CN104109658A - Creatine hydrolysis enzyme as well as coding gene and application thereof - Google Patents
Creatine hydrolysis enzyme as well as coding gene and application thereof Download PDFInfo
- Publication number
- CN104109658A CN104109658A CN201410359141.2A CN201410359141A CN104109658A CN 104109658 A CN104109658 A CN 104109658A CN 201410359141 A CN201410359141 A CN 201410359141A CN 104109658 A CN104109658 A CN 104109658A
- Authority
- CN
- China
- Prior art keywords
- creatine
- lytic enzyme
- enzyme
- gene
- hydrolysis enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/03—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amidines (3.5.3)
- C12Y305/03003—Creatinase (3.5.3.3), i.e. creatine amidinohydrolase
Abstract
The invention discloses a creatine hydrolysis enzyme as well as a coding gene and application thereof, belonging to the technical field of biomedical diagnosis. A nucleotide sequence of a gene of the creatine hydrolysis enzyme provided by the invention is shown in SEQ ID NO.1, an amino acid sequence is shown in SEQ ID NO.2, recombinant plasmids pET20b-cre are constructed, genetically engineered bacteria capable of efficiently expressing the creatine hydrolysis enzyme are obtained by transferring the recombinant plasmids into E.coli BL21, and efficient production of the creatine hydrolysis enzyme can be realized by applying the genetically engineered bacteria. The successful construction of the engineering bacteria lays a foundation for reducing the production cost of the creatine hydrolysis enzyme and expanding the application range.
Description
Technical field
The present invention relates to a kind of creatine lytic enzyme and encoding gene thereof, and this encoding gene recombination bacillus coli is prepared the method for creatine lytic enzyme.The invention belongs to technical field of bioengineering, the present invention recombinate preparation creatine lytic enzyme product belong to medical diagnosis compound, can be for detection of human kidney function.
Background technology
The energy of the mankind's muscle and brain consumption mainly comes from the hydrolysis of phosphocreatine.Phosphocreatine and ADP can form ATP under the effect of enzyme, generate creatine simultaneously, and the creatine forming is converted to creatinine in vivo the most at last.In addition, phosphocreatine also can be in vivo directly dephosphorylate generate creatinine, creatinine enters urine by blood and excretes through the filtration of kidney.This function of healthy kidney can ensure the creatinine forming in metabolic process is constantly excreted and make the creatinine in blood remain at a lower level.If kidney generation pathology, can not effectively remove formed creatinine and cause creatinine to accumulate in blood.Therefore the creatinine content of blood and urine can reflect the excretory function of kidney.Creatinine assay mainly contains chemical method and enzyme process.Chemical method has multiple, but mostly comes from the alkaline picric acid method that Jeffe sets up in one's early years, and its advantage is that cost is low, simple to operate.Although this method is economical, be subject to the interference of the non-specific material (false creatinine) in sample, and susceptibility is poor.
Enzymatic means is that sample passes through creatininase (creatinine amidohydrolase, E.C.3.5.2.10), creatine lytic enzyme (E.C.3.5.3.3), sarcosine oxidase (sareosine oxidase, E.C.1.5.3.1) continuous conversion, creatinine is degraded completely, the feature such as specificity that the method has enzymatic reaction is strong, highly sensitive, easy, quick.
Creatine lytic enzyme is requisite a kind of enzyme in enzymatic detection method, is mainly derived from microorganism.Nineteen thirty-seven finds that creatinine can be degraded by microorganisms first.The bacterial strain of finding subsequently some genus can be produced creatine lytic enzyme and be accumulated in cell by induction.These bacteriums have Rhodopseudomonas (Pseudomonas), clostridium (Clostridium), Flavobacterium (Flavobacterium), bacillus (Bacillus), Alcaligenes (Alcaligenes), paracoccus (Paracoccus) etc.The external research for E.C. 3.5.3.3 is mainly in the following aspects: (1) original bacterium produces the condition of enzyme production of E.C. 3.5.3.3; (2) expression of the E.C. 3.5.3.3 gene of several different sourcess; (3) E.C. 3.5.3.3 purifying and zymologic property research.Produced at present creatinine detection kit abroad, and China starts late in the research of creatine lytic enzyme, application clinically still mainly relies on import.
