CN104099308B - One kind having the active polypeptide of aspartokinase and its application - Google Patents

Abstract

The invention discloses one kind to have the active polypeptide of aspartokinase III, and the 342nd isoleucine residues of aspartic acid kinases III are replaced by alanine residue.Overexpression saltant type aspartokinase of the invention can be improved lysine production.This provides more more options to optimize the biosynthesis of lysine, helps to construct Strains for Lysine Production or improves lysine production.

Description

One kind having the active polypeptide of aspartokinase and its application

Technical field

The invention belongs to genetic engineering fields, specifically, the present invention relates to one kind to have aspartokinase active Polypeptide and its application.

Background technique

Amino acid is widely used in feed addition, food, nutriment and drug.In recent years, global amino acid annual output reaches To millions of tons.The wherein amino acid of aspartate family is used widely such as lysine, threonine.Aspartic acid race ammonia Base acid can be produced by microbial fermentation, and the microorganism used mainly includes Corynebacterium glutamicum or Escherichia coli.

Biosynthesis of the aspartate family amino acid in Escherichia coli is needed by a series of biochemical reaction steps.Its In a vital step, it is by aspartokinase enzymatic that aspartic acid, which becomes β-phosphoaspartate,.In large intestine In bacillus, there are three types of isodynamic enzymes for aspartokinase: aspartokinase I, II and III.Aspartokinase I and II are double function Energy enzyme, they are provided simultaneously with homoserine dehydrogenase activity.Aspartokinase I is encoded by thrA gene, activity by The inhibition of threonine, its expression inhibited by threonine and isoleucine (F.Falcoz-Kelly et al. (1969), Eur.J.Biochem.8:146-152).Aspartokinase II is encoded by metL gene, its expression is by methionine Inhibit (J.C.Patte et al. (1967), Biochim.Biophys.Acta.136:245-257).Aspartokinase III It is to be encoded by lysC gene, its activity and expression is all inhibited (Truffa-Bachi et al. by lysine (1968), Eur.J.Biochem.5:73-80).

The Escherichia coli aspartokinase III gene sequence of wild type is as shown in SEQ ID NO:2.Aspartokinase III is received significant attention in the production for preparing lysine and threonine with fermentation method.Overexpression aspartokinase III, Including wild type and saltant type, have very great help to lysine production is improved.It is helped to improve for example, US5661012 is reported The saltant type of following several amino acid sites of lysine production: 318,323,325,345,347,349.But it finds more, more Effective aspartokinase is still highly important.

Summary of the invention

The invention discloses the mutational sites of the aspartokinase III different from published mutational site.Inventor To Escherichia coli aspartokinase III(SEQ ID NO:1) Ile342 amino acid sites carried out amino acid replacement, obtain The aspartokinase III of saltant type.

Specifically, the invention discloses a kind of active polypeptide with aspartokinase III, this kind of polypeptide includes Amino acid sequence SEQ ID NO:1, or the polypeptide fragment or homeopeptide of the sequence with same enzymatic activity, and be equivalent to There is amino acid replacement mutation at Ile342 amino acid sites in SEQ ID NO:1 sequence.In the work for retaining aspartokinase Under the premise of property, amino acid residue at above-mentioned mutational site can be with any natural or non-natural amino acids or amino acids seemingly Object substitution.

Because the aspartokinase of saltant type will be applied to lysine or threonine produces, mutation cannot seriously drop The activity of low aspartokinase.Polypeptide provided in the present invention at least partly possesses day shown in SEQ ID NO:1 sequence The activity of aspartic acid kinases.

Certain specific amino acid are not limited to for replace original amino acid residue at above-mentioned site.Arbitrary protein ammonia Base acid or non-protein amino acid may serve to replace original amino acid residue at above-mentioned site.In some embodiments, on The original acid residue of rheme point it is natural by other, Argine Monohydrochloride replaces.Other Argine Monohydrochlorides being previously mentioned, refer to 22 amino acid in addition to isoleucine (Ile) found in natural polypeptides molecule, i.e. alanine (Ala), leucine (Leu), asparagine (Asn), lysine (Lys), aspartic acid (Asp), methionine (Met), cysteine (Cys), benzene Alanine (Phe), glutamic acid (Glu), threonine (Thr), glutamine (Gln), tryptophan (Trp), glycine (Gly), figured silk fabrics Propylhomoserin (Val), proline (Pro), serine (Ser), tyrosine (Tyr), arginine (Arg), histidine (His), seleno half Cystine, selenomethionine, pyrrolysine.It is L- amino for displaced amino acid in some preferred embodiments Acid.

