CN104109145A - Flavonoid structure based hydrogen sulfide donor derivative and application in treatment of neuroinflammation related diseases thereof - Google Patents

Flavonoid structure based hydrogen sulfide donor derivative and application in treatment of neuroinflammation related diseases thereof Download PDF

Info

Publication number
CN104109145A
CN104109145A CN201410279942.8A CN201410279942A CN104109145A CN 104109145 A CN104109145 A CN 104109145A CN 201410279942 A CN201410279942 A CN 201410279942A CN 104109145 A CN104109145 A CN 104109145A
Authority
CN
China
Prior art keywords
group
compound
ghs
phenyl
acceptable salt
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410279942.8A
Other languages
Chinese (zh)
Inventor
刘毅
张玲
李赛
王涛
刘莉
李程
孟文琪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xuzhou Medical College
Original Assignee
Xuzhou Medical College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xuzhou Medical College filed Critical Xuzhou Medical College
Priority to CN201410279942.8A priority Critical patent/CN104109145A/en
Publication of CN104109145A publication Critical patent/CN104109145A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D311/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings
    • C07D311/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only hetero atom, condensed with other rings ortho- or peri-condensed with carbocyclic rings or ring systems
    • C07D311/04—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring
    • C07D311/22—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4
    • C07D311/26—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4 with aromatic rings attached in position 2 or 3
    • C07D311/34—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4 with aromatic rings attached in position 2 or 3 with aromatic rings attached in position 3 only
    • C07D311/36—Benzo[b]pyrans, not hydrogenated in the carbocyclic ring with oxygen or sulfur atoms directly attached in position 4 with aromatic rings attached in position 2 or 3 with aromatic rings attached in position 3 only not hydrogenated in the hetero ring, e.g. isoflavones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention discloses a flavonoid structure based hydrogen sulfide donor derivative and application in treatment of neuroinflammation related diseases thereof. The derivative is a compound with a structure shown as formula (I) or a pharmaceutically acceptable salt thereof. Specifically, A ring has a flavonoid structure; R is a hydrogen sulfide donor group; L is a linking group, which is a connection chain including 2-15 atoms; and m is an integer of 1-5. The flavonoid structure based hydrogen sulfide donor compound provided by the invention can improve the anti-neuroinflammation effect of the compound by giving play to the synergistic effect of hydrogen sulfide and flavonoid derivatives, thereby further treating neuroinflammation related central nervous system diseases, like Alzheimer's disease and Parkinson's disease. (formula I).

