CN104099308A - Polypeptide having aspartokinase activity and use thereof - Google Patents

Abstract

The invention discloses a polypeptide having aspartokinase III activity. The 342th isoleucine residue of the aspartokinase III can be replaced by any amino acid residues but isoleucine. Through excess expression of the mutant aspartokinase, a lysine yield can be improved. The polypeptide provides more choices for lysine biosynthesis optimization and is conducive to construction of a lysine production bacterial strain or improvement of a lysine yield.

Description

A kind of polypeptide and application thereof with aspartokinase enzymic activity

Technical field

The invention belongs to genetically engineered field, specifically, the present invention relates to a kind of polypeptide and application thereof with aspartokinase enzymic activity.

Background technology

Amino acid is widely used in feed interpolation, food, nutritious prod and medicine.In recent years, global amino acid annual production reaches millions of tons.Wherein the amino acid of aspartate family, as Methionin, Threonine, is used widely.Aspartic acid family amino acid can be fermented and be produced by microorganism, and the microorganism of use mainly comprises Corynebacterium glutamicum or intestinal bacteria.

The biosynthesizing of aspartate family amino acid in intestinal bacteria need to be passed through a series of biochemical reaction steps.A vital step wherein, aspartic acid becomes β-phosphoaspartate, by aspartokinase enzyme catalysis.In intestinal bacteria, E.C. 2.7.2.4. has three kinds of isozymes: E.C. 2.7.2.4. I, II and III.E.C. 2.7.2.4. I and II are bifunctional enzymes, and they possess homoserine dehydrogenase activity simultaneously.E.C. 2.7.2.4. I is by thrA genes encoding, and its activity is subject to the inhibition of Threonine, its expression be subject to Threonine and Isoleucine suppress (F.Falcoz-Kelly et al. (1969), Eur.J.Biochem.8:146-152).E.C. 2.7.2.4. II is by metL genes encoding, its expression be subject to methionine(Met) suppress (J.C.Patte et al. (1967), Biochim.Biophys.Acta.136:245-257).E.C. 2.7.2.4. III is by lysC genes encoding, its activity and express the inhibition that is all subject to Methionin (Truffa-Bachi et al. (1968), Eur.J.Biochem.5:73-80).

The intestinal bacteria E.C. 2.7.2.4. III gene order of wild-type is as shown in SEQ ID NO:2.E.C. 2.7.2.4. III is subject to extensive concern in the production of preparing Methionin and Threonine with fermentation method.Overexpression E.C. 2.7.2.4. III, comprises wild-type and saltant type, to improving lysine production, has very great help.For example, US5661012 has reported the saltant type of the following several amino acid sites that contribute to improve lysine production: 318,323,325,345,347,349.But find more, more effective E.C. 2.7.2.4. and remain very important.

Summary of the invention

The invention discloses the mutational site of the E.C. 2.7.2.4. III different from published mutational site.Contriver is to intestinal bacteria E.C. 2.7.2.4. III(SEQ ID NO:1) Ile342 amino acid sites carried out amino-acid substitution, obtain the E.C. 2.7.2.4. III of saltant type.

Particularly, the invention discloses a kind of active polypeptide with E.C. 2.7.2.4. III, this peptide species comprises aminoacid sequence SEQ ID NO:1, or have polypeptide fragment or the homeopeptide of this sequence of same enzymic activity, and there is amino-acid substitution sudden change at the Ile342 amino acid sites place in being equivalent to SEQ ID NO:1 sequence.Retaining under the active prerequisite of E.C. 2.7.2.4., the amino-acid residue of said mutation site can be with natural or alpha-non-natural amino acid or amino acid analogue substitute arbitrarily.

Because the E.C. 2.7.2.4. of saltant type will be applied to Methionin or Threonine is produced, therefore sudden change can not seriously reduce the activity of E.C. 2.7.2.4..The polypeptide providing in the present invention is possessed the activity of the E.C. 2.7.2.4. shown in SEQ ID NO:1 sequence at least in part.