In other embodiments, it can be non-protein ammonia for replace original amino acid residue at mutational site Base acid, that is, the amino acid being not present in natural polypeptides.Non-protein amino acid includes: alpha-Aminoadipic acid, beta-amino adipic acid, Butyrine, α-aminoacid, Beta-alanine, 4-Aminobutanoicacid, 5- aminovaleric acid, 6-aminocaprolc acid, 8- aminocaprylic acid, 9 aminononanoic acid, 10- aminocapric acid, 12 amino dodecanoic acid, alpha-amido suberic acid, β-Cyclohexylalanine, citrulling take off Hydrogen alanine, α-Cyclohexylglycine, propargylglycine, pyroglutamic acid, 4- para-benzoylphenylalanine, δ-hydroxylysine, 4- Hydroxyproline, alloisoleucine, lanthionine (Lan), nor-leucine, norvaline, ornithine, phenylglycine, nipecotic acid, Sarcosine, 1,2,3,4- tetrahydroisoquinoline -3- carboxylic acid, allothreonine, thiazolidine -4- carboxylic acid, γ-aminobutyric acid (GABA) are different Cysteine, diaminopropionic acid, 2,4-diamino-butanoic, 3,4- diaminobutyric acids, biphenylalanine, 4- fluorophenylalanine etc..

Non-protein amino acid further includes the derivative of Argine Monohydrochloride, for example, homomethionine, homoserine, high dried meat ammonia Acid, high threonine, high tryptophan, high tyrosine, high histidine, high-lysine etc..

In some embodiments, aspartokinase shown in SEQ ID NO:1 sequence is at 342 amino acid sites by such as Lower amino acid replacement: Ala, Leu, Asn, Lys, Asp, Met, Cys, Phe, Glu, Thr, Gln, Trp, Gly, Val, Pro, Ser, Tyr, Arg or His.

In a preferred embodiment, the amino acid residue at 342 sites of aspartokinase is replaced by Ala.

It should be pointed out that the sequence of aspartokinase of the present invention is not limited solely to shown in SEQ ID NO:1 Sequence.With SEQ ID NO:1 with sequence homology and with same enzymatic activity polypeptide sequence all of the present invention In the range of aspartokinase is covered.For example, the present disclosure applies equally to derive from other microorganism kinds or other large intestines The aspartokinase of bacillus strain.

There is the polypeptide sequence of sequence homology with SEQ ID NO:1, SEQ can be equivalent to disclosed in except the present invention Occur compared with SEQ ID NO:1 sequence at one or more amino acid sites other than 342 mutational sites of ID NO:1 sequence Amino acid replacement, amino acid deletion or insertion.Also, for homologous polypeptide sequence, at least partly retaining aspartokinase Under the premise of enzymatic activity, amino acid replacement, amino acid deletion or insertion can also be carried out at other amino acid sites.Usually come Say, retain aspartokinase it is active under the premise of, arbitrary amino acid site in SEQ ID NO:1 sequence in addition to 342, It can be carried out amino acid replacement.In some embodiments, 1,2,3,5,10,20,30,40,50 in SEQ ID NO:1 sequence A amino acid sites have all carried out amino acid replacement.In some embodiments, 50,60,70 in SEQ ID NO:1 sequence, 80,90,100 amino acid sites, have all carried out amino acid replacement.

Polypeptide containing one or more amino acid insertions compared with SEQ ID NO:1 sequence is considered as SEQ ID NO:1 sequence The homologous sequence of column.Amino acid insertion can occur in any site of SEQ ID NO:1 sequence.Similarly, with SEQ ID NO:1 sequence compares the homologous sequence that the polypeptide containing one or more amino acid deletions is considered as SEQ ID NO:1 sequence.Amino Acid deletion can occur in any site in addition to 342 of SEQ ID NO:1 sequence.

The homologous sequence of SEQ ID NO:1 sequence has at least 75%, 80%, 85%, 90%, 95%, 99% and SEQ ID NO:1 sequence It arranges identical.Sequence alignment uses method well known in the art or computer software.