Description

Hydrogen sulfide donor derivative based on flavones structure and the application in the neural inflammation related disease for the treatment of thereof
Technical field
The present invention relates to pharmaceutical field, be specifically related to the preparation method and its usage that a class can discharge the flavone derivative of gaseous signal molecule hydrogen sulfide.
Background technology
Inflammatory reaction is accompanied by the acute and chronic process of central nervous system disease, as cerebral apoplexy, cerebral trauma, Parkinson's disease, alzheimer's disease and multiple sclerosis etc.Multinomial research shows, neural inflammation can increase the weight of the pathology process of nerve degenerative diseases.Therefore, neural inflammation being regulated and controled is one of effective ways for the treatment of nerve degenerative diseases.
In recent years, along with the attention to the neural inflammation mechanism of Alzheimer (Alzheimer ' s disease, AD), the chronic Neuroinflammation that has scholar to propose in brain is the another kind of important pathological characters of AD.In the pathogenic process of AD, the deposition of A β can be induced the activation of microglia, can the cause inflammation excessive release of the factor and superoxide of the abnormal activation of microglia, thus Neuroinflammation caused, and this process plays central role in the neurodegenerative process of AD.Inflammatory factor interleukin 1 (interleukin-l, IL-1) excessive release not only can promote the expression of A β precursor protein APP, cause A β deposition and Tau abnormal protein phosphorylation, can also activate microglia and astroglia cell, stimulate tumor necrosis factor-alpha (tumor necrosis factor-α, TNF-α) and interleukin-6 (interleukin-6, the release of inflammatory factor such as IL-6), form vicious cycle and increase the weight of neural inflammation, further affect the synaptic plasticity of hippocampus, cause AD patient's ability of learning and memory to decline.Clinical study discovery, AD patient compares with the healthy population of age-matched, brain local inflammation significant reaction, the acute phase reactant in brain, cytokine and complement proteins etc. significantly increase.Above-mentioned research has all confirmed that neural inflammation is in the developing vital role of AD.
Neural inflammation can cause degeneration of dopaminergic neurons, dead research to receive increasing concern.Parkinson's disease (Parkinson ' s disease, PD) in rat model, find, the microglia of abnormal activation is by producing oxyradical, active oxygen (reactive oxygen species, ROS), nitrogen protoxide (nitric oxide, NO) and cytokine (TNF-α, IL-1 α, IL-1 β, immunoreactivity Mierocrystalline cellulose desmin, IL-26 and Urogastron etc.) cause inflammatory reaction in brain, then increase the weight of neuronal damage, thereby participate in generation and the evolution of PD.In the inflammatory model of LPS induction, the activation of microglia and the minimizing of substantia nigra dopaminergic neuron are closely related, except the abnormal activation of microglia, also exist the activation of mild to moderate astroglia cell.In PD patient's postmortem, observe the microglia that inflammatory factor and abnormal activation are being assembled by substantia nigra of midbrain portion.Also there is bibliographical information, IL-1 α, IL-6, TNF-α and COX-2/PEG in PD patient's brain and in blood plasma 2level raises.Above-mentioned research has all confirmed that the generation of PD and development and neural inflammation are closely related.
As previously mentioned, multinomial research shows that neural inflammation is the important pathological characters of nerve degenerative diseases, occupies very important effect in its pathogenesis.Lasting chronic inflammatory reaction can cause the carrying out property of disease to increase the weight of, and forms vicious cycle, finally causes more neural cell injury, death.And inflammation-inhibiting reaction can neuroprotective unit, improve AD and PD patient's ability of learning and memory.As can be seen here, suppressing microglia and the abnormal activation of astroglia cell and the excessive release of inflammatory factor, is one of strategy for the treatment of nerve degenerative diseases.The exploitation of novel anti-inflammatory medicine is expected to become the effective ways of the nervous system disorders that treatment inflammation is relevant.
Hydrogen sulfide (hydrogen sulfide, H 2s) be the third gaseous signal molecule after NO and CO, be distributed widely in the middle of a plurality of tissues and organ of body, regulate multiple physiology and pathologic function in mammalian body.In central nervous system, hydrogen sulfide is widely regarded as a kind of new neuromodulator, brings into play important physiological function in brain.Numerous studies show that, hydrogen sulfide, mainly by number of mechanisms performance neuroprotectives such as anti-inflammatory, anti-oxidant and anti-apoptosis, is expected to become the new target drone of the nervous system disorderss such as treatment AD and PD.
Hu reported first hydrogen sulfide can be by suppressing P38/MAPK signal pathway, reduced the generation of the inflammatory factors such as the NO of LPS induction in microglia and astroglia cell and TNF-α.Gong has reported that hydrogen sulfide reduces the generation of proinflammatory factor by suppressing NF-kB pathway, and can improve the Cognition Function in Rats damage that LPS causes.Lee has confirmed that hydrogen sulfide and hydrogen sulfide donor compound (S-diclofenac sodium, S-acetylsalicylic acid) can pass through to reduce the release of proinflammatory inflammation factor TNF-α, IL-6, NO subsequently, and the effect of performance anti-neuritis disease.Suppress the activation of p38/JNK and NF-κ B, and the expression of minimizing proinflammatory factor is the mechanism of hydrogen sulfide performance anti-neuritis disease and neuroprotective.Above-mentioned studies confirm that, hydrogen sulfide can, by suppressing the generation of proinflammatory factor and the generation that improves anti-inflammatory factors, mediate its neuroprotective at least partly.Suppress the New Policy that neural inflammation is considered to delay or hinder nerve degenerative diseases development.Therefore, hydrogen sulfide and hydrogen sulfide donor medicine are expected to become novel anti-neuritis disease drug, for the treatment of neural inflammation related disease.
Flavonoid compound (Flavonoids, FLA) is the important natural organic-compound of a class, is the class secondary metabolite that plant produces in long-term natural selection process, is the medicinal ingredients of many herbal medicine.Modern study shows, the pharmacological action such as that FLA has is anticancer, antibacterial, anti-inflammatory, anti-diabetic and complication thereof, anti-oxidant, Cardiovarscular and osteoporosis.Studies have shown that, the activated lower molecular weight Flavonoid substances of tool or its meta-bolites, by reducing oxidative stress, neural inflammation, increase cerebral blood flow (CBF) and cause the long time-histories enhancement performance of hippocampus neuroprotective.Luteolin can suppress beta-secretase (BACE-1), activates alpha-secretase enzyme (ADAM10), suppresses Protein tau Hyperphosphorylationof and vagusstoff enzymic activity performance treatment AD effect.Genistein can effectively reduce the excessive release of inflammatory factor IL-2, IL-6, IL-1 β and TNF-α that LPS causes, thereby reduces inflammatory reaction, reduces the deposition of A β.In addition, genistein not only can protect microglia BV-2 to avoid A β 25-35with the toxic action of LPS, can also be by lowering Toll sample acceptor 4 (TLR4) and NF-κ B signal path, performance anti-inflammatory action.Can cause inflammation when astroglia cell and A β are hatched altogether a large amount of releases of factor iNOS, COX-2, IL-1 β and TNF-α, genistein is by raising the expression of PPAR γ, performance anti-inflammatory and neuroprotective.But the flavonoid compound lipophilic wetting abilities such as genistein all a little less than, bioavailability is low.Therefore, the flavonoid compounds such as genistein are carried out to structure of modification, improve bioavailability with active, become an important channel of this compounds of reasonable development.
Although anti-inflammatory drug treatment AD and PD have made some progress, but the mechanism of anti-inflammatory drug treatment PD and AD also imperfectly understands, also there is dispute in clinical test results, need the clinical treatment of the further clear and definite AD inflammation mechanism of clinical trial extensive, perspective, randomized, double-blind and NSAID (non-steroidal anti-inflammatory drug) (NonSteroidal Antiinflammatory Drugs, NSAIDs) to be worth and best dosage.And the dosage of NSAIDs is larger, serious gastrointestinal side effect has limited traditional NSAIDs for the long-term treatment of AD and PD.Therefore, further explore the pathophysiological process of AD and PD, research better efficacy, security and the better novel anti-inflammatory medicine of tolerance, be extremely important for the treatment of nerve degenerative diseases.
Summary of the invention
The object of the invention is on the basis of existing technology, the hydrogen sulfide donor compound of flavone structure is provided.They show certain anti-neuritis disease effect.
Object of the present invention can reach by following measures:
The present invention relates to have the compound of following chemical structure:
Wherein:
A ring is flavonoid structure;
R is hydrogen sulfide donor group;
L is linking group, comprises the connection chain of 2-15 atom;
M is 1～5 integer.
Above-claimed cpd or its pharmacy acceptable salt, wherein A ring is:
Osajin group: genistein, Dai, 6-methoxy Dai, neochanin, puerarin;
Flavonoid group: luteolin, chrysin, apigenin, scutellarin, Vitexin, isorientin, table orientin, blue grey Liu Su, acacetin, remove methoxy andrographin;
Flavonols group: 3-hydroxyflavone, azaleatin, Zante Fustic, norizalpinin, gossypetin, kaempferide, Isorhamnetol;
Chalcones group: isoliquiritigenin, Corylifolinin, 2-hydroxy-benzalacetophenone, 4-hydroxy-benzalacetophenone, Bavachalcone.
A encircles preferred flavones group:
Osajin group: genistein, Dai, 6-methoxy Dai, puerarin;
Flavonoid group: luteolin, chrysin, apigenin, scutellarin;
Flavonols group: 3-hydroxyflavone, azaleatin, gossypetin, kaempferide;
Chalcones group: isoliquiritigenin, 2-hydroxy-benzalacetophenone, 4-hydroxy-benzalacetophenone, Bavachalcone.
Above-claimed cpd or its pharmacy acceptable salt, wherein the hydrogen sulfide donor of R group is:
The preferred hydrogen sulfide donor of R is:
Above-claimed cpd or its pharmacy acceptable salt, the compound that contains described hydrogen sulfide donor group can discharge hydrogen sulfide through metabolism in vivo.
Above-claimed cpd or its pharmacy acceptable salt, linking group L is x is O or S; Y is O, S or N; N is the integer of 2-8.
The preferred linking group of L is wherein X is O, and Y is O, n=2 or 3.
The present invention also comprises the compound shown in formula (II) or its pharmacy acceptable salt,
The present invention further comprises formula (III) or formula (IV) compound or its pharmacy acceptable salt,
In formula (II), (III) or structure (IV), R 5for substituted-phenyl, substituted benzoyl or saturated or unsaturated hydrocarbons sulfenyl, described substituting group is selected from, 1,2-dithiole-3-thioketones base, 1,2-dithiole-3-thioketones formyl radical, amino thioformyl or 1,2-dithiolane base.
Saturated or unsaturated hydrocarbons sulfenyl in the present invention comprises stable hydrocarbon sulfenyl (being alkyl-S-), also comprises unsaturated hydrocarbons sulfenyl (being unsaturated alkyl-S-), and " unsaturated " here refers to and in group, contain one or more alkenyl or alkynyls.Carbonatoms saturated or unsaturated hydrocarbons sulfenyl in the present invention is generally 1～6, and preferably 1～4, further preferably 2～4.A kind of concrete saturated or unsaturated hydrocarbons sulfenyl includes but not limited to methyl sulfenyl, ethyl sulfenyl, n-propyl sulfenyl, allyl group sulfenyl etc.