For replacing some the specific amino acid that is not limited to of the original amino-acid residue of above-mentioned site.Arbitrary protein amino acid or non-protein amino acid can be used for replacing the original amino-acid residue of above-mentioned site.In certain embodiments, the original acid residue in above-mentioned site, Argine Monohydrochloride natural by other replaced.Other Argine Monohydrochlorides of mentioning, refer to 22 amino acid except Isoleucine (Ile) of finding in natural polypeptides molecule, be L-Ala (Ala), leucine (Leu), l-asparagine (Asn), Methionin (Lys), aspartic acid (Asp), methionine(Met) (Met), halfcystine (Cys), phenylalanine (Phe), L-glutamic acid (Glu), Threonine (Thr), glutamine (Gln), tryptophane (Trp), glycine (Gly), α-amino-isovaleric acid (Val), proline(Pro) (Pro), Serine (Ser), tyrosine (Tyr), arginine (Arg), Histidine (His), seleno-cysteine, selenomethionine, pyrrolysine.In some preferred embodiments, for the amino acid of replacing, be L-amino acid.

In other embodiment, for what replace that mutational site locates original amino-acid residue, can be non-protein amino acid, be not present in the amino acid in natural polypeptides.Non-protein amino acid comprises: α-aminoadipic acid, beta-amino hexanodioic acid, butyrine, α-aminoacid, Beta-alanine, 4-Aminobutanoicacid, 5-aminovaleric acid, 6-aminocaprolc acid, 8-aminocaprylic acid, 9 aminononanoic acid, the amino capric acid of 10-, 12 amino dodecanoic acid, alpha-amino group suberic acid, β-Cyclohexylalanine, citrulline, dehydroalanine, α-Cyclohexylglycine, PGIY, Pyrrolidonecarboxylic acid, 4-benzophenone L-Ala, δ-hydroxylysine, 4-Hydroxyproline, alloisoleucine, L-lanthionine (Lan), nor-leucine, norvaline, ornithine, phenylglycine, nipecotic acid, sarkosine, 1, 2, 3, 4-tetrahydroisoquinoline-3-carboxylic acid, allothreonine, thiazolidine-4-carboxylic acid, γ-aminobutyric acid (GABA), different halfcystine, diaminopropionic acid, 2, 4-DAB, 3, 4-DAB, biphenylalanine, 4-fluorophenylalanine etc.

Non-protein amino acid also comprises the derivative of Argine Monohydrochloride, for example, and homomethionine, homoserine, high proline(Pro), high threonine, high tryptophan, high tyrosine, high Histidine, high-lysine etc.

In certain embodiments, the E.C. 2.7.2.4. shown in SEQ ID NO:1 sequence is at following amino-acid substitution: the Ala of 342 amino acid sites places quilt, Leu, Asn, Lys, Asp, Met, Cys, Phe, Glu, Thr, Gln, Trp, Gly, Val, Pro, Ser, Tyr, Arg, or His.

In a preferred embodiment, the amino-acid residue of 342 site of E.C. 2.7.2.4. is replaced by Ala.

The sequence that it is pointed out that E.C. 2.7.2.4. of the present invention is not only limited to the sequence shown in SEQ ID NO:1.Have in the scope that peptide sequence sequence homology and that have same enzymic activity all contains at E.C. 2.7.2.4. of the present invention with SEQ ID NO:1.For example, the present invention is equally applicable to derive from the E.C. 2.7.2.4. of other microorganism kind or other coli strain.

There is the peptide sequence of sequence homology with SEQ ID NO:1, can the one or more amino acid sites place 342 mutational sites of the disclosed SEQ of being equivalent to ID NO:1 sequence in the present invention compare with SEQ ID NO:1 sequence and occur that amino-acid substitution, amino acid deletes or insert.And, for the peptide sequence of homology, retaining under the prerequisite of aspartokinase enzymic activity at least partly, also can carry out at other amino acid sites places amino-acid substitution, amino acid deletion or insert.As a rule, retaining under the prerequisite of aspartokinase enzymic activity, the arbitrary amino acid site in SEQ ID NO:1 sequence except 342, can carry out amino-acid substitution.In certain embodiments, 1,2,3,5,10,20,30,40 in SEQ ID NO:1 sequence, 50 amino acid sites, have all carried out amino-acid substitution.In certain embodiments, 50,60,70,80 in SEQ ID NO:1 sequence, 90,100 amino acid sites, have all carried out amino-acid substitution.