The invention also includes comprising being equivalent to 342 amino acid mutation sites in SEQ ID NO:1 sequence, there is aspartic acid One segment of the SEQ ID NO:1 sequence of kinase activity and the homeopeptide of the polypeptide fragment.It is above-mentioned to have asparagus fern ammonia The polypeptide fragment of kinase activity, with SEQ ID NO:1 sequence or its homologous sequence the difference is that, the end N- and/ Or there are one or more amino acid deletions in the end C-.For example, under the premise of at least partly reservation aspartokinase is active, The segment of SEQ ID NO:1 sequence can have 5 in the end N- and/or the end C-, and 10,15,20,30,40, or 50 amino acid deletions.Similarly, under the premise of at least partly reservation aspartokinase is active, SEQ ID NO:1 sequence The segment of homologous sequence can have 5,10,15,20,30,40 or 50 in the end N- and/or the end C- Amino acid deletions.

The invention also discloses one section of polynucleotides, and one section of coding is of the present invention aspartokinase enzymatic activity Polypeptide, the polypeptide include have at 342 amino acid sites amino acid sequence shown in the SEQ ID NO:1 of amino acid replacement, Polypeptide fragment or their homologous sequence with the active sequence of aspartokinase.For example, polynucleotide can have Just like sequence shown in SEQ ID NO:2, wherein the codon of coding Ile342 amino acid sites is modified, to cause above-mentioned Amino acid replacement at site.The invention also includes as used different degenerate codon and caused by with above-mentioned sequence not Same polynucleotide sequence, and polypeptide that carried out coding optimization for different hosts, that coding is same or homologous The polynucleotide sequence of sequence.

The invention also discloses an expression vector, which includes one section of polynucleotide sequence, and the sequence is compiled The polypeptide fragment of the code aspartokinase of the present invention for having enzymatic activity or aspartokinase and theirs is homologous Polypeptide.Expression vector refers to a polynucleotide construction, is generally made of DNA molecular, and it is more to can be realized carrier the preceding paragraph The gene transfer of polynucleotide, the duplication in host cell and gene expression.The polynucleotide is relative to host cell Can be it is heterologous, be also possible to it is homologous but by modification.The duplication of expression vector can be by being integrated into host cell base It is replicated because being replicated in group, or by episomal vector (such as plasmid).Episomal vector has can be in host cell The duplication subsequence of middle self-replacation.

The expression vector used in the method disclosed in the present, can be high copy number plasmid, to realize in host The purpose that high-level aspartokinase is expressed in cell, is also possible to the plasmid of middle copy number or low copy number.Expression vector The general marker gene with for screening transformant.Usually used marker gene is antiviral antibiotic gene, such as anti-ammonia benzyl The gene of penicillin, kanamycins or tetracycline.The selection of marker gene can determine according to host cell and carrier used It is fixed.

Expression vector of the present invention is that by the carrier of polynucleotide expression of the present invention.Usually come It says, expression vector includes the adjusting sequence to work to the polynucleotide sequence being intended by, such as promoter and enhancer. Promoter in expression vector can be composing type, be also possible to induction type.Adjusting sequence can be according to host used Bacterium, expected polypeptide expression level etc. are selected.In some embodiments, constructed expression vector is used in prokaryotes Aspartokinase is expressed in cell.In a preferred embodiment, constructed expression vector in bacterium for expressing asparagus fern Histidine kinase, such as Escherichia coli or Corynebacterium glutamicum.

Expression vector of the present invention further includes that can be realized aspartokinase of the present invention to merge egg The carrier of white form expression.Fusion protein refers to comprising at least two sections disjunct polypeptide or polypeptide fragments under native state Hybrid protein.The expression vector of expressed fusion protein increases by one section of ammonia in the end N- of polypeptide to be expressed or the end C- Base acid sequence.Increased amino acid sequence may but be not limited to provide following effect, such as enhancing aspartokinase in place Expression in chief cell, or be conducive to the purifying of aspartokinase.

The invention also discloses the host cells comprising the polynucleotide or expression vector.A variety of different hosts are thin Born of the same parents can be used for expressing aspartokinase of the present invention.Eukaryotic cells (such as yeast or zooblast) and protokaryon Biological cell may be used to recombinantly express aspartokinase of the present invention.The preferred prokaryote of host.It is preferred that Bacterium is as host.For example, host can be the bacterium of following kind: escherichia coli, Serratieae, brevibacterium is rodlike Bacillus etc..It is preferred that Escherichia coli are as host strain.The coli strain that can be used for lysine and threonine production includes K- 12, JM109, GT3 etc..