Summary of the invention
The invention provides a kind of method of creatine lytic enzyme High-efficient Production and purification.In the present invention, provide with genetic engineering technique clone and obtained described creatine hydrolase gene, built engineering bacteria and the production method thereof of Recombinant protein expression creatine lytic enzyme.
The present invention relates to the full-length gene order that clone obtains creatine lytic enzyme, relate to and build the method that the described high efficient expression of creatine hydrolase gene engineering is prepared creatine lytic enzyme, also relate to creatine lytic enzyme of the present invention application in medical treatment as herein described as lytic enzyme.
The invention provides a kind of creatine lytic enzyme that derives from Arthrobacter, its aminoacid sequence is as shown in SEQ ID NO.1.
The present invention also provides the gene of the described creatine lytic enzyme of encoding, and its nucleotide sequence is as shown in SEQ ID NO.2.
Contain the plasmid of creatine hydrolase gene described in claim 2 and also belong to the scope of protection of present invention.
Genetic engineering bacterium or the transgenic cell line of the gene that contains above-mentioned recombinant plasmid or creatine lytic enzyme all belong to the scope of protection of present invention.
The gene clone of the creatine lytic enzyme (CRE) described in the present invention is obtained with recombination and preparation as follows:
Described in 1, the clone of creatine lytic enzyme CRE full-length gene obtains.
The structure of creatine lytic enzyme CRE gene recombined escherichia coli expression vector described in 2.Creatine lytic enzyme CRE gene in described preparation method 1 is utilized to primer CREF, CRER amplification, adopt digestion with restriction enzyme, be connected to colibacillus expression plasmid pET20b (+), build recombinant expression plasmid pET20b-cre.
3 proceed to the recombinant expression pET20b-cre described in preparation method 2 in E.coliBL21 competence through chemical transformation.On the LB flat board that is added with penbritin (0.1 μ g/mL), screen positive recombinant, and it is successful with Auele Specific Primer CREF, CRER, positive colibacillus to be dropped into performing PCR checking creatine lytic enzyme CRE gene recombination E.coliBL21 (pET20b-cre).
The present invention also provides a kind of method of fermentative production restructuring creatine lytic enzyme: described engineering bacteria is accessed 20mL/250mL triangular flask by the inoculum size by 0.4% from glycerine pipe, Clothoid type shaking speed 200rpm, and culture temperature is 37 DEG C, cultivates 12h.Fermentation culture: cultured seed culture fluid is seeded in 50mL/500mL triangular flask and is cultivated by the inoculum size of 1% (v/v), and culture temperature is 37 DEG C, shaking speed 200rpm; Treat OD
600=0.6, adding final concentration is the IPTG abduction delivering of 0.6mmol/L, cultivates 10h.
The restructuring creatine lytic enzyme of preparing by aforesaid method, E.coliBL21 (pET20-cre) fermented liquid carries out the detection of creatine hydrolytic enzyme activities, adopts colorimetry to detect.
The present invention, by molecular biological means, provides a kind of new creatine hydrolase gene.In addition, build the Recombinant organism of a plant height product creatine lytic enzyme, apply this bacterial classification and produce creatine lytic enzyme, there is the plurality of advantages such as production technique is simple, product production is high, production peak can reach 32U/mL, and expection can solve the industrial application problem that application intestinal bacteria produce creatine lytic enzyme.The present invention is that research, exploitation, the production work of creatine lytic enzyme laid a good foundation, also for creatine lytic enzyme provides convenience in the application in the fields such as medical diagnosis.
