generation weld in acid condition, and the growing amount of weld is proportional with kreatinase activity.Measure the absorbance of weld at 435nm place, the growing amount of weld can be calculated according to mM specific absorbance of this weld.Unit definition: under these conditions, 1 μm of ol weld of generation per minute is 1 unit (U).Reaction system is the 900 μ L creatine solution with the 0.1mol/L of the phosphate buffered saline of pH7.0,50mM, adds the enzyme liquid of 100 μ L in system, reacts 10min at 37 DEG C.Add 2mL p-dimethylaminobenzaldehyde solution (the p-dimethylaminobenzaldehyde of molten 2g, in 100mL dimethyl sulfoxide, then adds concentrated hydrochloric acid 15mL) and terminate reaction.Matched group is initially charged p-dimethylaminobenzaldehyde solution, rear addition enzyme liquid.Measure light absorption value at 435nm place, return to zero with water, calculate and obtain enzyme value alive.
Implement example 5: the purification of restructuring kreatinase
Carry out ammonium sulfate precipitation after broken recombination bacillus coli, select the precipitation of 60-80% ammonium sulfate saturation.Precipitating with a small amount of phosphate buffer (pH7.0) soluble protein, dialyzed overnight is to remove the ammonium sulfate in enzyme liquid.Isoelectric point, IP character according to creatine hydrolytic enzyme, selects QFF post to carry out ion-exchange purification.QFF post balances 30min with phosphate buffer, is injected by crude enzyme liquid in purification column, with the phosphate buffer eluting destination protein containing 0.1MNaCl.
Claims (7)
1. the creatine hydrolytic enzyme deriving from arthrobacterium, it is characterised in that its aminoacid sequence is such as shown in SEQIDNO.1.
2. the gene of creatine hydrolytic enzyme described in coding claim 1, it is characterised in that nucleotide sequence is such as shown in SEQIDNO.2.
3. a recombiant plasmid, it is characterised in that it contains the creatine hydrolase gene described in claim 2.
4. the restructuring creatine hydrolytic enzyme engineering bacteria containing the recombiant plasmid described in claim 3.
5. the restructuring creatine hydrolytic enzyme cell line containing the recombiant plasmid described in claim 3.
6. build the method for engineering bacteria described in claim 4, it is characterized in that, creatine hydrolase gene described in claim 2 is connected to colibacillus expression plasmid pET20b (+), build recombinant expression plasmid pET20b-cre, the recombiant plasmid pET20b-cre of preparation is proceeded in E.coliBL21 competence through chemical transformation.
7. a method for fermenting and producing restructuring creatine hydrolytic enzyme, accesses 20mL/250mL triangular flask, Clothoid type shaking speed 200rpm by the inoculum concentration of 0.4% by the engineering bacteria described in claim 4 from glycerol pipe, and cultivation temperature is 37 DEG C, cultivates 12h；Fermentation culture: being seeded in 50mL/500mL triangular flask by the inoculum concentration of 1% (v/v) by cultured seed culture fluid and cultivate, cultivation temperature is 37 DEG C, shaking speed 200rpm；Treat OD600=0.6, add the IPTG abduction delivering of final concentration of 0.6mmol/L, cultivate 10h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410359141.2A CN104109658B (en) | 2014-07-25 | 2014-07-25 | A kind of creatine hydrolytic enzyme and encoding gene thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410359141.2A CN104109658B (en) | 2014-07-25 | 2014-07-25 | A kind of creatine hydrolytic enzyme and encoding gene thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104109658A CN104109658A (en) | 2014-10-22 |
| CN104109658B true CN104109658B (en) | 2016-06-29 |
Family
ID=51706647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410359141.2A Expired - Fee Related CN104109658B (en) | 2014-07-25 | 2014-07-25 | A kind of creatine hydrolytic enzyme and encoding gene thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104109658B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274080B (en) * | 2015-11-11 | 2018-08-07 | 江南大学 | A kind of creatine hydrolysis enzyme mutant that thermal stability improves |
| CN105907739B (en) * | 2016-05-04 | 2020-01-03 | 江南大学 | Creatine hydrolase mutant with improved thermal stability |
| CN109957533A (en) * | 2019-04-04 | 2019-07-02 | 大连大学 | One plant of marine bacteria for producing sarcosine oxidase and its application |
| CN109897805A (en) * | 2019-04-04 | 2019-06-18 | 大连大学 | A kind of screening technique producing sarcosine oxidase bacterial strain |
| CN110257359B (en) * | 2019-06-24 | 2020-07-14 | 湖南艾科瑞生物工程有限公司 | Improved high-activity heat-resistant creatine hydrolase and application thereof |
-
2014
- 2014-07-25 CN CN201410359141.2A patent/CN104109658B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| Cloning of the creatinine amidohydrolase gene from Pseudomonas sp PSJ;Yamamoto K等;《Biosci Biotech Biochem》;19951231;第59卷(第7期);1331-1332 * |
| 登录号：CBT76936.1;Monnet,C.等;《GENBANK》;20110120;第1页 * |
| 登录号：FQ311875.1;Monnet,C.等;《GENBANK》;20110120;第1页（3061538-3061791） * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104109658A (en) | 2014-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104109658B (en) | A kind of creatine hydrolytic enzyme and encoding gene thereof and application | |
| CN102286441B (en) | Low-temperature esterase and coding gene and use thereof | |
| CN103361326B (en) | Partial glyceride lipase mutant with improved thermal resistance, mutant plasmid, recombination strain and preparation method | |
| CN104560927B (en) | A kind of arginine deiminase of mutation and its preparation method and application | |
| CN102911927B (en) | Glutamate decarboxylase as well as coding genes and application thereof | |
| CN103881994B (en) | β -galactosidase mutant with high transglycosidic activity and preparation method and application thereof | |
| CN106995811B (en) | A kind of algin catenase, preparation method and application | |
| CN101633931A (en) | Hyaluronidase expression vector and application thereof | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN105505846A (en) | Recombined spore with surface displaying glutamate dehydrogenase and construction method and application thereof | |
| CN109777793A (en) | A kind of GDSL lipase, genetic engineering bacterium and its application | |
| CN103525784A (en) | Partial glyceride lipase mutant, plasmids, recombination strains, preparation methods and applications | |
| CN111235133B (en) | Bacillus chitin-philic chitinase gene and clone expression and application thereof | |
| CN104694524A (en) | Method for preparing glutamic acid decarboxylase mutant by utilizing ramachandran map information and mutant thereof | |
| CN103525782A (en) | Organophosphorus pesticide degrading enzyme gene and application thereof | |
| CN104004732B (en) | A kind of chitosanase and its preparation method and application | |
| CN105274080A (en) | Creatinase mutant with increased thermal stability | |
| CN101372693A (en) | Heat resisting cellulase gene, recombinant engineering bacterium, heat resisting cellulase and use | |
| CN109929860A (en) | A kind of preparation and application of fucoidin enzyme coding gene and enzyme | |
| CN105200076A (en) | Bacillus subtilis recombined to express gamma-lactamase and immobilization and application | |
| CN105950596B (en) | A kind of difunctional acid urease gene and its expression and application | |
| CN105296513A (en) | Marine esterase as well as coding gene E22 and application thereof | |
| CN102220354B (en) | Heat-resisting urate oxidase gene of microbacterium category bacteria and application of same | |
| CN108929883A (en) | II E of sporulation related gene spo is influencing the application in strain growth and producing enzyme | |
| CN106566837A (en) | Iota-carrageenan enzyme gene derived from marine bacteria and applications of iota-carrageenan enzyme gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160629 Termination date: 20170725 |