Host strain for fermenting and producing lysine can contain complete L-lysine biosynthesis pathway, can be independent Produce lysine.For example, the wild-type e. coli of the gene order containing coding SEQ ID NO:1 polypeptide may be used as host Bacterium.But it is extremely low using wild-type strain production lysine production.Coding asparagus fern of the present invention is converted into above-mentioned host strain The polynucleotide of histidine kinase saltant type can significantly improve the yield of lysine.In addition, host strain can also not include day Aspartic acid kinases III gene, or not comprising active aspartokinase III gene.It is converted into this host strain Polynucleotide of the present invention can make recombinant bacterium the production lysine, threonine of building.

The host cell that the present invention is previously mentioned may include other gene mutation, bases for being conducive to improve lysine production Because of deletion or gene insertion, and the modification to Gene expression and regulation sequence.Such as some enzymes in Bio-synthetic pathway of lysine Mutation and central metabolic pathway in some enzymes mutation.Such as dihydrodipicolinic acid synthase (SEQ ID NO:3), it is urged Change the dehydration condensation of aspartic-β-semialdehyde and pyruvic acid, this is aspartate family amino acid biosynthetic pathway point Branch is first exclusive enzyme of Bio-synthetic pathway of lysine.The enzyme is encoded by dapA gene (SEQ ID NO:4), its activity Also inhibited (Blickling, S.and Knablein, J. (1997) Biol.Chem.378:207-10) by lysine. EP0733710 refers to 2 kinds of saltant types for helping to improve the dihydrodipicolinic acid synthase of lysine production.

Expression vector can be selected according to host cell used.For example, being suitable for the expression vector of Escherichia coli It include: pBluescript serial carrier, pUC serial carrier (such as pUC18, pUC19, pBR322, pBR329, pQE70, pQE60, PQE-9, pNH8A, pNH16A, pNH18A, pNH46A, ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5, PLG338, pKC30, pHSG299, pHSG399, pRep4, pACYC177, pACYC184, pRSF1010, pBW22 etc.).It is suitable for The expression vector of Corynebacterium glutamicum includes: Escherichia coli/Corynebacterium glutamicum shuttle carrier (such as pEC-XT99A, pEC- XC99E, pET-XK99E etc.).There are also some other expression vectors are available, such as Kirchner et al., 2003, J.Biotechnol., 104:287-299, and " Cloning Vectors " (Pouwels et al. (eds.) Elsevier, Amsterdam New York Oxford, 1985) carrier stated in.Expression vector can be turned with any suitable method Change into host cell, such as Maniatis et al. is in Molecular Cloning, A laboratory Manual (1982, Cold Spring Harbor Laboratory) certain methods described in a book, such as: electricity turns, microinjection, particle gun, Or chemical transformation (such as calcium phosphate method).

The invention also discloses a kind of methods for producing L-lysine or L-threonine, comprising: (i) in suitable culture medium In and cultivate host cell as described above under proper culture conditions, expression has the active polypeptide of aspartokinase, should Polypeptide is made of SEQ ID NO:1 sequence, or by SEQ ID NO:1 sequence fragment or its homeopeptide with same enzymatic activity Composition, and have mutation at the Ile342 amino acid sites for being equivalent to SEQ ID NO:1 sequence；(ii) mentioned from above-mentioned culture solution Take L-lysine or L-threonine.

The culture medium utilized must be appropriate for the needs of particular host cell.Utilizable carbon source is sugar and carbon hydrate Object, such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose；Oil & fat, such as soybean oil, to Day, certain herbaceous plants with big flowers was oily, and peanut oil and coconut are fatty；Fatty acid, such as palmitinic acid, stearic acid and linoleic acid；Alcohol, such as glycerol and ethyl alcohol；With And organic acid, such as acetic acid.These substances can be used alone or as a mixture.Utilizable nitrogen source is nitrogen-containing organic compound, Such as peptone, yeast extract, meat extract, malt extract, corn pulp, soy meal and urea；Or inorganic compound, such as ammonium sulfate, chlorine Change ammonium, ammonium phosphate, ammonium carbonate and ammonium nitrate.Nitrogen source can be used alone or as a mixture.Phosphorus source can be potassium dihydrogen phosphate or phosphoric acid Hydrogen dipotassium or corresponding sodium salt.Culture medium can also contain metal salt, such as magnesium sulfate or ferric sulfate.Finally, except mentioned above Substance outside, required growth promoting substance such as amino acid and vitamin can be added.Described additive can once or in batches It is added in culture medium.