" alkyl " in the present invention in each group is when undefined, refer generally to carbonatoms and be 1～8 straight or branched alkyl, be preferably carbonatoms and be 1～6 straight or branched alkyl, the straight or branched alkyl that more preferably carbonatoms is 1～4.The alkyl here includes but not limited to methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, isobutyl-etc.
In a kind of preferred version, R 5for substituted-phenyl or C 1~ 6saturated or unsaturated hydrocarbons sulfenyl, described substituting group selected from mercapto, 1,2-dithiole-3-thioketones base, 1,2-dithiole-3-thioketones formyl radical, amino thioformyl or 1,2-dithiolane base.
In another kind of preferred version, R 5for substituted-phenyl or C 2～4saturated or unsaturated hydrocarbons sulfenyl, described substituting group is selected from 1,2-dithiole-3-thioketones base, amino thioformyl or 1,2-dithiolane base; And when X is O, R 5for substituted-phenyl, when X is S, R 5for C2～4 are saturated or unsaturated hydrocarbons sulfenyl.
In another kind of preferred version, R 5be 1,2-dithiole-3-thioketones base phenyl, amino thioformyl phenyl or allyl group sulfenyl; And when X is O, R 5be 1,2-dithiole-3-thioketones base phenyl or amino thioformyl phenyl, when X is S, R 5for allyl group sulfenyl.
In formula (II), (III) or structure (IV), X is O or S.
In formula (II), (III) or structure (IV), Z is-OC (=O)-,-C (=O) O-or covalent linkage; When Z is covalent linkage, the alkylidene group of Z the right and left is directly connected by covalent linkage.
In formula (II), (III) or structure (IV), Y is O or S; Preferably, Y is O.
In formula (II) structure, R 6for substituted or non-substituted phenyl, its substituting group be hydroxyl, alkoxyl group or-Y-(CH 2) q-Z-(CH 2) p-X-R 5, or two adjacent substituting groups are connected and form oxygen heterocyclic ring with together with carbon atom on phenyl ring.R 6be further formula (III) or (IV) in structure.
In formula (III) structure, R 7for one or more hydroxyls or C 1～4alkoxyl group; In a kind of preferred version, R 7for one or more hydroxyls.In another kind of preferred version, R 7for contraposition hydroxyl.
In the structure of formula (IV), R 8for hydrogen, one or more C 1～4alkoxyl group or-Y-(CH 2) q-Z-(CH 2) p-X-R 5, or R 8with being attached thereto phenyl ring, form benzodioxane group; In a kind of preferred version, R 8for hydrogen or-Y-(CH 2) q-Z-(CH 2) p-X-R 5, or R 8form benzodioxane group with phenyl ring.
In formula (II), (III) or structure (IV), p or q are respectively 1～4 integer independently; In a kind of preferred version, p or q are respectively 1～3 integer independently.In another kind of preferred version, p or q are respectively 1 or 2 or 3 independently.
Above-claimed cpd or its pharmacy acceptable salt, wherein said compound is to be selected from lower group one or more:
General synthetic method
The total preparation of compound of mentioning in the present invention is:
Take genistein as raw material, first react with ethyl bromoacetate and obtain derivative G-1, under ultrasound condition, carry out esterlysis reaction and obtain containing carboxy derivatives G-2, then under alkaline condition, react and obtain target compound GHS-1 with hydrogen sulfide donor ADT-Br.We also obtain brominated derivative G-3 and G-4 by genistein and glycol dibromide and the reaction of 1,3-dibromopropane.Compound G-3 and G-4 react and obtain target compound with hydrogen sulfide donor ADT-OH, TBZ, ACS60 and ACS81 respectively.
The luteolin (or chrysin or apigenin) of take is raw material, by luteolin and 1,2-ethylene dibromide and 1,3-dibromopropane reacts and obtains brominated derivative under alkaline condition, control the input ratio of raw material and the consumption of catalyzer, obtain multiple differently from br-derivatives, then react and obtain target compound with hydrogen sulfide donor ADT-OH, TBZ, ACS60 and ACS81; Luteolin (or chrysin or apigenin) is reacted and obtains derivative with ethyl bromoacetate, control the input ratio of raw material and the consumption of catalyzer, obtain multiple different from ester group derivative, under ultrasound condition, carrying out esterlysis reaction obtains containing carboxy derivatives again, again with 1,2-ethylene dibromide and 1,3-dibromopropane react and obtain brominated derivative under alkaline condition, then react and obtain target compound with hydrogen sulfide donor ADT-OH, TBZ, ACS60 and ACS81.
The compounds of this invention enters after body, can decompose and discharge flavone derivative and hydrogen sulfide, produces collaborative anti-inflammatory effect.
Compound of the present invention or they and pharmaceutically can to accept salt be raw material, be prepared into and be spendablely clinically used for the treatment of the disease that inflammation is relevant, and the central nervous system disease thing that wherein preferably neural inflammation is relevant, as alzheimer's disease and Parkinson's disease.
Another object of the present invention is to provide a kind of pharmaceutical composition, and it is activeconstituents or main active ingredient that this pharmaceutical composition be take compound of the present invention or its pharmacy acceptable salt, is aided with pharmaceutically acceptable auxiliary material and makes.
The present invention also provides a kind of pharmaceutical composition, and this pharmaceutical composition comprises compound or its pharmacy acceptable salt and pharmaceutically acceptable diluent or carrier.
Can be by compound of the present invention the form administration with prodrug.Prodrug refers to the compound just after transforming in organism with pharmacological action.Can use prodrug to change physicochemical property or the pharmacokinetics aspect character of the compounds of this invention.When compound of the present invention contains, can connect while changing the suitable group of character group or substituted radical, can form prodrug.
" pharmacy acceptable salt " in the present invention represents to retain the biological effectiveness of parent compound and those salt of character.This class salt comprises:
(1) with sour salify, free alkali by parent compound reacts and obtains with mineral acid or organic acid, mineral acid comprises hydrochloric acid, Hydrogen bromide, nitric acid, phosphoric acid, metaphosphoric acid, sulfuric acid, sulfurous acid and perchloric acid etc., organic acid comprises acetic acid, trifluoroacetic acid, propionic acid, vinylformic acid, caproic acid, pentamethylene propionic acid, hydroxyethanoic acid, pyruvic acid, oxalic acid, (D) or (L) oxysuccinic acid, fumaric acid, toxilic acid, phenylformic acid, hydroxy-benzoic acid, gamma-hydroxybutyric acid, methoxybenzoic acid, phthalic acid, methylsulfonic acid, ethyl sulfonic acid, naphthalene-1-sulfonic acid, naphthalene-2-sulfonic acid, tosic acid, Whitfield's ointment, tartrate, citric acid, lactic acid, styracin, dodecyl sulphate, glyconic acid, L-glutamic acid, aspartic acid, stearic acid, amygdalic acid, succsinic acid or propanedioic acid etc.
(2) salt that is present in that acid proton in parent compound is replaced by metal ion or is generated with organic bases ligand compound, metal example is alkalimetal ion, alkaline-earth metal ions or aluminum ion for example, organic bases such as thanomin, diethanolamine, trolamine, Trometamol, N-METHYL-ALPHA-L-GLUCOSAMINE, quinine etc.
" pharmaceutical composition " refers to one or more or its pharmacy acceptable salt, solvate, hydrate or prodrug and other chemical composition in the compound in the present invention, and for example pharmaceutically acceptable carrier, mixes.The object of pharmaceutical composition is to promote administration to the process of animal.
" pharmaceutical carrier " refer to organism do not cause obvious pungency and do not disturb the biological activity of given compound and the pharmaceutical composition of character in non-active ingredient, such as but not limited to calcium carbonate, calcium phosphate, various sugar (such as lactose, N.F,USP MANNITOL etc.), starch, cyclodextrin, Magnesium Stearate, Mierocrystalline cellulose, magnesiumcarbonate, acrylate copolymer or methacrylate polymer, gel, water, polyoxyethylene glycol, propylene glycol, ethylene glycol, Viscotrol C or hydrogenated castor oil or many oxyethyl groups hydrogenated castor oil, sesame oil, Semen Maydis oil, peanut wet goods.
Hydrogen sulfide donor compound based on flavones structure provided by the invention, can be by the synergy of performance hydrogen sulfide and flavone derivative, improve the anti-neuritis disease effect of compound, and then can treat the central nervous system disease that neural inflammation is relevant, as alzheimer's disease and Parkinsonian treatment.
Accompanying drawing explanation
The impact of Fig. 1 target compound on LPS induction BV2 Hemapoiesis TNF-alpha levels.
BV2 cell and compound are hatched 2h, add afterwards LPS to hatch 24h. data and represent (n=6) with mean value ± standard error. ap<0.001 compares with control group; bp<0.001 compares with LPS group; cp<0.001 and GHS-1, GHS-3, GHS-4, GHS-5, GHS-6, GHS-8 and GHS-9 group are compared.
The impact of Fig. 2 target compound on LPS induction BV2 Hemapoiesis IL-1 β level.
BV2 cell and compound are hatched 2h, add afterwards LPS to hatch 24h. data and represent (n=6) with mean value ± standard error. ap<0.001 compares with control group; bp<0.001 compares with LPS group; cp<0.001 and GHS-1, GHS-3, GHS-4, GHS-5, GHS-6, GHS-8 and GHS-9 group are compared.
Fig. 3 in Morris water maze laboratory, the impact of compound GHS-2 on neural inflammation mouse latent period (A), swimming rate (B), target quadrant percentage (C) and traversing times (D).
Data represent (n=12) with mean value ± standard error. ap<0.05 compares with sham operated rats; bp<0.05, cp<0.01, dp<0.001 compares with LPS group; ep<0.05, fp<0.01 compares with LPS+GHS-2high group.
The expression of Fig. 4 target compound GHS-2 to CD11b mRNA in neural inflammation hippocampus of mice.
In figure, (A) agarose gel electrophoresis RT-PCR detects the expression of total mRNA in hippocampus, selects β-actin as interior mark; (B) relative content of CD11b mRNA adopts photodensitometry.Data represent (n=3) with mean value ± standard error. ap<0.001 compares with sham operated rats; cp<0.01, dp<0.001 compares with LPS group; ep<0.05 compares with LPS+GHS-2high group.
The expression of Fig. 5 target compound GHS-2 to GFAP mRNA in neural inflammation hippocampus of mice.
In figure, (A) agarose gel electrophoresis RT-PCR detects the expression of total mRNA in hippocampus, selects β-actin as interior mark; (B) relative content of GFAP mRNA adopts photodensitometry.Data represent (n=3) with mean value ± standard error. ap<0.001 compares with sham operated rats; bp<0.05, cp<0.01, dp<0.001 compares with LPS group; ep<0.05, fp<0.01 compares with LPS+GHS-2high group.
The expression of Fig. 6 target compound GHS-2 to TNF-α mRNA in neural inflammation hippocampus of mice.
In figure, (A) agarose gel electrophoresis RT-PCR detects the expression of total mRNA in hippocampus, selects β-actin as interior mark; (B) relative content of TNF-α mRNA adopts photodensitometry.Data represent (n=3) with mean value ± standard error. ap<0.001 compares with sham operated rats; bp<0.05, cp<0.01, dp<0.001 compares with LPS group; ep<0.05, fp<0.01 compares with LPS+GHS-2high group.
The expression of Fig. 7 target compound GHS-2 to IL-1 β mRNA in neural inflammation hippocampus of mice.
In figure, (A) agarose gel electrophoresis RT-PCR detects the expression of total mRNA in hippocampus, selects β-actin as interior mark; (B) relative content of IL-1 β mRNA adopts photodensitometry.Data represent (n=3) with mean value ± standard error. ap<0.001 compares with sham operated rats; bp<0.05, dp<0.001 compares with LPS group; ep<0.05, compares with LPS+GHS-2high group.
The impact of Fig. 8 compound GHS-2 on TNF-alpha levels in neural inflammation hippocampus of mice.
Data represent (n=6) with mean value ± standard error. ap<0.001 compares with sham operated rats; bp<0.05, cp<0.01, dp<0.001 compares with LPS group; ep<0.05, fp<0.01 compares with LPS+GHS-2high group.
The impact of Fig. 9 compound GHS-2 on IL-1 β level in neural inflammation hippocampus of mice.
Data represent (n=6) with mean value ± standard error. ap<0.001 compares with sham operated rats; bp<0.05, dp<0.001 compares with LPS group; ep<0.05, compares with LPS+GHS-2high group.
Embodiment
Preparation Example
Embodiment 1