Brief description of the drawings
Figure 1 shows that recombination bacillus coli and original bacterium shake flask fermentation produce alive comparison of crude enzyme liquid enzyme of creatine lytic enzyme.
Figure 2 shows that protein purification SDS-PAGE electrophoresis result (M, the protein standard molecular weight of restructuring creatine lytic enzyme; 1, E.coliBL21/pET20b contrast broken wall supernatant; 2, recombinant bacterium broken wall supernatant; 3,60-80% ammonium sulfate saturation ratio albumen; 4, the restructuring creatine hydrolase protein of purifying).
Embodiment
Materials and methods
Creatine hydrolyzing activity unit of force definition: react under the condition of 37 DEG C and pH7.0, it is a unit (U) that per minute produces the required enzyme amount of 1 μ mol yellow dyes.
Colorimetric method for determining creatine lytic enzyme enzyme is lived: creatine is decomposed into sarkosine and urea under the effect of creatine lytic enzyme, and urea and paradimethy laminobenzaldehyde produce yellow dyes under acidic conditions, and the growing amount of yellow dyes is directly proportional to the vigor of E.C. 3.5.3.3.
Implement example 1: creatine lytic enzyme
In the present invention, the aminoacid sequence of creatine lytic enzyme is as shown in SEQIDNO.1, and the mode that Nucleotide obtains is:
By the comparison of the creatine hydrolase gene sequence to different sources, design primer (CREF:GAAAGAACATATGACTACCGCCAACATCGCCACCA; CRER:TTCTCTCGAGTTACGCGTCGATGATGTTGTTCTCC), taking tobacco Arthrobacter (Arthrobacter nicotianae 23710) genome as template, the fragment that success obtains about 1200bp, checks order, and nucleotide sequence is as shown in SEQ ID NO.2.
Creatine lytic enzyme of the present invention, the information of its aminoacid sequence SEQ ID NO.1 is as follows:
Creatine lytic enzyme of the present invention, the information of its nucleotide sequence SEQ ID NO.2 is as follows:
atgactaccgccaacatcgccaccaatgtttccgaactggcccgactgaagaccctgcacaacggcgccaaggagcagctgaccttctcggatgccgagttcgagcgccgcctggccggcctgcgccagatcatggccgcgaagtcgctggacgcggtcatcctgaccagctaccacggcatcaagtactactcggacttcctgtacaccaccttcggccgcaactacgcgctggtggtcaccgccagcaactccaccaccgtcaccgcgaacatcgatgccggcatgccatggcgcaccagctacggcgacaacatcgtgtacaccgactggaagcgcgacaacttcttctacggcctgcaggaagcacttaagcgcgacggcgtgaaggcaacccggatcggcgtggaagacgacttcctgccgggccgcacccgccagcagatcgccgacaccttcgacggcgcaaccctggtggatgtctcgcaggacgccatgcgccagcgcatgatcaagtccgccgaggaaatcgaggtcatcaagcacggtgcacgcatcggcgacctgggcggcgaagccatcaaggcagcgatccgcgaaggcatcagcgaatacgaggtcgcactgatcggcaccgaggccatggtgcacgagatcgccaagaccttcccacaccgcgaagtgcgcgacacctgggtctggttccagtccggcatcaacaccgacggcgcccacaactgggccaccacccgcaagcttcagcgcggcgacatcctgtcgctgaactgcttccccatgacttccggctactacaccgcactggagcgcaccctgttcctgggcgagccggatgcccgcagcctggaactgtggaacatcaacgtcgaggtgcacaagcgcggcctggagctgatcaagcccggtgctgtctgcaaggacatcgccgccgagctgaacgagatctacatcgcccacggcctgctgccgaaccgcaccttcggctacggccactccttcggcgtgctctcgcactactacggacgtgaagccggtctggagctgcgcgaggacattgagactgtcctggagccaggcatggtcgtctcgatggaaccgatgatcaccgtcatggacggcgagccaggtgccggcggctaccgcgagcacgacatcctggtcatcggcgaggataacaccgttgagaacatcaccaagttcggtttcggtccggagaacaacatcatcgacgcgtaa
Implement example 2: the structure that contains the expression system of creatine hydrolase gene
Expression vector described in the present invention is pET20b (+), and choosing upstream restriction enzyme site according to carrier is NdeI, and downstream restriction enzyme site is XhoI.The cloning vector pMD19-T that contains creatine hydrolase gene (cre) obtaining and expression vector pET20b (+) are carried out respectively to double digestion, cut after 40min in 37 DEG C of enzymes, gel electrophoresis is verified and is reclaimed enzyme and cut product.The expression vector that recovery is obtained is connected with goal gene, and connecting fluid is transformed into expressive host E.coliBL21, and recombinant clone is correct through PCR checking.