Cultivating host cell of the present invention can be using the fermentation process generally used.For example, cell can carry out Batch culture, fed-batch culture, or continuous culture.Cultural method is in Encyclopedia of Bioprocess Technology–Fermentation,Biocatalysis,and Bioseparation,Volumes1-5,Flickinger, M.C., Drew, S.W. (eds.) have comprehensive description in mono- book of 1999John Wiley&Sons..Cultivation temperature can be 20 °C To 42 °C, preferably 30 °C to 40 °C, preferably 30 °C to 37 °C.The pH of culture medium can be 5.0 to 9.0, preferably 6.0 to 8.0, example Such as 7.0.Incubation time can from several hours to several days.For example, if incubation time can be 12h and arrive using batch culture 36h；If incubation time can be up to 21 days or longer using continuous culture.

Product (L-lysine or L-threonine) is extracted from culture solution can use well known method, such as The method of ion exchange resin is used described in US5342766.

It is disclosed in this invention by mutation to there is the active polypeptide of aspartokinase or polypeptide fragment to help to mention The biosynthesis yield of high-lysine and threonine.On the basis of the present invention, the gene for amino acids production can be constructed Engineering bacteria, including Corynebacterium glutamicum and Escherichia coli.The host strain of saltant type aspartokinase of the present invention is expressed, L-lysine and L-threonine can be produced in suitable culture medium.

The invention discloses the saltant type of new escherichia coli aspartokinase III, mutational site with reported The saltant type in road is different.Overexpression saltant type aspartokinase of the invention can be improved lysine production.This is optimization The biosynthesis of lysine provides more more options, helps to construct Strains for Lysine Production or improves lysine production.

Detailed description of the invention

Fig. 1 is aspartokinase and/or dihydrodipicolinic acid synthase's expression plasmid structure chart.

Specific embodiment

Biological deposits information

Escherichia coli (Escherichia coli) CAT lys1303 is according to " Budapest agreement " March 22 in 2013 Day is deposited in China typical culture collection center (CCTCC), address Wuhan, China, Wuhan University, deposit number CCTCC NO:M2013100.

Embodiment 1: the clone of wild-type e. coli aspartokinase III gene (lysC) and the building of expression plasmid

Using e. coli bl21 (Beijing Bo Maide Biotechnology Co., Ltd), genomic DNA is template, with primer 1:AG GAGTTAATGAATGTCTGAAATTGTTGTCTC(SEQ ID NO:5) and primer 2: ACTGAAAGCTTTTACTCAAACAAATTACTAT(SEQ ID NO:6) it is primer, carry out PCR reaction.

PCR reacts to obtain about 1.4kb DNA product.The Purified in electrophoresis PCR product, even with pMD18-T carrier (TaKaRa) It connects.Connection product is transformed into e. coli jm109 (Beijing Bo Maide Biotechnology Co., Ltd).Bacterium colony is done to transformant PCR examines direction of the lysC gene in plasmid, and the primer is primer 3:GAGTTAGCTCACTCATTAGG(SEQ ID NO: And primer 2 (SEQ ID NO:6) 7).If lysC gene is consistent with lac promoter direction on carrier, about 1.4kb can be generated PCR product.The consistent plasmid in lac promoter direction on lysC gene and carrier is selected, pUC-lysC is named as.

Embodiment 2: the building of saltant type lysC gene and the building of expression plasmid

Using pUC-lysC as template, with primer 1(SEQ ID NO:5) and primer 4:GTCTACCGAAATATTATGCC(SEQ ID NO:8) it is primer, expand lysC genetic fragment I(about 1kb)；With primer 2 (SEQ ID NO:6) and primer 5:GGCATAAT ATTTCGGTAGACTTAGCCACCACGTCAGAAGTGAGC(SEQ ID NO:9) it is primer, amplification lysC genetic fragment II(is about 0.3kb).