Compare with SEQ ID NO:1 sequence the homologous sequence that the polypeptide that contains one or more aminoacid insertion is considered as SEQ ID NO:1 sequence.Aminoacid insertion can occur in any site of SEQ ID NO:1 sequence.Similarly, compare the homologous sequence that the polypeptide that contains one or more amino acid deletions is considered as SEQ ID NO:1 sequence with SEQ ID NO:1 sequence.Amino acid is deleted any site except 342 that can occur in SEQ ID NO:1 sequence.

The homologous sequence of SEQ ID NO:1 sequence has at least 75%, 80%, and 85%, 90%, 95%, 99% is identical with SEQ ID NO:1 sequence.Sequence alignment is used method well known in the art or computer software.

The present invention also comprises comprising and is equivalent to 342 amino acid mutation sites in SEQ ID NO:1 sequence have a fragment of the SEQ ID NO:1 sequence of aspartokinase enzymic activity, and the homeopeptide of described polypeptide fragment.The above-mentioned polypeptide fragment with aspartokinase enzymic activity, is there are one or more aminoacid deletion at N-end and/or C-end with the difference of SEQ ID NO:1 sequence or its homologous sequence.For example, retaining under the prerequisite of aspartokinase enzymic activity at least partly, the fragment of SEQ ID NO:1 sequence can have 5 at N-end and/or C-end, and 10,15,20,30,40, or 50 aminoacid deletion.Similarly, retaining under the prerequisite of aspartokinase enzymic activity at least partly, the fragment of the homologous sequence of SEQ ID NO:1 sequence can have 5 at N-end and/or C-end, and 10,15,20,30,40, or 50 aminoacid deletion.

The invention also discloses one section of polynucleotide, its one section of polypeptide that has aspartokinase enzymic activity of the present invention of encoding, this polypeptide is included in 342 amino acid sites places and has the aminoacid sequence shown in the SEQ ID NO:1 of amino-acid substitution, with the polypeptide fragment of this sequence of aspartokinase enzymic activity, or their homologous sequence.For example, polynucleotide can have the sequence as shown in SEQ ID NO:2, and the codon of the Ile342 amino acid sites of wherein encoding is modified, to cause the amino-acid substitution in above-mentioned site.The present invention also comprises due to the polymerized nucleoside acid sequence different from above-mentioned sequence that has used different degenerate codon to cause, and the polymerized nucleoside acid sequence that has carried out coding peptide sequence that optimize, that encode same or homology for different hosts.

The invention also discloses an expression vector, this carrier comprises one section of polymerized nucleoside acid sequence, the described sequence encoding E.C. 2.7.2.4. that has enzymic activity of the present invention, or the polypeptide fragment of E.C. 2.7.2.4., and their homeopeptide.Expression vector refers to a polynucleotide construction, generally DNA molecular, consists of, and can realize the transgenosis of carrier the preceding paragraph polynucleotide, copying and genetic expression in host cell.Described polynucleotide can be allos with respect to host cell, can be also homology but through modifying.Copying of expression vector can copy by being incorporated in host cell gene group, or copies by episomal vector (as plasmid).Episomal vector is with replicon sequence that can self-replacation in host cell.

The expression vector using in the method disclosed in the present, can be high copy number plasmid, to realize the object of expressing high-level E.C. 2.7.2.4. in host cell, can be also the plasmid of middle copy number or low copy number.The general band of expression vector is useful on the marker gene of screening transformant.Normally used marker gene is antiviral antibiotic gene, for example the gene of anti-penbritin, kantlex or tsiklomitsin.The selection of marker gene can decide according to host cell used and carrier.

Expression vector of the present invention is to realize the carrier that polynucleotide of the present invention is expressed.As a rule, expression vector comprises the adjusting sequence that the polymerized nucleoside acid sequence to wanting to express works, for example promotor and enhanser.Promotor in expression vector can be composing type, can be also induction type.Regulate sequence to select according to the expression of polypeptides level of Host Strains used, expection etc.In certain embodiments, constructed expression vector is for expressing E.C. 2.7.2.4. at prokaryote.In a preferred embodiment, constructed expression vector is used for expressing E.C. 2.7.2.4. on bacterium, for example intestinal bacteria or Corynebacterium glutamicum.