4 ', 5-dihydroxyl-7-ethoxycarbonyl methoxyl group isoflavones (intermediate G-1)
Genistein (1.08g, 4mmol), adds fully stirring and dissolving of anhydrous propanone 50mL and ethyl bromoacetate (1.33ml, 12mmol), and Anhydrous potassium carbonate (0.55g, 4mmol) adds in three batches, under 40 ℃ of ultrasound conditions, reacts 8h.After reaction finishes, reaction mixture is cooled to room temperature, filters, and filtrate decompression is concentrated, obtains light yellow solid.Yield 85%.mp135℃-138℃,TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.63； 1H?NMR(400MHz,DMSO-d 6):δ12.96(s,1H),9.64(s,1H),8.43(s,1H),7.40(d,J＝8.5Hz,2H),6.89(d,J＝2.6Hz,2H),6.73(t,J＝2.1Hz,1H),6.46(t,J＝2.5Hz,1H),4.96(s,2H),4.21(q,J＝8.4Hz,2H),1.23(t,J＝2.2Hz,3H)；HRMS(ESI +):[M+H] +calcd.for?C 19H 17O 7,357.0969,found,357.0990.
Embodiment 2
4 ', 5-dihydroxyl-7-carboxymethoxyl isoflavones (intermediate G-2)
G1 (1.78g, 5mmol), adds water 50mL, methyl alcohol 50mL and salt of wormwood (0.69g, 5mmol) to mix, and under 40 ℃ of ultrasound conditions, reacts 4h.After reaction finishes, reaction solution concentrating under reduced pressure, filters, and filtrate is acidified to pH1-2 with 1mol/L dilute hydrochloric acid, separates out immediately white precipitate.Yield 55%, mp240 ℃-243 ℃, TLC (silica, hexane:EtOAc, 1:1v/v): R f=0.21; 1h NMR (400MHz, DMSO-d 6): δ 12.94 (s, 1H), 9.61 (s, 1H), 8.39 (s, 1H), 7.32 (d, J=8.8Hz, 2H), 6.79 (d, J=3.4Hz, 2H), 6.61 (t, J=2.2Hz, 1H), 6.37 (m, 1H), 4.82 (s, 2H); HRMS (ESI +): [M+H] +calcd.for C 17h 13o 7, 329.0661, found, 329.0681.
Embodiment 3
4 ', 5-dihydroxyl-7-(2-bromine oxethyl)-isoflavones (intermediate G-3)
Genistein (0.27g, l mmol), glycol dibromide (1.7mL, 20mmol) and salt of wormwood (0.11g, 0.8mmol) are dissolved in 30mL dry DMF, ultrasonic reaction 12h under 40 ℃ of conditions.After having reacted, reaction mixture cool to room temperature, adds 5% sodium bicarbonate dilution, separates out light yellow solid, suction filtration, filter cake petroleum ether, vacuum-drying.Productive rate 86%.mp175℃-178℃。TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.52； 1HNMR(400MHz,DMSO-d 6):δ12.97(s,1H),9.64(s,1H),8.41(s,1H),7.40(d,J＝8.4Hz,2H),6.84(d,J＝8.4Hz,2H),6.69(d,J＝2.0Hz,1H),6.43(d,J＝2.4Hz,1H),4.46(t,J＝5.2Hz,2H),3.84(t,J＝5.6Hz,5.2Hz,2H)； 13C?NMR(100MHz,DMSO-d 6):δ180.9,164.2,162.3,160.0,157.9,154.9,130.6,133.0,121.5,115.6,106.1,98.9,93.5,69.0,31.4。
Embodiment 4
4 ', 5-dihydroxyl-7-(3-bromine propoxy-)-isoflavones (intermediate G-4)
Genistein (0.27g, l mmol), 1,3-dibromopropane (2ml, 20mmol), salt of wormwood (0.11g, 0.8mmol) is dissolved in 30mL dry DMF, ultrasonic reaction 12h under 40 ℃ of conditions.Post-treating method is with the method for G-3.Productive rate 85%, mp124 ℃-126 ℃.TLC(silica，hexane:EtOAc,2:1v/v):R f＝0.66； 1H?NMR(400MHz,DMSO-d 6):δ12.96(s,1H),9.63(s,1H),9.40(s,1H),7.40(d,J＝8.4Hz,2H),6.83(d,J＝8.4Hz,2H),6.67(d,J＝2.0Hz,1H),6.42(d,J＝2.0Hz,1H),4.20(t,J＝6.0Hz,2H),3.67(t,J＝6.4Hz,2H),2.26-2.29(m,2H)； 13C?NMR(100MHz,DMSO-d 6):δ180.9,164.7,162.3,158.0,157.9,154.8,130.6,123.0,121.5,115.6,106.0,98.8,93.3,66.8,32.0,31.4。
Embodiment 5
5-p-hydroxybenzene-D3T (intermediate A DT-OH)
5-p-methoxyphenyl-D3T (0.24g, 1mmol) and pyridine hydrochloride (1.2g, 10mmol) minute mix.Frit reaction 30min under 210 ℃ of conditions, is cooled to room temperature after reaction finishes, and adds 1mol/L dilute hydrochloric acid, and suction filtration, obtains brown solid, vacuum-drying.Yield 81%.mp185℃-187℃。TLC(silica，hexane:EtOAc，4:1v/v):R f＝0.37； 1H?NMR(400MHz,DMSO-d 6):δ6.82(d,J＝8.8Hz,2H),7.65(s,1H),7.73(d,J＝8.8Hz,2H),10.49(s,1H)。
Embodiment 6
5-is to bromo ethoxyl phenenyl-D3T (intermediate A DT-Br)
ADT-OH (0.452g, 2mmol), salt of wormwood (0.552g, 4mmol) and 1,2-ethylene dibromide (0.52mL, 6mmol), dry DMF 30mL fully dissolves, 60 ℃ of reaction 6h, after finishing, reaction is cooled to room temperature, ethyl acetate extraction, distilled water wash 3 times, ethyl acetate layer anhydrous sodium sulfate drying, concentrating under reduced pressure obtains brown solid, yield 56%.TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.58； 1H?NMR(400MHz,DMSO-d 6):δ7.88(d,J＝8.8Hz,2H),7.80(s,1H),7.11(d,J＝8.8Hz,2H),4.41(t,J＝5.2Hz,2H),3.84(t,J＝5.6Hz,5.2Hz,2H)； 13C?NMR(100MHz,DMSO-d 6):δ215.3,174.1,161.8,134.8,129.5,128.8,124.6,116.1,116.0,68.6,31.6。
Embodiment 7
5-is to carboxylic ethoxyl phenenyl-D3T (intermediate A CS60)
ADT-OH (0.45g, 2mmol), salt of wormwood (0.55g, 4mmol) and ethyl bromoacetate (0.66mL, 6mmol), add dry DMF 30mL fully to dissolve, 50 ℃ of reaction 3h, reaction finishes rear cool to room temperature, ethyl acetate extraction, distilled water wash 3 times, ethyl acetate layer anhydrous sodium sulfate drying, concentrating under reduced pressure obtains brown oily matter.TLC(silica，hexane:EtOAc，3:1v/v):Rf＝0.63。
The oily matter (0.31g, 1mmol) of upper step gained is directly used in to the next step, adds 50% sulfuric acid (2.2mL, 20mmol), acetic acid 20mL, 100 ℃ of reaction 2h, after reaction finishes, add distilled water, and suction filtration obtains deep green solid.Yield 49%.TLC(silica，hexane:EtOAc，1:1v/v):R f＝0.24； 1H?NMR(400MHz,DMSO-d 6):δ7.92(d,J＝8.4Hz,2H),7.76(s,1H),7.06(d,J＝12.8Hz,2H),4.79(s,2H)。
Embodiment 8
3-(2-allyl disulfide)-propionic acid (intermediate A CS81)
N 2under protective condition, diallyl disulfide (7.32g, 50mmol), 3-thiohydracrylic acid (1.06g, 10mmol) and 10mol/L NaOH (1.5mL, 15mmol), add methyl alcohol 20mL and ether 10mL, room temperature lucifuge reaction 24h.After reaction finishes, concentrating under reduced pressure, the residue ether dissolution after concentrating, distilled water wash 3 times, ether layer anhydrous sodium sulfate drying, concentrating under reduced pressure.Yield 64%.TLC(silica，CH 2Cl 2:CH 3OH，10:1v/v):R f＝0.52； 1H?NMR(400MHz,DMSO-d 6):δ6.07-5.69(m,1H),5.44-4.99(m,2H),3.40(d,J＝7.2Hz,2H),2.88(t,J＝7.2Hz,6.8Hz,2H),2.63(t,J＝7.2Hz,6.8Hz,2H)； 13C?NMR(100MHz,DMSO-d 6):δ173.2,134.1,119.1,41.5,34.3,33.7。
Embodiment 9
Target compound GHS-1
TBZ (0.15g, 1mmol), G-3 (0.37g, 1mmol) and salt of wormwood (0.14g, 1mmol) add dry DMF 20mL, and stirring and dissolving is kept away the lower 60 ℃ of reaction 4h of dark condition.After reaction finishes, in reaction solution, add distilled water, separate out yellow-green colour solid, suction filtration obtains crude product, the separated GHS-1 that obtains of silica gel column chromatography.Yield 39%.TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.43； 1H?NMR(400MHz,DMSO-d 6):δ12.96(s,1H),9.63(s,1H),8.41(s,1H),7.79(d,J＝8.0Hz,2H),7.39(d,J＝8.0Hz,2H),7.17(d,J＝8.0Hz,2H),6.82(d,J＝8.0Hz,2H),6.72(s,1H),6.45(s,1H),4.45(d,J＝6.4Hz,4H)； 13C?NMR(100MHz,DMSO-d 6):δ180.7,164.4,162.1,162.0,157.8,157.8,154.7,134.5,130.4,122.8,121.3,119.4,116.0,115.4,105.9,103.4,98.7,93.3,67.3,66.8.
Embodiment 10
Target compound GHS-2
ADT-OH (0.23g, 1mmol), G-3 (0.38g, 1mmol) and salt of wormwood (0.14g, 1mmol) add dry DMF 20mL, stirring and dissolving, 60 ℃ of reaction 6h.After reaction finishes, in reaction solution, add distilled water, separate out safran solid, suction filtration obtains crude product, the separated GHS-2 that obtains of silica gel column chromatography.Yield 28%.TLC(silica，hexane:acetone，2:1v/v):R f＝0.46； 1H?NMR(400MHz,DMSO-d 6):δ12.96(s,1H),9.59(s,1H),7.89(d,J＝8.8Hz,2H),7.77(s,1H),7.39(d,J＝8.4Hz,2H),7.15(d,J＝8.8Hz,2H),6.82(d,J＝8.4Hz,2H),6.73(d,J＝2.0Hz,1H),6.47(d,J＝2.0Hz,1H),4.44-4.49(m,4H)； 13C?NMR(100MHz,DMSO-d 6):δ215.3,180.9,174.1,164.6,162.3,162.1,157.9,157.9,154.9,134.7,130.0,129.5,124.4,123.0,121.5,116.1,115.5,106.1,98.9,93.5,67.6,67.0；HRMS(EI +):(M+H) +calcd.for?C 26H 19O 6S 3,523.0344；found,523.0266.
Embodiment 11
Target compound GHS-3
ACS60 (0.28g, 1mmol), G-3 (0.37g, 1mmol) and salt of wormwood (0.14g, 1mmol) add dry DMF 20mL, and stirring and dissolving is kept away the lower 60 ℃ of reaction 6h of dark condition.After reaction finishes, in reaction solution, add distilled water, separate out safran solid, suction filtration obtains crude product, the separated GHS-3 that obtains of silica gel column chromatography.Yield 24%.TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.39； 1H?NMR(400MHz,DMSO-d 6):δ12.96(s,1H),9.60(s,1H),8.38(d,J＝1.8Hz,1H),7.82(s,1H),7.80(s,1H),7.70(s,1H),7.39(dd,J＝2.0Hz,2.4Hz,2H),7.09-7.05(m,2H),6.82(d,J＝8.4Hz,2H),6.60(t,J＝2.4Hz,1H),6.37(d,J＝2.0Hz,1H),4.98(d,J＝5.6Hz,2H),4.51-4.48(m,2H),4.29(d,J＝4.0Hz,2H)； 13C?NMR(100MHz,DMSO-d 6):δ215.2,180.8,173.9,168.8,164.4,162.3,161.4,157.9,154.8,134.8,130.6,129.3,124.8,123.0,121.5,116.1,115.5,106.0,98.8,93.4,67.0,65.3,63.2；MS(EI +):(M+H) +,calcd.for?C 28H 21O 8S 3,581.0；found,581.3.Anal.Calcd?for?C 28H 20O 8S 3:C,57.92；H,3.47；O,22.04.Found:C,57.83；H,3.40；O,22.12.
Embodiment 12
Target compound GHS-4
ACS81 (0.178g, 1mmol), G-3 (0.376g, 1mmol) and salt of wormwood (0.138g, 1mmol) add dry DMF 20mL, and stirring and dissolving is kept away the lower 60 ℃ of reaction 6h of dark condition.After reaction finishes, in reaction solution, add distilled water, separate out light yellow solid, the crude product of suction filtration, the separated GHS-4 that obtains of silica gel column chromatography.Yield 42%.TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.35； 1H?NMR(400MHz,DMSO-d 6):δ12.95(s,1H),9.63(s,1H),8.40(s,1H),7.38(d,J＝8.8Hz,2H),6.82(d,J＝8.4Hz,2H),6.67(d,J＝2.0Hz,1H),6.41(d,J＝2.0Hz,1H),5.78-5.66(m,1H),5.14-5.02(m,2H),4.37(dd,J＝2.73Hz,5.41Hz,2H),4.31(d,J＝2.8Hz,2H),3.14(d,J＝6.8Hz,2H),2.62(s,4H)； 13C?NMR(100MHz,DMSO-d 6):δ180.7,171.7,164.3,162.1,157.8,157.8,154.7,134.8,130.4,122.8,121.3,117.4,115.4,105.9,98.7,93.2,67.0,62.6,34.2,33.9,25.3.MS(EI +):(M+H) +,calcd.for?C 23H 23O 7S 2,475.1；found,475.3.Anal.Calcd?for?C 23H 22O 7S 2:C,58.21；H,4.67；O,23.60.Found:C,58.34；H,4.60；O,23.62.
Embodiment 13
Target compound GHS-5
Method is with embodiment 9, and silica gel column chromatography is separated must GHS-5.Yield 34%.TLC(silica，hexane:acetone，2:1v/v):R f＝0.49； 1H?NMR(400MHz,DMSO-d 6):δ12.94(s,1H),9.57(s,1H),8.38(s,1H),7.87(d,J＝7.2Hz,2H),7.74(s,1H),7.38(d,J＝6.8Hz,2H),7.10(d,J＝7.2Hz,2H),6.82(d,J＝6.8Hz,2H),6.67(s,1H),6.42(s,1H),4.25(dd,J＝4.8Hz,4.8Hz,4H),2.24-2.18(m,2H)； 13C?NMR(100MHz,DMSO-d 6):δ194.0,180.8,170.4,164.8,162.2,162.0,157.9,157.9,154.8,130.6,128.7,124.9,123.0,121.5,116.5,115.8,105.9,98.9,93.3,65.7,65.1,28.7；HRMS(EI):(M-H) -calcd.for?C 27H 19O 6S 3,535.0344；found,535.0350.
Embodiment 14
Target compound GHS-6
TBZ (0.15, g, 1mmol), G-4 (0.39g, 1mmol), salt of wormwood (0.14g, 1mmol).Method is with embodiment 10, and silica gel column chromatography is separated must GHS-6.Yield 42%.TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.48； 1H?NMR(400MHz,DMSO-d 6):δ12.95(s,1H),9.63(s,1H),8.40(s,1H),7.76(d,J＝8.8Hz,2H),7.38(d,J＝8.8Hz,2H),7.12(d,J＝8.8Hz,2H),6.81(d,J＝8.4Hz,2H),6.67(d,J＝2.0Hz,1H),6.41(d,J＝2.4Hz,1H),4.26-4.20(m,4H),2.23-2.17(m,2H)； 13C?NMR(100MHz,DMSO-d 6):δ180.7,164.7,162.2,162.0,157.8,154.7,134.5,130.4,122.8,119.4,115.9,115.3,105.8,104.8,103.1,98.7,93.1,65.4,65.0,28.4；MS(EI +):(M+H) +,calcd.for?C 25H 22NO 6S,464.1；found,464.7.Anal.Calcd?for?C 25H 21NO 6S:C,64.78；H,4.57；O,20.71.Found:C,64.83；H,4.50；O,20.65.
Embodiment 15
Target compound GHS-8
ACS81 (0.18g, 1mmol), G-4 (0.39g, 1mmol) and salt of wormwood (0.14g, 1mmol) add dry DMF 20mL, and stirring and dissolving is kept away the lower 60 ℃ of reaction 6h of dark condition.After reaction finishes, in reaction solution, add distilled water, separate out light yellow solid, suction filtration, filter cake vacuum drying, the separated GHS-8 that obtains of silica gel column chromatography.Yield 31%.TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.41； 1H?NMR(400MHz,DMSO-d 6):δ12.96(s,1H),9.60(s,1H),8.40(s,1H),7.40(d,J＝8.6Hz,2H),6.84(d,J＝8.6Hz,2H),6.65(t,J＝2.3Hz,1H),6.40(d,J＝2.0Hz,1H),5.68-5.86(m,1H),5.04-5.16(m,2H),4.20(m,4H),3.16(d,J＝7.2Hz,1H),2.86-2.98(m,1H),2.74(d,J＝6.0Hz,1H),2.67-2.58(m,2H),2.56-2.46(m,1H),2.09(m,2H)； 13C?NMR(100MHz,DMSO-d 6):δ180.7,171.7,165.7,164.6,162.0,157.7,154.6,134.8,131.9,130.4,128.5,122.8,121.3,117.4,115.3,105.7,98.6,93.1,65.6,61.3,34.3,33.9,33.0,28.1.
Embodiment 16
Target compound GHS-9