Two PCR products of Purified in electrophoresis.With equimolar amounts mixing lysC genetic fragment I and II, as template, with primer 1 (SEQ ID NO:5) and primer 2 (SEQ ID NO:6) are primer, carry out over-lap PCR.PCR reaction solution volume is 50 μ l, ingredient It is as follows:

LysC segment I and II: each 0.05pmole

Primer: each 50pmole

TaKaRaTaq DNA Polymerase(TaKaRa): 2.5U

10 × PCR Buffer:5 μ l

DNTPs: every kind 10nmole

Over-lap PCR reacts to obtain the product of an about 1.4kb.Purified in electrophoresis PCR product, with pMD18-T carrier (TaKaRa) it connects.Connection product is transformed into e. coli jm109.Being bacterium colony PCR to transformant examines lysC gene in matter Direction in grain, the primer are primer 3(SEQ ID NO:7) and primer 2 (SEQ ID NO:6).It selects lysC gene and carries The consistent plasmid in lac promoter direction on body with universal primer M13F(-47) and M13R(-48) is sequenced, and confirmation is encoding There is preset Ile → Ala to be mutated at 342 site of amino acid residue.The plasmid is named as pUC-lysC342(Figure 1A).

Embodiment 3: the clone of wild type dihydrodipicolinic acid synthase (dapA)

Using e. coli bl21 genomic DNA as template, with primer 6:ACTGAAAGCTTAGGAGGTAATGAATGTTCA CGGGAAGTATTGT(SEQ ID NO:10) and primer 7:ACTGACATAT GTTACAGCAA ACCGGCATGC(SEQ ID NO:11) it is primer, carries out PCR reaction.

PCR reacts to obtain about 0.9kb DNA product.The Purified in electrophoresis PCR product, connect with pMD18-T carrier.It will connection Product is transformed into e. coli jm109.It is bacterium colony PCR to transformant to examine, the primer is primer 3(SEQ ID NO:7) and Primer 6(SEQ ID NO:10) or primer 3(SEQ ID NO:7) and primer 7(SEQ ID NO:11).Any no matter drawn using group Object can generate the PCR product of about 0.9kb if the success of dapA gene is connected with carrier.The plasmid containing dapA gene is selected, It is named as pUC-dapA.It should be appreciated by those skilled in the art dapA gene is relative to lac promoter may there are two types of connections Direction.Any one direction can meet the needs of the present embodiment and embodiment 4.

Embodiment 4: the building of saltant type dapA gene

Using pUC-dapA as template, with primer 8:GACCGGCGCTAACGTTACTGCGGAAGCC(SEQ ID NO:12) be Primer carries out direct mutagenesis PCR.PCR reaction solution volume is 50 μ l, and ingredient is as follows:

PUC-dapA plasmid: 100ng

Primer 8:50pmole

The Beijing Pfu DNA Polymerase(Bo Maide Biotechnology Co., Ltd): 5U

Taq DNA Ligase(NEB): 40U

10 × Pfu Buffer:4 μ l

10 × Taq DNA Ligase Buffer:5 μ l

DNTPs: every kind 10nmole

PCR reaction condition is as follows:

94 °C, 5min

94 °C, 1min(circulation starts)

55 °C, 1min

65 °C, 8min(30 circulation)

65 °C, 10min

10U DpnI(NEB is added into PCR reaction solution), in 37 °C of reaction 1h.Take 10 μ l digestions treated PCR reaction Liquid converts e. coli jm109.

The plasmid for extracting multiple transformants with universal primer M13F(-47) and M13R(-48) is sequenced, and dapA is examined Whether encode in gene has expected Ala → Val to be mutated at 81 site of amino acid residue.The plasmid name of mutation will be successfully introduced into For pUC-dapA81(Figure 1B).

The building of embodiment 5:LysC342/DapA81 coexpression vector

With HindIII and NdeI digestion pUC-dapA81 plasmid, the DNA fragmentation (about 1kb) for having dapA gene is obtained；With Same digestion pUC-lysC342 plasmid, obtains the DNA fragmentation (about 4kb) for having lysC gene and plasmid backbone part.By two Connection product, is transformed into e. coli jm109 (Fig. 1) by segment connection.

Bacterium colony PCR is carried out to transformant with primer 1(SEQ ID NO:5) and primer 7(SEQ ID NO:11).If dapA Gene is successfully connected with lysC gene, can generate the PCR product of about 2.2kb.The plasmid of connection chosen successfully, is named as pUC- LysC342-dapA81(Fig. 1 C).