Expression vector of the present invention also comprises can realize the carrier that E.C. 2.7.2.4. of the present invention is expressed with the form of fusion rotein.Fusion rotein refers to the hybrid protein that comprises at least two sections of disjunct polypeptide or polypeptide fragments under native state.The expression vector of expressed fusion protein, increases by one section of aminoacid sequence at the N-of polypeptide to be expressed end or C-end.The aminoacid sequence increasing may but the following effect that provides is provided, for example strengthen the expression of E.C. 2.7.2.4. in host cell, or be conducive to the purifying of E.C. 2.7.2.4..

The invention also discloses the host cell that comprises described polynucleotide or expression vector.Multiple different host cell can be for expressing E.C. 2.7.2.4. of the present invention.Eukaryotic cells (for example yeast or zooblast) and prokaryote may be used to recombinant expressed E.C. 2.7.2.4. of the present invention.The preferred prokaryote of host.Preferred bacterium is as host.For example, host can be the bacterium of following kind: colon bacillus, Serratia, tyrothricin, coryneform bacteria etc.Preferably intestinal bacteria are as Host Strains.Can comprise K-12, JM109, GT3 etc. for the coli strain of Methionin and Threonine production.

Host Strains for fermentative production Methionin can contain complete 1B biosynthetic pathway, can independently produce Methionin.The wild-type e. coli of the gene order that for example, contains coding SEQ ID NO:1 polypeptide can be used as Host Strains.But it is extremely low to use wild type strain to produce lysine production.To the polynucleotide that transforms coding E.C. 2.7.2.4. saltant type of the present invention in above-mentioned Host Strains, can obviously improve the output of Methionin.In addition, Host Strains also can not comprise E.C. 2.7.2.4. III gene, or does not comprise the activated E.C. 2.7.2.4. III of tool gene.In this Host Strains, transform polynucleotide of the present invention, can make the recombinant bacterium building produce Methionin, Threonine.

The host cell that the present invention mentions, can comprise other transgenations that are conducive to improve lysine production, gene elmination or gene and insert, and the modification that genetic expression is regulated to sequence.The for example sudden change of some enzymes in the sudden change of some enzymes and central metabolic pathway in Bio-synthetic pathway of lysine.Dihydrodipicolinic acid synthase (SEQ ID NO:3) for example, the dehydration condensation of its catalysis aspartic-β-semialdehyde and pyruvic acid, this is first exclusive enzyme that aspartate family amino acid biosynthetic pathway branches into Bio-synthetic pathway of lysine.This enzyme is by dapA gene (SEQ ID NO:4) coding, and its activity is also subject to the inhibition (Blickling, S.and Knablein, J. (1997) Biol.Chem.378:207-10) of Methionin.EP0733710 has mentioned 2 kinds of saltant types that contribute to improve the dihydrodipicolinic acid synthase of lysine production.

Expression vector can be selected according to host cell used.For example, be applicable to colibacillary expression vector and comprise: pBluescript serial carrier, pUC serial carrier (as pUC18, pUC19, pBR322, pBR329, pQE70, pQE60, pQE-9, pNH8A, pNH16A, pNH18A, pNH46A, ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5, pLG338, pKC30, pHSG299, pHSG399, pRep4, pACYC177, pACYC184, pRSF1010, pBW22 etc.).The expression vector that is applicable to Corynebacterium glutamicum comprises: intestinal bacteria/Corynebacterium glutamicum shuttle vectors (as pEC-XT99A, pEC-XC99E, pET-XK99E etc.).Also have some other expression vector available, as Kirchner et al., 2003, J.Biotechnol., 104:287-299, the carrier of explaining in " Cloning Vectors " (Pouwels et al. (eds.) Elsevier, Amsterdam New York Oxford, 1985).Expression vector can be transformed into host cell by any applicable method, for example Maniatis et al. is at Molecular Cloning, A laboratory Manual (1982, Cold Spring Harbor Laboratory) certain methods of setting forth in a book, such as: electricity turns, microinjection, particle gun, or chemical transformation (as calcium phosphate method).

The invention also discloses a kind of method of producing 1B or L-threonine, comprise: (i) in suitable substratum and under suitable culture condition, cultivate host cell as above, expression has the polypeptide of aspartokinase enzymic activity, this polypeptide is comprised of SEQ ID NO:1 sequence, or formed by SEQ ID NO:1 sequence fragment or its homeopeptide with same enzymic activity, and there is sudden change at the Ile342 amino acid sites place that is equivalent to SEQ ID NO:1 sequence; (ii) from above-mentioned nutrient solution, extract 1B or L-threonine.