Implement example 3: recombination bacillus coli heterogenous expression creatine lytic enzyme
Glycerine pipe: glycerol concentration is 20%; Seed culture medium consists of (g/L): peptone 10, yeast extract paste 5, NaCl10, pH7.0,100 μ g/mL ammonia benzyl mycins; Fermention medium consists of (g/L): peptone 12, yeast extract paste 24, glycerine 4, KH
2pO
42.31, K
2hPO
416.43,100 μ g/mL ammonia benzyl mycins.Seed culture: the inoculum size by 0.4% from glycerine pipe accesses 20mL/250mL triangular flask, Clothoid type shaking speed 200rpm, culture temperature is 37 DEG C, cultivates 12h.Fermentation culture: cultured seed culture fluid is seeded in 50mL/500mL triangular flask and is cultivated by the inoculum size of 1% (v/v), and culture temperature is 37 DEG C, shaking speed 200rpm.Treat OD
600=0.6, adding final concentration is the IPTG abduction delivering of 0.6mmol/L, cultivates 10h, and creatine lytic enzyme output can reach 32U/mL.
Implement example 4: the enzyme activity determination of recombinant production creatine lytic enzyme
Creatine is hydrolyzed and generates sarkosine and urea under the catalysis of creatine lytic enzyme, and urea and p-dimethylaminobenzaldehyde act on and produce yellow dyes under acidic conditions, and the growing amount of yellow dyes and E.C. 3.5.3.3 activity are proportional.Measure the absorbancy of yellow dyes at 435nm place, can calculate the growing amount of yellow dyes according to the mmole specific absorbance of this yellow dyes.Unit definition: under these conditions, it is 1 unit (U) that per minute produces 1 μ mol yellow dyes.Reaction system is the creatine solution of 900 μ L with the 0.1mol/L of the phosphate buffered saline buffer preparation of pH7.0,50mM, adds the enzyme liquid of 100 μ L in system, at 37 DEG C, reacts 10min.Add the p-dimethylaminobenzaldehyde solution of 2mL (the p-dimethylaminobenzaldehyde of molten 2g, in 100mL dimethyl sulfoxide (DMSO), then adds concentrated hydrochloric acid 15mL) termination reaction.Control group first adds p-dimethylaminobenzaldehyde solution, after add enzyme liquid.Measure light absorption value at 435nm place, with water zeroing, calculate enzyme value alive.
Implement example 5: the purification of restructuring E.C. 3.5.3.3
After broken recombination bacillus coli, carry out ammonium sulfate precipitation, select the precipitation of 60-80% ammonium sulfate saturation ratio.With a small amount of phosphate buffered saline buffer (pH7.0) soluble protein precipitation, dialyzed overnight is to remove the ammonium sulfate in enzyme liquid.According to the iso-electric point character of creatine lytic enzyme, select QFF post to carry out ion-exchange purification.QFF post, with phosphate buffered saline buffer balance 30min, injects purification column by crude enzyme liquid, with the phosphate buffered saline buffer wash-out target protein that contains 0.1MNaCl.