ADT-Br (0.33g, 1mmol), G-2 (0.32g, 1mmol) and salt of wormwood (0.138g, 1mmol), add dry DMF 20mL, stirring and dissolving, 60 ℃ of reaction 6h.After reaction finishes, in reaction solution, add distilled water, separate out safran solid, suction filtration, obtains crude product, the separated GHS-9 that obtains of silica gel column chromatography.Yield 25%.TLC(silica，hexane:EtOAc，2:1v/v):R f＝0.39； 1H?NMR(400MHz,DMSO-d 6):δ12.92(s,1H),9.59(s,1H),8.35(d,J＝1.2Hz,1H),7.85(d,J＝8.8Hz,2H),7.74(s,1H),7.36(d,J＝8.8Hz,2H),7.05(dd,J＝3.2Hz,2.4Hz,2H),6.79-6.82(m,2H),6.64(d,J＝2.4Hz,1H),6.42(d,J＝2.0Hz,1H),5.01(s,2H),4.52(dd,J＝3.2Hz,2.8Hz,2H),4.26-4.31(m,2H)； 13C?NMR(100MHz,DMSO-d 6):δ215.2,180.8,174.1,168.5,163.8,162.1,161.9,157.9,157.7,154.8,134.7,130.5,129.4,124.4,122.9,121.3,115.9,115.5,106.2,98.9,93.5,66.6,65.4,63.4；MS(EI +):(M+H) +,calcd.for?C 28H 21O 8S 3,581.0；found,581.3.Anal.Calcd?for?C 28H 20O 8S 3:C,57.92；H,3.47；O,22.04.Found:C,57.83；H,3.40；N,22.12.
Embodiment 17
Target compound LHS-1
Luteolin (0.286g, l mmol), glycol dibromide (0.42mL, 5mmol) and salt of wormwood (0.11g, 0.8mmol) are dissolved in 15mL dry DMF, ultrasonic reaction 2h under 70 ℃ of conditions.After having reacted, reaction mixture cool to room temperature, adds a large amount of distilled water, separates out yellow-green colour solid, suction filtration, and vacuum-drying, obtains L-1, productive rate 45%.
L-1 (0.312g, l mmol), glycol dibromide (0.21mL, 2.5mmol), salt of wormwood (0.14g, 1.0mmol) is dissolved in 10mL dry DMF, ultrasonic reaction 4h under 50 ℃ of conditions.After having reacted, reaction mixture cool to room temperature, adds a large amount of distilled water, separates out large green solid, suction filtration, and vacuum-drying, obtains L-2, productive rate 59%.
ADT-OH (0.23g, 1mmol), L-2 (0.418g, 1mmol) and salt of wormwood (0.14g, 1mmol), add dry DMF 20mL, stirring and dissolving, 60 ℃ of reaction 8h.After reaction finishes, in reaction solution, add distilled water, separate out brown solid, suction filtration obtains crude product, the separated LHS-1 that obtains of silica gel column chromatography.TLC(silica，hexane:EtOAc，3:1v/v):R f＝0.34； 1H?NMR(400MHz,DMSO-d 6):δ12.96(s,1H),9.60(s,2H),7.82(s,1H),7.80(s,1H),7.70(s,1H),7.39(dd,J＝2.0Hz,2.4Hz,1H),7.09-7.05(m,2H),6.82(d,J＝8.4Hz,2H),6.60(t,J＝2.4Hz,1H),6.37(d,J＝2.0Hz,1H),4.98(d,J＝5.6Hz,2H),4.51-4.48(m,2H),4.29(d,J＝4.0Hz,2H)； 13C?NMR(100MHz,DMSO-d 6):δ215.3,180.9,174.1,164.6,162.3,162.1,157.9,157.9,154.9,130.0,129.5,124.4,123.0,121.5,116.1,115.5,106.1,98.9,67.6,67.0.
Embodiment 18
Target compound CHS-9
Chrysin (1.02g, 4mmol), adds fully stirring and dissolving of anhydrous propanone 50mL and ethyl bromoacetate (1.33ml, 12mmol), and Anhydrous potassium carbonate (0.55g, 4mmol) adds in three batches, under 40 ℃ of ultrasound conditions, reacts 8h.After reaction finishes, reaction mixture is cooled to room temperature, filters, and filtrate decompression is concentrated, obtains yellow solid C-1.Yield 63%.
C-1 (1.7g, 5mmol), adds water 50mL, methyl alcohol 50mL and salt of wormwood (0.69g, 5mmol), under 40 ℃ of ultrasound conditions, reacts 3h.After reaction finishes, reaction solution concentrating under reduced pressure, filters, and filtrate is acidified to pH1-2 with 1mol/L dilute hydrochloric acid, separates out immediately white precipitate C-2.Yield 75%.
ADT-Br (0.33g, 1mmol), C-2 (0.31g, 1mmol) and salt of wormwood (0.138g, 1mmol), add dry DMF 20mL, stirring and dissolving, 60 ℃ of reaction 4h.After reaction finishes, in reaction solution, add distilled water, separate out safran solid, suction filtration, obtains crude product, the separated CHS-9 that obtains of silica gel column chromatography.Yield 37%.TLC(silica，hexane:EtOAc，3:1v/v):R f＝0.43； 1H?NMR(400MHz,DMSO-d 6):δ12.92(s,1H),8.35(d,J＝1.2Hz,1H),7.85(d,J＝8.8Hz,2H),7.74(s,1H),7.36(d,J＝8.8Hz,2H),6.79-6.82(m,3H),6.64(d,J＝2.4Hz,1H),6.42(d,J＝2.0Hz,1H),4.52(dd,J＝3.2Hz,2.8Hz,2H),4.26-4.31(m,2H)； 13C?NMR(100MHz,DMSO-d 6):δ215.2,180.8,174.1,168.5,163.8,162.1,161.9,157.9,157.7,134.7,130.5,124.4,122.9,121.3,115.9,115.5,106.2,98.9,93.5,66.6,65.4,63.4.
Embodiment 19
Target compound AHS -17
Apigenin (0.27g, l mmol), glycol dibromide (3.4mL, 40mmol) and salt of wormwood (0.28g, 2mmol) are dissolved in 30mL dry DMF, ultrasonic reaction 12h under 40 ℃ of conditions.After having reacted, reaction mixture cool to room temperature, adds 5% sodium bicarbonate washing, separates out light yellow solid, suction filtration, filter cake petroleum ether, vacuum-drying.Productive rate 82%.
ADT-OH (0.69g, 3mmol), A-3 (0.482g, 1mmol) and salt of wormwood (0.28g, 2mmol) add dry DMF 20mL, stirring and dissolving, 60 ℃ of reaction 8h.After reaction finishes, in reaction solution, add distilled water, separate out safran solid, suction filtration obtains crude product, the separated AHS-17 that obtains of silica gel column chromatography.Yield 32%. 1H?NMR(400MHz,DMSO-d 6):δ12.96(s,1H),7.89(d,J＝8.8Hz,2H),7.77(s,1H),7.39(d,J＝8.4Hz,4H),6.82(d,J＝8.4Hz,4H),6.73(d,J＝2.0Hz,2H),6.47(d,J＝2.0Hz,1H),4.44-4.49(m,4H)； 13C?NMR(100MHz,DMSO-d 6):δ215.3,180.9,174.1,164.6,162.3,162.1,157.9,157.9,154.9,130.0,129.6,129.5,128.6,125.3,124.4,124.2,123.0,122.6,121.5,121.1,116.1,116.0115.5,114.2106.1,105.998.9,97.867.6,67.2,67.0,66.2.
Biology embodiment
Adopt following experiment differentiation to there are those compounds of the required activity of optimum extent.
The improvement effect of embodiment 1 compound to lipopolysaccharide-induced BV2 microglia inflammation
1 reagent and instrument
RPMI1640 substratum (RPMI1640+10% calf serum or foetal calf serum+HEPES3.5g/l+NaHCO 32.0g/l+ penicillin 0.13g/l+ Streptomycin sulphate 0.15g/l); ELISA test kit; Trypsinase; Lipopolysaccharides.
CO 2incubator, aseptic operating platform, microplate reader, whizzer, liquid-transfering gun, transfer pipet, centrifuge tube and 96 orifice plates etc.
The cultivation of 2 BV2 microglias
The separated BV2 cell of EDTA-trypsin digestion, with 5 * 10 4the density of individual/mL is inoculated in cell culture fluid, at 37 ℃, and 5%CO 2condition under cultivate.
3 groupings and administration are processed
Get BV2 microglia, be divided at random control group (control), model group (LPS, 500ng/mL), target compound (GHS-1, GHS-2, GHS-3, GHS-4, GHS-5, GHS-6, GHS-8, GHS-9)+LPS group (500ng/mL).Establish 4-6 multiple hole for every group.Each concentration administration group and BV2 cell are hatched 2h, add afterwards LPS to hatch 24h.
4 ELISA methods are measured the expression of BV2 microglia inflammatory factor
(1) grouping as stated above, each concentration administration group and BV2 cell are hatched 2h, add afterwards LPS (500ng/mL) to hatch 24h.Collect respectively the cell conditioned medium in every orifice plate, the centrifugal 10min of 1000rpm, carefully draws supernatant, and-80 ℃ of Refrigerator stores give over to the sample of ELISA.
(2) before experiment, 20min takes out test kit from refrigerator, and balance is to room temperature (20-25 ℃).
(3) Criterion curve: prepare 8 EP pipes, every pipe adds sample diluting liquid 900 μ L, and the first pipe adds standard substance 100 μ L, mixes the rear pipettor sucking-off 500 μ L that use, and moves to the second pipe, so repeatedly opposes and is doubly diluted to the 8th pipe.
(4) application of sample: Zhong Mei hole, product to be tested hole adds testing sample (cell conditioned medium) 100 μ L, follows every hole and adds corresponding antibody, is placed in room temperature on shaking table (22-25 ℃) and hatches 2h, shaking table speed ≈ 500rpm.
(5) wash plate: by Sptting plate washing 3 times, at every turn dry to printing on filter paper with wash buffer.
(6) in every hole, add substrate working fluid 100 μ L, room temperature (22-25 ℃) lucifuge is placed 45min.
(7) in every hole, add 50 μ L stop buffers, measure rapidly.
(8) microplate reader is surveyed absorbancy, calculates the content of inflammatory factor.
5 experimental results
With LPS (500ng/mL), stimulate BV2 microglia, in-vitro simulated neural inflammatory model, measures by ELISA method inflammatory factor TNF-α and the IL-1 β level that BV2 microglia secretes, and carries out extracorporeal anti-inflammatory screening active ingredients and comparison.Compare with control group, the level of LPS group inflammatory factor (TNF-α and IL-1 β) significantly increases, and illustrates that LPS can cause that the secretion of the BV2 cellular inflammation factor increases; Compare with LPS group, target compound GHS-1, GHS-2, GHS-3, GHS-4, GHS-5, GHS-6, GHS-8and GHS-9 all can significantly suppress TNF-α and IL-1 β level, illustrate that above-claimed cpd all has good anti-inflammatory activity; Wherein, GHS-2 can return to normal level by TNF-α and IL-1 β, illustrates that GHS-2 is the compound that anti-inflammatory activity is the highest.Refer to Fig. 1 and Fig. 2.
The improvement effect of embodiment 2 compound GHS-2 to the lipopolysaccharide-induced neural inflammation of mouse intracerebroventricular injection
1 animal rearing
Healthy Kunming kind bull mouse, body weight 20-25g, provides (animal credit number: SYXK (Soviet Union) 2007-0037) by Xuzhou Medical College's Experimental Animal Center.Animal agreement used is ratified by Xuzhou Medical College's animal care and the use council, and the experimentation on animals of carrying out meets Chinese law in nursing and uses the regulation of laboratory animal.Experiment makes animal adapt to experimental situation the last week, is placed in lower minute cage group support of nature diel rhythm illumination condition, and temperature is (22 ± 2) ℃, and humidity is 50 ± 10%, the drinking-water of freely ingesting.
2 reagent and instrument
Ibuprofen BP/EP, lipopolysaccharides, agarose, cDNA the first chain synthetic agent box, PCR test kit, ELISA test kit; PCR instrument, gel images treatment system, microplate reader, water maze tracing analysis system.
3 laboratory animal groupings
1) normal group (control, n=18): continuous 14d abdominal injection 5%DMSO;
2) sham operated rats (sham, n=18): after 3d abdominal injection 5%DMSO, intracerebroventricular injection stroke-physiological saline solution 3 μ L, all the other are with control group;
3) model group (LPS, n=18): after 3d abdominal injection 5%DMSO, intracerebroventricular injection LPS3 μ L, all the other are with control group;
4) sham-operation administration group (GHS-2, n=18): continuous 14d abdominal injection GHS-237 μ mol/kg, after 3d abdominal injection GHS-2, intracerebroventricular injection stroke-physiological saline solution 3 μ L;
5) positive controls (Ibuprofen BP/EP, IBU, n=18): continuous 14d abdominal injection IBU97 μ mol/kg, after 3d abdominal injection IBU, intracerebroventricular injection LPS3 μ L;
6) genistein control group (Genistein, n=18): 14d abdominal injection gives Genistein37 μ mol/kg continuously, after 3d abdominal injection Genistein, intracerebroventricular injection LPS3 μ L;
7) GHS-2 high dose group (GHS-2high, n=18): 14d abdominal injection gives GHS-218 μ mol/kg continuously, after 3d abdominal injection GHS-2, intracerebroventricular injection LPS3 μ L;
8) GHS-2 low dose group (GHS-2low, n=18): 14d abdominal injection gives GHS-237 μ mol/kg continuously, after 3d abdominal injection GHS-2, intracerebroventricular injection LPS3 μ L.
The preparation of 4 animal models
With hand, mouse head is fixed, with the microsyringe of 10 μ l, between mouse two ear lines and eyes line, slightly departing from the skull bone position of center, syringe is vertically thrust to about 3mm (fixing at needle point with plastic casing in advance).Slowly injection, the time of injection is 10s, volume is 3 μ l, let the acupuncture needle remain at a certain point 30s.2 mouse intracerebroventricular injection methylenum coeruleum 3 μ l are randomly drawed in each experiment, after 10min, broken end is got brain, the equal viewable side ventricles of the brain of crown section, third ventricle, aqueduct of midbrain and fourth ventricle all have indigo plant to dye, but it is shallow that color subtracts successively, the degree of depth that methylenum coeruleum disperse enters surrouding brain tissue also shoals gradually, proves that intracerebroventricular injection position is correct.
5 Morris water maze laboratories
Adopt the ability of learning and memory of Morris determined with Morris water mouse.Water maze diameter is 120cm, the round pool of high 60cm, depth of water 15.5cm.At place, third quadrant center, placing a diameter is 14cm, the circular platform of high 14cm, and platform is lower than water surface 1.5cm.Water temperature remains on 25 ± 2 ℃.Mouse is accepted continuously the training of 4 days, every day 4 times, records respectively mouse and from the different place of entry of four quadrants, enters water and find required time of platform, i.e. latent period.4 preclinical mean value as the same day the final result enter last statistics.If mouse is not found platform in 90s, mouse should be put on platform, make its learning and memory, count in such cases 90s latent period.