The substratum utilizing must be applicable to the needs of particular host cell.Utilizable carbon source is sugar and carbohydrate, glucose for example, sucrose, lactose, fructose, maltose, molasses, starch and Mierocrystalline cellulose; Oil & fat, soybean oil for example, sunflower oil, peanut oil and coconut fat; Lipid acid, palmitinic acid for example, stearic acid and linolic acid; Alcohol, for example glycerine and ethanol; And organic acid, for example acetic acid.These materials can be used alone or as a mixture.Utilizable nitrogenous source is nitrogen-containing organic compound, as peptone, and yeast extract, meat extract, Fructus Hordei Germinatus extract, corn steep liquor, soyflour and urea; Or mineral compound, as ammonium sulfate, ammonium chloride, ammonium phosphate, volatile salt and ammonium nitrate.Nitrogenous source can be used alone or as a mixture.Phosphorus source can be potassium primary phosphate or dipotassium hydrogen phosphate or corresponding sodium salt.Substratum can also contain metal-salt, for example magnesium sulfate or ferric sulfate.Finally, except above-mentioned material, can add essential growth-promoting substance as amino acid and VITAMIN.Said additive can be once or portion-wise addition in substratum.

Cultivate host cell of the present invention and can adopt the fermentation process generally using.For example, cell can carry out batch culture, fed batch cultivation, or cultured continuously.Cultural method is at Encyclopedia of Bioprocess Technology – Fermentation, Biocatalysis, and Bioseparation, Volumes1-5, Flickinger, M.C., Drew, S.W. (eds.), has comprehensive description in 1999John Wiley & Sons. mono-book.Culture temperature can be 20 ° of C to 42 ° of C, preferably 30 ° of C to 40 ° of C, preferably 30 ° of C to 37 ° of C.The pH of substratum can be 5.0 to 9.0, preferably 6.0 to 8.0, for example 7.0.Incubation time can be from several hours to several days.For example, if adopt batch culture, incubation time can be that 12h is to 36h; If employing cultured continuously, incubation time can reach 21 days or longer.

From nutrient solution, extract product (1B or L-threonine) and can adopt known method, for example the method that makes spent ion exchange resin described in US5342766.

The biosynthesizing output that the polypeptide with aspartokinase enzymic activity through sudden change disclosed in this invention or polypeptide fragment contribute to improve Methionin and Threonine.On basis of the present invention, can build the genetic engineering bacterium for amino acids production, comprise Corynebacterium glutamicum and intestinal bacteria.Express the Host Strains of saltant type E.C. 2.7.2.4. of the present invention, in suitable substratum, can produce 1B and L-threonine.

The saltant type that the invention discloses new colon bacillus E.C. 2.7.2.4. III, its mutational site is different from the saltant type of having reported.Overexpression saltant type aspartokinase of the present invention endonuclease capable improves lysine production.This provides more more options for optimizing the biosynthesizing of Methionin, contributes to build Strains for Lysine Production or improves lysine production.

Accompanying drawing explanation

Fig. 1 is E.C. 2.7.2.4. and/or dihydrodipicolinic acid synthase's expression plasmid structure iron.

Embodiment

Biological preservation information

Intestinal bacteria (Escherichia coli) CAT lys1303 is deposited in Chinese Typical Representative culture collection center (CCTCC) on March 22nd, 2013 according to < < Budapest agreement > >, address Wuhan, China, Wuhan University, deposit number is CCTCC NO:M2013100.

Embodiment 1: the clone of wild-type e. coli E.C. 2.7.2.4. III gene (lysC) and the structure of expression plasmid

E. coli bl21 (Bo Maide bio tech ltd, Beijing) genomic dna of take is template, take primer 1:AGGAGTTAATGAATGTCTGAAATTGTTGTCTC(SEQ ID NO:5) and primer 2: be ACTGAAAGCTTTTACTCAAACAAATTACTAT(SEQ ID NO:6) primer, carry out PCR reaction.