Claims (8)
1. a creatine lytic enzyme that derives from Arthrobacter, is characterized in that, its aminoacid sequence is as shown in SEQ ID NO.1.
2. the gene of creatine lytic enzyme described in coding claim 1, is characterized in that nucleotide sequence is as shown in SEQ ID NO.2.
3. a recombinant plasmid, is characterized in that, it contains creatine hydrolase gene claimed in claim 2.
4. a restructuring creatine lytic enzyme engineering bacteria that contains recombinant plasmid claimed in claim 3.
5. a restructuring creatine lytic enzyme clone that contains recombinant plasmid claimed in claim 3.
6. the method for engineering bacteria described in structure claim 4, it is characterized in that, creatine hydrolase gene claimed in claim 2 is connected to colibacillus expression plasmid pET20b (+), build recombinant expression plasmid pET20b-cre, the recombinant plasmid pET20b-cre of preparation is proceeded in E.coliBL21 competence through chemical transformation.
7. the method for fermentative production restructuring creatine lytic enzyme: engineering bacteria claimed in claim 5 is accessed a 20mL/250mL triangular flask by the inoculum size by 0.4% from glycerine pipe, Clothoid type shaking speed 200rpm, culture temperature is 37 DEG C, cultivates 12h; Fermentation culture: cultured seed culture fluid is seeded in 50mL/500mL triangular flask and is cultivated by the inoculum size of 1% (v/v), and culture temperature is 37 DEG C, shaking speed 200rpm; Treat OD
600=0.6, adding final concentration is the IPTG abduction delivering of 0.6mmol/L, cultivates 10h.
8. the application of creatine lytic enzyme in mensuration human body creatinine content, evaluation human body renal function described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410359141.2A CN104109658B (en) | 2014-07-25 | 2014-07-25 | A kind of creatine hydrolytic enzyme and encoding gene thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410359141.2A CN104109658B (en) | 2014-07-25 | 2014-07-25 | A kind of creatine hydrolytic enzyme and encoding gene thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104109658A true CN104109658A (en) | 2014-10-22 |
| CN104109658B CN104109658B (en) | 2016-06-29 |
Family
ID=51706647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410359141.2A Expired - Fee Related CN104109658B (en) | 2014-07-25 | 2014-07-25 | A kind of creatine hydrolytic enzyme and encoding gene thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104109658B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274080A (en) * | 2015-11-11 | 2016-01-27 | 江南大学 | Creatinase mutant with increased thermal stability |
| CN109897805A (en) * | 2019-04-04 | 2019-06-18 | 大连大学 | A kind of screening technique producing sarcosine oxidase bacterial strain |
| CN109957533A (en) * | 2019-04-04 | 2019-07-02 | 大连大学 | One plant of marine bacteria for producing sarcosine oxidase and its application |
| CN110257359A (en) * | 2019-06-24 | 2019-09-20 | 陕西斯戴木生物科技有限公司 | A kind of creatine hydrolase that improved high activity is heat-resisting and its application |
| CN110592055A (en) * | 2016-05-04 | 2019-12-20 | 江南大学 | Creatine hydrolase mutant with improved thermal stability |
-
2014
- 2014-07-25 CN CN201410359141.2A patent/CN104109658B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| MONNET,C.等: "登录号：CBT76936.1", 《GENBANK》, 20 January 2011 (2011-01-20), pages 1 * |
| MONNET,C.等: "登录号：FQ311875.1", 《GENBANK》, 20 January 2011 (2011-01-20) * |
| YAMAMOTO K等: "Cloning of the creatinine amidohydrolase gene from Pseudomonas sp PSJ", 《BIOSCI BIOTECH BIOCHEM》, vol. 59, no. 7, 31 December 1995 (1995-12-31), pages 1331 - 1332, XP003018889 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105274080A (en) * | 2015-11-11 | 2016-01-27 | 江南大学 | Creatinase mutant with increased thermal stability |