Embodiment 6: lysine is produced with the host strain containing saltant type aspartokinase

Plasmid pUC-lysC, pUC-lysC342 and pUC-lysC342-dapA81 are transformed into Escherichia coli K- respectively 12substr.MG1655(DSM-18039).Obtained bacterial strain MG1655/pUC-lysC, MG1655/pUC-lysC342(is i.e. big Enterobacteria CAT lys1303, deposit number CCTCC M2013100) and MG1655/pUC-lysC342-dapA81 be inoculated in kind In sub- culture solution, in 30 °C of culture 12h.Seed bacterium solution is inoculated in fermentation culture with 2.0% inoculum concentration.In 30 °C of culture 2h, 1mM IPTG is added, continues to cultivate 36h.

Wherein, contain in seed culture fluid (100mL):

Sucrose: 0.32g；

Ammonium sulfate: 0.55g；

Yeast powder: 0.3g；

Peptone: 0.6g；

Potassium dihydrogen phosphate: 0.3g；

Magnesium sulfate: 0.01g；

Ferrous sulfate: 0.01g；

Isoleucine: 0.004g；

Vitamin B1: 0.003g.

Wherein, contain in fermentation culture (100mL):

Glucose: 14g；

Sucrose: 1g；

Ammonium sulfate: 3.3g；

Potassium dihydrogen phosphate: 0.42g；

Magnesium sulfate: 0.05g；

Ferrous sulfate: 0.01g；

Corn pulp: 1.6g；

Isoleucine: 0.02g；

Niacinamide: 1.0mg；

Vitamin B1: 3.0mg；

Calcium carbonate: 2.8g.

The measuring method (colorimetric method) of lysine concentration is as follows:

Fermenation raw liquid is diluted to about 30mg/dl lysine hydrochloric acid salinity, the liquid 1mL after taking dilution is placed in 25mL Drying test tube in；It takes 30mg/dl lysine hydrochloride standard solution and distilled water 1mL respectively again, is respectively placed in different do In dry test tube；1mL ninhydrin solution is added in each test tube (being separately added into prepare liquid, titer, blank water) respectively；It is mixed After closing uniformly, test tube is sealed with aluminium foil；Above each test tube is placed in 100 DEG C of boiling water baths and is heated, self-boiled water boiling plays meter When 10 minutes；After reaction, test tube is taken out, is placed in cold water after cooling, accurate 8mL distilled water of drawing is in each test tube respectively In, it mixes；Then, the light absorption value of 475nm is measured on spectrophotometer.Blank sample is using the liquid of blank test test tube as ginseng According to, standard curve of the gained light absorption value according to ninhydrin, the concentration of the lysine after fermentation liquid dilution can be calculated.According to dilute Degree of releasing obtains lysine hydrochloric acid salinity in fermenation raw liquid.

After fermentation shake flask culture 36h, after measured, acid yield is as shown in table 1.

Table 1, lysine production measurement result

Bacterium numbering	Lysine g/L
		MG1655	0.8
MG1655/pUC-lysC	24.5±3.1
		MG1655/pUC-lysC342	40.2±3.4
pUC-lysC342-dapA81	54.6±3.6

Seen from table 1, saltant type aspartokinase of the invention is subjected to overexpression, can be improved in Escherichia coli The yield of lysine.Method of the invention provides more more options to optimize the biosynthesis of lysine, helps to construct bad ammonia Acid production bacterial strain improves lysine production.

It will be apparent to one skilled in the art that under the premise of without departing substantially from scope and spirit of the present invention, it can It is carry out various modifications and is changed, the combination between above-mentioned items technical characteristic and other skills for being completed according to above content Art scheme, which changes, belongs to the scope of the invention.

Claims (8)

1. one kind has the active polypeptide of aspartokinase III, which is characterized in that

The 342nd isoleucine residues of aspartokinase III are replaced by alanine residue.

2. polypeptide according to claim 1, which is characterized in that the aspartokinase III has such as SEQ ID NO:1 Shown in amino acid sequence.

3. a kind of polynucleotide, which is characterized in that the polymerized nucleoside acid encoding is for example of any of claims 1-2 Polypeptide.

4. a kind of expression vector, which is characterized in that include polynucleotide as claimed in claim 3.

5. a kind of host cell, which is characterized in that comprising polynucleotide as claimed in claim 3 or such as claim 4 institute The expression vector stated.

6. host cell according to claim 5, which is characterized in that the host cell is bacterium.

7. host cell according to claim 6, which is characterized in that the bacterium is Escherichia coli, deposit number CCTCC M2013100。

8. application of the host cell in production lysine as described in any one of claim 5-7.