PCR reaction obtains about 1.4kb DNA product.This PCR product of Purified in electrophoresis, is connected with pMD18-T carrier (TaKaRa).Connection product is transformed into e. coli jm109 (Bo Maide bio tech ltd, Beijing).Transformant is done to the direction of bacterium colony PCR check lysC gene in plasmid, and the primer is primer 3:GAGTTAGCTCACTCATTAGG(SEQ ID NO:7) and primer 2 (SEQ ID NO:6).If lysC gene is consistent with lac promotor direction on carrier, can produce the PCR product of about 1.4kb.Select lysC gene and the plasmid that on carrier, lac promotor direction is consistent, called after pUC-lysC.

Embodiment 2: the structure of saltant type lysC gene and the structure of expression plasmid

Take pUC-lysC as template, take primer 1(SEQ ID NO:5) and primer 4:GTCTACCGAAATATTATGCC(SEQ ID NO:8) be primer, the about 1kb of amplification lysC gene fragment I(); Take primer 2 (SEQ ID NO:6) and primer 5:GGCATAATATTTCGGTAGACTTAGCCACCACGTCAGAAGTGAGC(SEQ ID NO:9) be primer, the about 0.3kb of amplification lysC gene fragment II().

Two PCR products of Purified in electrophoresis.With equimolar amount mixing lysC gene fragment I and II, as template, take primer 1(SEQ ID NO:5) and primer 2 (SEQ ID NO:6) be primer, carry out overlapping PCR.PCR reaction solution volume is 50 μ l, and composition is as follows:

LysC fragment I and II: each 0.05pmole

Primer: each 50pmole

TaKaRaTaq?DNA?Polymerase（TaKaRa）：2.5U

10×PCR?Buffer：5μl

DNTPs: every kind of 10nmole

Overlapping PCR reaction obtains the product of an about 1.4kb.Purified in electrophoresis PCR product, is connected with pMD18-T carrier (TaKaRa).Connection product is transformed into e. coli jm109.Transformant is done to the direction of bacterium colony PCR check lysC gene in plasmid, and the primer is primer 3(SEQ ID NO:7) and primer 2 (SEQ ID NO:6).Select lysC gene and the plasmid that on carrier, lac promotor direction is consistent, use universal primer M13F(-47) and M13R(-48) check order, confirmation has default Ile → Ala to suddenly change in coded amino acid residue 342 site.By this plasmid called after pUC-lysC342(Figure 1A).

Embodiment 3: wild-type dihydrodipicolinic acid synthase's (dapA) clone

Take e. coli bl21 genomic dna as template, take primer 6:ACTGAAAGCTTAGGAGGTAATGAATGTTCACGGGAAGTATTGT(SEQ ID NO:10) and primer 7:ACTGACATAT GTTACAGCAA ACCGGCATGC(SEQ ID NO:11) be primer, carry out PCR reaction.

PCR reaction obtains about 0.9kb DNA product.This PCR product of Purified in electrophoresis, is connected with pMD18-T carrier.Connection product is transformed into e. coli jm109.Transformant is done to bacterium colony PCR check, and the primer is primer 3(SEQ ID NO:7) and primer 6(SEQ ID NO:10), or primer 3(SEQ ID NO:7) and primer 7(SEQ ID NO:11).No matter use and where organize primer, if the success of dapA gene is connected with carrier, can produce the PCR product of about 0.9kb.The plasmid that selection contains dapA gene, called after pUC-dapA.It should be appreciated by those skilled in the art, dapA gene may have two kinds of closures with respect to lac promotor.Any one direction can meet the needs of the present embodiment and embodiment 4.

Embodiment 4: the structure of saltant type dapA gene

Take pUC-dapA as template, take primer 8:GACCGGCGCTAACGTTACTGCGGAAGCC(SEQ ID NO:12) be primer, carry out site-directed mutagenesis PCR.PCR reaction solution volume is 50 μ l, and composition is as follows:

PUC-dapA plasmid: 100ng

Primer 8:50pmole

Bo Maide bio tech ltd, Pfu DNA Polymerase(Beijing): 5U

Taq?DNA?Ligase（NEB）：40U

10×Pfu?Buffer：4μl

10×Taq?DNA?Ligase?Buffer：5μl

DNTPs: every kind of 10nmole

PCR reaction conditions is as follows:

94°C，5min

94 ° of C, the 1min(beginning that circulates)

55°C，1min

65 ° of C, 8min(30 circulation)

65°C，10min

In PCR reaction solution, add 10U DpnI(NEB), in 37 ° of C reaction 1h.Get 10 μ l enzymes and cut the PCR reaction solution after processing, transform e. coli jm109.