Within the 5th day, remove platform, carry out space exploration test, observe the activity in the inherent pond of mouse 90s, record mouse arrive the latent period of platform, at the number of times of target quadrant per-cent residence time and spanning platform.When carrying out water maze laboratory, also should regularly give mouse peritoneal administration.
6 RT-PCR measure the mRNA level of GFAP, CD11b, TNF-α and IL-1 β in hippocampus of mice
The extraction of 6.1 total RNA
Every group of hippocampus 50mg that gets at random 3 mouse, adds the Trizol of 1mL, carries out homogenized in ice bath; Homogenate, room temperature is placed 5min, thoroughly decomposes nucleoprotein complex body; By 0.2mL chloroform/1mL Trizol, add chloroform, cover tightly lid; Firmly rock centrifuge tube 15s, room temperature is placed 2～3min; 4 ℃, the centrifugal 15min of 12000g, mixture is separated into the red phenol-chloroform layer in bottom, middle layer and colourless water sample upper strata, RNA is in the water sample of upper strata; Draw upper strata water sample to centrifuge tube, avoid any organic layer and boundary layer to bring water into; The Virahol that adds 0.5mL100%, room temperature is placed 10min; 4 ℃, the centrifugal 10min of 12000g, abandons supernatant, leaves pipe end RNA; The ethanol (3:1 adds nuclease free water) that adds 1mL75%, after simple vortex, 4 ℃, the centrifugal 5min of 7500g, abandons supernatant; Room temperature super clean bench inner drying 10min; Every pipe adds 30 μ L nuclease free waters to dissolve RNA, hatches 10～15min for 55～60 ℃; Measure RNA concentration, packing ,-80 ℃ of preservations.
6.2 reverse transcription reaction
According to calculating, every pipe adds quantitative RNA; Every pipe adds 2 μ L oligo (dT) 15, the ultrapure dNTP of 2 μ L, mends RNase-free ddH 2o to 14.5 μ L; 70 ℃ heating 5min after rapidly at cooled on ice 2min; Add 4 μ L5 * First-stand Buffer+0.5 μ L RNasin+1 μ L Tian script M-MLV to mix; 42 ℃ of temperature are bathed 50min; 95 ℃ of heating 5min, termination reaction, is placed in and carries out subsequent experimental or-20 ℃ of preservations on ice.
6.3PCR amplification
TNF-α upstream and downstream primer sequence is: upstream: 5 '-TCTCATCAGTTCTATGGCCC-3 '; Downstream: 5 '-GGGAGTAGACAAGGTACAAC-3 ', amplification length is 212bp.IL-1 β upstream and downstream primer sequence is: upstream: 5 '-TTGACGGACCCCAAAAGATG-3 '; Downstream: 5 '-AGAAGGTGCTCATGTCCTCA-3 ', amplification length is 204bp.CD11b upstream and downstream primer sequence is: upstream: 5 '-CAGATCAACAATGTGACCGTATGGG-3 '; Downstream: 5 '-CATCATGTCCTTGTACTGCCGCTTG-3 ', amplification length is 498bp.GFAP upstream and downstream primer sequence is: upstream: 5 '-AAGCAGATGAAGCCACCCTG-3 '; Downstream: 5 '-GTCTGCACGGGAATGGTGAT-3 ', amplification length is 625bp.β-actin upstream and downstream primer sequence is: upstream: 5 ' ATGTCACGCACGATTTCCC3 '; Downstream: 5 ' GAGACCTTCAACACCCCAGC3 ', amplification length is 219bp.Under condition of ice bath, configure reaction system: Template<1 μ g1 μ L, Primer1 (10 μ M) 1 μ L, Primer2 (10 μ M) 1 μ L, 2 * Master Mix12.5 μ L, add ddH 2o complements to 25 μ L.After all reacted constituents are mixed, reaction tubes is put into PCR instrument, carry out respectively the amplification of TNF-α, IL-1 β, CD11b, GFAP and β-actin, reaction conditions is as follows: 94 ℃ of 3min, 94 ℃ of 30s, 59 ℃ of 30s, 72 ℃ of 1min, 72 ℃ of 5min, 30 circulations.
6.4 electrophoresis
The PCR primer of TNF-α, IL-1 β, CD11b, GFAP and β-actin is carried out to electrophoresis in 1.25% sepharose.Deposition condition is 100V, 120min.Under ultraviolet lamp, observe, be placed in gel image analysis software and carry out spectrophotometric analysis, use the relative content of ratio value representation goal gene TNF-α, IL-1 β, CD11b and the GFAP mRNA of TNF-α, IL-1 β, CD11b and the absorbancy of GFAP and the absorbancy of β-actin.
7 experimental results
7.1 water maze laboratory results
Adopt Morris water maze laboratory to detect the ability of learning and memory of respectively organizing mouse, in the orientation navigation experiment of 5 days, the average latency of each group is decline (Fig. 3 A) to some extent all, sham operated rats is compared no significant difference (P>0.05) with the latent period of normal group, illustrate that the execution of operation does not affect the ability of learning and memory of normal mouse; Compare with sham operated rats, the latent period of sham-operation administration group (GHS-2high) is no significant difference (P>0.05) also, and prompting GHS-2 does not affect the ability of learning and memory of sham operated rats mouse; From second day, compare with sham operated rats, significantly increase the latent period of model group (P<0.05); From the 3rd day, compare with model group, significantly reduce the latent period of GHS-2 high dose group (P<0.05), the 4th day and the 5th day, significantly shorten the latent period of GHS-2 high dose group (P<0.01).Second day to the four days, compare with model group, have no obvious shortening the latent period of Ibuprofen BP/EP group (P>0.05) and genistein group (P>0.05), until the 5th day, be just significantly shorter than model group the latent period of Ibuprofen BP/EP group (P<0.01) and genistein group (P<0.05).Illustrate that GHS-2 can obviously reduce the latent period of model mice, and its effect is better than Ibuprofen BP/EP and genistein.
In target study experiment, model group mouse is compared and all significantly reduces (P<0.05) compared with sham operated rats at the number of times (Fig. 3 D) of target percentage of time that quadrant is treated (Fig. 3 C) and spanning platform, illustrates that intracerebroventricular injection LPS has caused the decline of ability of learning and memory in mice; Compare with model group, Ibuprofen BP/EP group (P<0.01), genistein group (P<0.05), GHS-2 high dose group (P<0.001) and GHS-2 low dose group (P<0.05) all can significantly increase mouse at the number of times of target percentage of time that quadrant is treated and spanning platform.The These parameters of GHS-2 high dose group is significantly higher than Ibuprofen BP/EP group (P<0.05) and genistein group (P<0.01); Compare with sham operated rats, the These parameters of GHS-2 high dose group is without significant difference (P>0.05).These results suggest that genistein, GHS-2 and Ibuprofen BP/EP have some improvement to the equal tool of decline of the ability of learning and memory in mice of LPS induction, the improvement effect of GHS-2 high dosage is the most obvious, is better than genistein and Ibuprofen BP/EP.
In the test of five days, the equal not statistically significant of swimming rate (P>0.05) of each group.Illustrate that the mobility of each treated animal does not affect the latent period of each treated animal, time for the treatment of at target quadrant than and the number of times (Fig. 3 B) of spanning platform.
The impact of 7.2 GHS-2 on CD11b and GFAP mRNA in the neural inflammation hippocampus of mice of LPS induction
GFAP is the characteristic albumen of the astroglia cell of activation; CD11b is up-regulated in the microglia of activating.This research, by detecting the level of CD11b and GFAP mRNA, is investigated the impact (Fig. 4 and Fig. 5) of GHS-2 on microglia and astroglia cell in the neural inflammation hippocampus of mice of LPS induction.
Compare with normal group, the level of sham operated rats CD11b mRNA and GFAP mRNA has no obvious rising (P>0.05), illustrates that the execution of performing the operation does not cause the abnormal activation of the interior microglia of hippocampus and astroglia cell.Compare with sham operated rats, give the variation (P>0.05) that obvious CD11b mRNA and GFAP mRNA level do not appear in sham operated rats mouse high dosage GHS-2 yet, illustrate that GHS-2 can excessive activation microglia and astroglia cell.Compare with sham operated rats, the level of model group CD11b mRNA and GFAP mRNA obviously raises (P<0.001), illustrates that intracerebroventricular injection LPS can cause the abnormal activation of spongiocyte.Compare with model group, Ibuprofen BP/EP group (P<0.001, P<0.01), genistein group (P<0.01, P<0.05), GHS-2 high dose group (P<0.001, P<0.001) and GHS-2 low dose group (P<0.001, P<0.01) can effectively reduce CD11b mRNA and GFAP mRNA level.Wherein, with genistein group, Ibuprofen BP/EP group, the comparison of GHS-2 low dose group, GHS-2 high dose group CD11b mRNA (P<0.01, P<0.01, P<0.05) and GFAP mRNA (P<0.05, P<0.05) level minimum (Fig. 4, Fig. 5), returns to normal level substantially.These results suggest that, GHS-2 can suppress the abnormal activation of the caused microglia of LPS and astroglia cell, and its restraining effect is better than genistein and Ibuprofen BP/EP.
The impact of 7.3 GHS-2 on TNF-α mRNA and IL-1 β mRNA in the neural inflammation hippocampus of mice of LPS induction
This research, by detecting inflammatory factor TNF-α mRNA and IL-1 β mRNA level, is investigated the impact of GHS-2 on the neural inflammation of LPS induction.Compare with normal group mouse, sham operated rats TNF-α mRNA and IL-1 β mRNA level have no obvious rising (P>0.05), and the execution of prompting operation does not cause obvious inflammatory reaction.Compare with sham operated rats, the GHS-2 that gives sham operated rats mouse high dosage does not affect the variation (P>0.05) of TNF-α mRNA and IL-1 β mRNA level.Compare with sham operated rats, model group TNF-α mRNA (P<0.001) and IL-1 β mRNA (P<0.001) level amount significantly increase, and the intracerebroventricular injection LPS reaction that causes inflammation is described; And compare with model group, Ibuprofen BP/EP group (P<0.001), genistein group (P<0.01), GHS-2 high dose group (P<0.001) and GHS-2 low dose group (P<0.05) can effectively reduce TNF-α mRNA level; Compare with model group, Ibuprofen BP/EP group (P<0.05) and GHS-2 high dose group (P<0.001) can effectively reduce IL-1 β mRNA level.Wherein, compare with genistein group with Ibuprofen BP/EP, GHS-2 high dose group TNF-α mRNA (P<0.05, P<0.01) and IL-1 β mRNA (P<0.05, P<0.01) level significantly reduces, substantially return to normal level (Fig. 6, Fig. 7).These results suggest that, GHS-2 can effectively reduce inflammatory factor TNF-α mRNA and IL-1 β mRNA level, thus the effect of performance anti-neuritis disease, and its anti-inflammatory action is better than Ibuprofen BP/EP and genistein.
7.4 the impact of GHS-2 on TNF-α and IL-1 β level in the neural inflammation hippocampus of mice of LPS induction
The demonstration of ELISA result, consistent with mRNA index, TNF-α and IL-1 β that the execution of operation and GHS-2 do not affect in sham operated rats hippocampus express variation.Compare with model group, Ibuprofen BP/EP group (P<0.001), genistein group (P<0.01), GHS-2 high dose group (P<0.001) and GHS-2 low dose group (P<0.05) can effectively reduce TNF-alpha levels; Wherein, compare with genistein group (P<0.01) with Ibuprofen BP/EP group (P<0.05), GHS-2 high dose group TNF-α significantly reduces (Fig. 8).
Except genistein group and GHS-2 low dose group, Ibuprofen BP/EP group (P<0.05) and GHS-2 high dosage (P<0.001) group all can effectively reduce IL-1 β level.Wherein, the IL-1 β level of GHS-2 high dose group is minimum, substantially return to normal level, and compare and all have statistical significance (Fig. 9) with genistein group (P<0.05) with Ibuprofen BP/EP group (P<0.05).These results suggest that, GHS-2 can significantly reduce the excessive generation of TNF-α and IL-1 β, and its anti-neuritis disease effect is better than genistein and Ibuprofen BP/EP.
8 experiment conclusion
Experiment in vitro result shows: prepared compound can significantly reduce the excessive release of lipopolysaccharide-induced proinflammatory factor, has anti-neuritis disease scorching active.In body, experimental result shows: prepared compound GHS-2 can suppress the abnormal activation of microglia and astroglia cell, reduces the excessive generation of inflammatory factor, improves the ability of learning and memory of neural inflammation mouse.Above-mentioned these compounds have good anti-inflammatory activity, can be applicable to the treatment of neural inflammation related disease.