| CN105274080B (en) * | 2015-11-11 | 2018-08-07 | 江南大学 | A kind of creatine hydrolysis enzyme mutant that thermal stability improves |
| CN110592055A (en) * | 2016-05-04 | 2019-12-20 | 江南大学 | Creatine hydrolase mutant with improved thermal stability |
| CN110592055B (en) * | 2016-05-04 | 2021-03-02 | 江南大学 | Creatine hydrolase mutant with improved thermal stability |
| CN109897805A (en) * | 2019-04-04 | 2019-06-18 | 大连大学 | A kind of screening technique producing sarcosine oxidase bacterial strain |
| CN109957533A (en) * | 2019-04-04 | 2019-07-02 | 大连大学 | One plant of marine bacteria for producing sarcosine oxidase and its application |
| CN110257359A (en) * | 2019-06-24 | 2019-09-20 | 陕西斯戴木生物科技有限公司 | A kind of creatine hydrolase that improved high activity is heat-resisting and its application |
| CN110257359B (en) * | 2019-06-24 | 2020-07-14 | 湖南艾科瑞生物工程有限公司 | Improved high-activity heat-resistant creatine hydrolase and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104109658B (en) | 2016-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104109658B (en) | A kind of creatine hydrolytic enzyme and encoding gene thereof and application | |
| CN102286441B (en) | Low-temperature esterase and coding gene and use thereof | |
| CN102911927B (en) | Glutamate decarboxylase as well as coding genes and application thereof | |
| CN103215244B (en) | Alkaline pectinase PelN, as well as encoded gene and application thereof | |
| CN108070581B (en) | L-aspartate beta-decarboxylase mutant with improved enzyme activity and application thereof | |
| CN103602653A (en) | Keratinase with improved thermal stability and specific activity as well as preparation method and application thereof | |
| CN104560927A (en) | Mutated arginine deiminase as well as preparation method and application thereof | |
| CN105505846A (en) | Recombined spore with surface displaying glutamate dehydrogenase and construction method and application thereof | |
| CN103103206B (en) | Alpha-amylase and gene of alpha-amylase, engineering bacteria containing gene and application of engineering bacteria | |
| CN109777793A (en) | A kind of GDSL lipase, genetic engineering bacterium and its application | |
| CN101372693A (en) | Heat resisting cellulase gene, recombinant engineering bacterium, heat resisting cellulase and use | |
| CN103525782A (en) | Organophosphorus pesticide degrading enzyme gene and application thereof | |
| CN105274080A (en) | Creatinase mutant with increased thermal stability | |
| CN105200076A (en) | Bacillus subtilis recombined to express gamma-lactamase and immobilization and application | |
| CN105950596B (en) | A kind of difunctional acid urease gene and its expression and application | |
| CN105002130A (en) | Gene engineering bacteria capable of producing bile salt hydrolase and construction method and application thereof | |
| CN106011118B (en) | A kind of Fe3+ dependent form food-grade acid urase and its application in yellow rice wine | |
| CN104862264B (en) | A kind of recombinant bacterium for converting production α-phenylpyruvic acid efficiency and improving | |
| CN103382464B (en) | Derive from the Ntn hydrolase of the ancient bacterium of hyperthermophilic and encoding gene thereof and application | |
| CN105296513A (en) | Marine esterase as well as coding gene E22 and application thereof | |
| CN102220354B (en) | Heat-resisting urate oxidase gene of microbacterium category bacteria and application of same | |
| CN104762306B (en) | A kind of ocean esterase and its encoding gene E32 and application | |
| CN102952790B (en) | Multifunctional cellulose as well as expression gene and application thereof | |
| CN103194420B (en) | Beta-agarase and recombinant expression strain | |
| CN103468664B (en) | Method for promoting efficient water-soluble expression of arginine deiminase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160629 Termination date: 20170725 |