Claims (10)

1. compound or its pharmacy acceptable salt of formula (I) structure:
Wherein:
A ring is flavonoid structure;
R is hydrogen sulfide donor group;
L is linking group, comprises the connection chain of 2-15 atom;
M is 1～5 integer.
2. compound according to claim 1 or its pharmacy acceptable salt, is characterized in that
A kind of in following radicals of A ring:
Osajin group: genistein, Dai, 6-methoxy Dai, neochanin or puerarin;
Flavonoid group: luteolin, chrysin, apigenin, scutellarin, Vitexin, isorientin, table orientin, blue grey Liu Su, acacetin or remove methoxy andrographin;
Flavonols group: 3-hydroxyflavone, azaleatin, Zante Fustic, norizalpinin, gossypetin, kaempferide or Isorhamnetol;
Chalcones group: isoliquiritigenin, Corylifolinin, 2-hydroxy-benzalacetophenone, 4-hydroxy-benzalacetophenone or Bavachalcone;
R group is selected from:
Linking group L is
or
Wherein X is O or S; Y is O, S or N; N is the integer of 1-5.
3. the compound shown in formula (II) or its pharmacy acceptable salt,
In formula,
R 5for substituted-phenyl, substituted benzoyl or saturated or unsaturated hydrocarbons sulfenyl, described substituting group is selected from, 1,2-dithiole-3-thioketones base, 1,2-dithiole-3-thioketones formyl radical, amino thioformyl or 1,2-dithiolane base;
X is O or S;
Z is-OC (=O)-,-C (=O) O-or covalent linkage;
Y is O or S;
P or q are respectively 1～4 integer independently;
R 6for substituted or non-substituted phenyl, its substituting group be hydroxyl, alkoxyl group or-Y-(CH 2) q-Z-(CH 2) p-X-R 5, or two adjacent substituting groups are connected and form oxygen heterocyclic ring with together with carbon atom on phenyl ring.
4. compound according to claim 3 or its pharmacy acceptable salt, is characterized in that this compound is formula (III) or formula (IV) compound,
In formula,
R 7for one or more hydroxyls or C 1～4alkoxyl group;
R 8for hydrogen, one or more C 1～4alkoxyl group or-Y-(CH 2) q-Z-(CH 2) p-X-R 5, or R 8with the phenyl ring being attached thereto, jointly form benzodioxane group.
5. according to the compound described in claim 3 or 4 or its pharmacy acceptable salt, it is characterized in that
R 5for substituted-phenyl or C 1～6saturated or unsaturated hydrocarbons sulfenyl, described substituting group is selected from 1,2-dithiole-3-thioketones base, 1,2-dithiole-3-thioketones formyl radical, amino thioformyl or 1,2-dithiolane base;
X is O or S;
Z is-OC (=O)-,-C (=O) O-or covalent linkage;
Y is O;
P or q are respectively 1～3 integer independently.
6. according to the compound described in claim 3 or 4 or its pharmacy acceptable salt, it is characterized in that
R 5for substituted-phenyl or C 2～4saturated or unsaturated hydrocarbons sulfenyl, described substituting group is selected from 1,2-dithiole-3-thioketones base, amino thioformyl or 1,2-dithiolane base; And when X is O, R 5for substituted-phenyl, when X is S, R 5for C2～4 are saturated or unsaturated hydrocarbons sulfenyl;
P or q are respectively 1～3 integer independently.
7. compound according to claim 4 or its pharmacy acceptable salt, is characterized in that
R 5be 1,2-dithiole-3-thioketones base phenyl, amino thioformyl phenyl or allyl group sulfenyl; And when X is O, R 5be 1,2-dithiole-3-thioketones base phenyl or amino thioformyl phenyl, when X is S, R 5for allyl group sulfenyl;
R 7for one or more hydroxyls;
R 8for hydrogen or-Y-(CH 2) q-Z-(CH 2) p-X-R 5, or R 8form benzodioxane group with phenyl ring.
8. compound according to claim 3 or its pharmacy acceptable salt, is characterized in that described compound is selected from
9. a pharmaceutical composition, is characterized in that it is activeconstituents or main active ingredient that said composition be take the compound described in claim 1 or 3 or its pharmacy acceptable salt, is aided with pharmaceutically acceptable auxiliary material and makes.
10. the compound described in claim 1 or 3 or its pharmacy acceptable salt application aspect preparation treatment inflammation related disease medicine, this disease is neural inflammation related disease particularly, comprises alzheimer's disease or Parkinson's disease class central nervous system disease.
CN201410279942.8A 2014-06-22 2014-06-22 Flavonoid structure based hydrogen sulfide donor derivative and application in treatment of neuroinflammation related diseases thereof Pending CN104109145A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410279942.8A CN104109145A (en) 2014-06-22 2014-06-22 Flavonoid structure based hydrogen sulfide donor derivative and application in treatment of neuroinflammation related diseases thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410279942.8A CN104109145A (en) 2014-06-22 2014-06-22 Flavonoid structure based hydrogen sulfide donor derivative and application in treatment of neuroinflammation related diseases thereof

Publications (1)

Publication Number Publication Date
CN104109145A true CN104109145A (en) 2014-10-22

Family

ID=51706156

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410279942.8A Pending CN104109145A (en) 2014-06-22 2014-06-22 Flavonoid structure based hydrogen sulfide donor derivative and application in treatment of neuroinflammation related diseases thereof

Country Status (1)

Country Link
CN (1) CN104109145A (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106008440A (en) * 2016-05-26 2016-10-12 淮海工学院 Genistein 7-O-sodium acetate and preparation method thereof
CN106176801A (en) * 2015-05-06 2016-12-07 复旦大学 Hydrogen sulfide purposes in struvite anemia medicine is treated in preparation
CN106243182A (en) * 2016-07-29 2016-12-21 广西师范大学 Enoxolone hydrogen sulfide donor reagent derivatives and synthetic method thereof and application
CN107375268A (en) * 2017-09-21 2017-11-24 上海华堇生物技术有限责任公司 The medicinal usage of azaleatin
CN105753674B (en) * 2015-12-22 2018-01-30 上海市奉贤区中心医院 A kind of feather cockscomb element, its preparation method and its application
WO2019051548A1 (en) * 2017-09-15 2019-03-21 Norbio No. 2 Pty Ltd Treatment of neuro-inflammation
CN110314156A (en) * 2018-03-28 2019-10-11 中国医学科学院药物研究所 Hundred can application of the benefit in preparation prevention and treatment central neurotransmitter disorder and the product that trembles
CN111096972A (en) * 2020-02-25 2020-05-05 成都医学院 Pharmaceutical composition for preventing and/or treating Alzheimer's disease
CN112745284A (en) * 2020-12-28 2021-05-04 四川大学华西医院 Natural chalcone derivative and preparation method and application thereof
CN113292548A (en) * 2021-05-21 2021-08-24 湖北工业大学 Preparation of quercetin-conjugated hydrogen sulfide donor and application of quercetin-conjugated hydrogen sulfide donor in treatment of diabetes and wound healing
US11491134B2 (en) 2019-06-20 2022-11-08 Industrial Technology Research Institute Composition for inhibiting skin cell proliferation and/or anti-inflammation method for inhibiting skin cell proliferation and/or anti-inflammation and method for treating skin diseases and/or inflammatory diseases

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106176801A (en) * 2015-05-06 2016-12-07 复旦大学 Hydrogen sulfide purposes in struvite anemia medicine is treated in preparation
CN106176801B (en) * 2015-05-06 2020-06-09 复旦大学 Application of hydrogen sulfide in preparation of medicine for treating inflammatory anemia
CN105753674B (en) * 2015-12-22 2018-01-30 上海市奉贤区中心医院 A kind of feather cockscomb element, its preparation method and its application
CN106008440A (en) * 2016-05-26 2016-10-12 淮海工学院 Genistein 7-O-sodium acetate and preparation method thereof
CN106243182A (en) * 2016-07-29 2016-12-21 广西师范大学 Enoxolone hydrogen sulfide donor reagent derivatives and synthetic method thereof and application
CN106243182B (en) * 2016-07-29 2018-11-23 广西师范大学 Enoxolone-hydrogen sulfide donor reagent derivatives and its synthetic method and application
WO2019051548A1 (en) * 2017-09-15 2019-03-21 Norbio No. 2 Pty Ltd Treatment of neuro-inflammation
CN107375268A (en) * 2017-09-21 2017-11-24 上海华堇生物技术有限责任公司 The medicinal usage of azaleatin
CN110314156A (en) * 2018-03-28 2019-10-11 中国医学科学院药物研究所 Hundred can application of the benefit in preparation prevention and treatment central neurotransmitter disorder and the product that trembles
US11491134B2 (en) 2019-06-20 2022-11-08 Industrial Technology Research Institute Composition for inhibiting skin cell proliferation and/or anti-inflammation method for inhibiting skin cell proliferation and/or anti-inflammation and method for treating skin diseases and/or inflammatory diseases
CN111096972A (en) * 2020-02-25 2020-05-05 成都医学院 Pharmaceutical composition for preventing and/or treating Alzheimer's disease
CN112745284A (en) * 2020-12-28 2021-05-04 四川大学华西医院 Natural chalcone derivative and preparation method and application thereof
CN112745284B (en) * 2020-12-28 2022-04-26 四川大学华西医院 Natural chalcone derivative and preparation method and application thereof
CN113292548A (en) * 2021-05-21 2021-08-24 湖北工业大学 Preparation of quercetin-conjugated hydrogen sulfide donor and application of quercetin-conjugated hydrogen sulfide donor in treatment of diabetes and wound healing
CN113292548B (en) * 2021-05-21 2022-04-15 湖北工业大学 Preparation of quercetin-conjugated hydrogen sulfide donor and application of quercetin-conjugated hydrogen sulfide donor in treatment of diabetes and wound healing

Similar Documents

Publication Publication Date Title
CN104109145A (en) Flavonoid structure based hydrogen sulfide donor derivative and application in treatment of neuroinflammation related diseases thereof
CN102234259B (en) Sphaelactone derivatives, their pharmaceutical compositions, preparation method thereof and application thereof
CN103087984B (en) A kind of have the Chinese medicine composition and application thereof that promote mescenchymal stem cell proliferation function
CN101947215A (en) Application of flavonoid compound in tangerine peel to preparation of medicament for inhibiting angiogenesis
CN105849111A (en) Pyranochromenyl phenol derivative, and pharmaceutical composition for treating metabolic syndrome or inflammatory disease
CN104161749A (en) Application of polymethoxyflavone and its derivatives in prevention and treatment of low SIRT6 level related diseases
CN105687185B (en) The method of the disease of invasion fiber type tumor disease and beta-catenin mediation is treated using nefopam compound
Wei et al. Triterpenoids as bivalent and dual inhibitors of acetylcholinesterase/butyrylcholinesterase from the fruiting bodies of Inonotus obliquus
CN101805246B (en) Urushiol compound and medicinal composition thereof, preparation method and application thereof
Yan et al. Effects of vestibular damage on the sleep and expression level of orexin in the hypothalamus of rats and its correlation with autophagy and Akt tumor signal pathway
CN102675228B (en) Medicine for treating ischemic brain injury stroke and sequela of ischemic brain injury stroke and preparation method for medicine
CN105193795B (en) Application of two kinds of halophenol compounds in terms of angiogenesispromoting effect
CN106963755A (en) Application of the pinocembrin in demyelinating disease medicine is prepared
CN113768921A (en) Application of methoxy flavonoid compound in preparing anti-leucoderma medicament
RU2613189C1 (en) Agent increasing anti-metastatic activity of cyclophosphan
CN113521078A (en) Aged cell killing agent and application thereof
CN106619605A (en) Medicinal application of corylin
CN104248635B (en) Protopine Alkaloid is used for the application suppressed in the medicine of P gp in preparation
CN105837538A (en) Use of tanshinone IIA derivatives in preparation of drug for protecting endothelial cells
CN102274237B (en) Novel application of flavonoid compound
CN113694055B (en) Application of agalloch eaglewood tetrol in preparing medicine for treating vascular dementia
CN104829679B (en) A kind of water-soluble celastrin derivative and application thereof
Fernandes et al. Pedunculagin and tellimagrandin-I stimulate inflammation and angiogenesis and upregulate vascular endothelial growth factor and tumor necrosis factor-alpha in vivo
CN109928986A (en) 1-O- acetyl inula Britannica lactone spiral shell aryl isoxazoline derivative and its medical usage
CN109172548A (en) Lutein and its derivative are preparing the application in anti-glioma drug

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20141022