Extract the plasmid of a plurality of transformants, use universal primer M13F(-47) and M13R(-48) check order, in check dapA gene, whether coded amino acid residue 81 site have Ala → Val sudden change of expection.Plasmid called after pUC-dapA81(Figure 1B of sudden change will successfully be introduced).

The structure of embodiment 5:LysC342/DapA81 co-expression carrier

With HindIII and NdeI enzyme, cut pUC-dapA81 plasmid, obtain the DNA fragmentation (about 1kb) with dapA gene; With same enzyme, cut pUC-lysC342 plasmid, obtain the DNA fragmentation (about 4kb) with lysC gene and plasmid skeleton part.Two fragments are connected, connecting product, be transformed into e. coli jm109 (Fig. 1).

With primer 1(SEQ ID NO:5) and primer 7(SEQ ID NO:11) transformant is carried out to bacterium colony PCR.If dapA gene is successfully connected with lysC gene, can produce the PCR product of about 2.2kb.The plasmid of connection chosen successfully, called after pUC-lysC342-dapA81(Fig. 1 C).

Embodiment 6: with the Host Strains that contains saltant type E.C. 2.7.2.4., produce Methionin

Plasmid pUC-lysC, pUC-lysC342 and pUC-lysC342-dapA81 are transformed into respectively to e. coli k-12 substr.MG1655(DSM-18039).Bacterial strain MG1655/pUC-lysC, the MG1655/pUC-lysC342(obtaining is intestinal bacteria CAT lys1303, preserving number CCTCC M2013100) and MG1655/pUC-lysC342-dapA81 be inoculated in seed culture fluid, in 30 ° of C, cultivate 12h.With 2.0% inoculum size, kind of daughter bacteria liquid is inoculated in to fermentation culture.In 30 ° of C, cultivate 2h, add 1mM IPTG, continue to cultivate 36h.

Wherein, in seed culture fluid (100mL), contain:

Sucrose: 0.32g;

Ammonium sulfate: 0.55g;

Yeast powder: 0.3g;

Peptone: 0.6g;

Potassium primary phosphate: 0.3g;

Magnesium sulfate: 0.01g;

Ferrous sulfate: 0.01g;

Isoleucine: 0.004g;

VITMAIN B1: 0.003g.

Wherein, in fermentation culture (100mL), contain:

Glucose: 14g;

Sucrose: 1g;

Ammonium sulfate: 3.3g;

Potassium primary phosphate: 0.42g;

Magnesium sulfate: 0.05g;

Ferrous sulfate: 0.01g;

Corn steep liquor: 1.6g;

Isoleucine: 0.02g;

Nicotinamide: 1.0mg;

VITMAIN B1: 3.0mg;

Calcium carbonate: 2.8g.

The measuring method of lysine concentration (colorimetry) is as follows:

Fermenation raw liquid is diluted to about 30mg/dl lysine hydrochloric acid salt concn, gets the dry test-tube that liquid 1mL after dilution is placed in 25mL; Get respectively again 30mg/dl lysine hydrochloride standardized solution and distilled water 1mL, be placed in respectively different dry test-tubes; In each test tube (having added respectively liquid to be measured, reference liquid, blank water), add 1mL ninhydrin solution respectively; After mixing, with aluminium foil, test tube is sealed; Above each test tube is placed in to 100 ℃ of boiling water baths and heats, from boiling water boiling, timing is 10 minutes; After reaction finishes, take out test tube, be placed in cold water cooling after, accurately draw respectively 8mL distilled water in each test tube, mix; Then, on spectrophotometer, measure the light absorption value of 475nm.Blank sample is usingd the liquid of blank test test tube as reference, and gained light absorption value, according to the typical curve of triketohydrindene hydrate, can calculate the concentration of the Methionin after fermented liquid dilution.According to extent of dilution, obtain lysine hydrochloric acid salt concn in fermenation raw liquid.

Fermentation shake flask is cultivated after 36h, and after measured, acid yield is as shown in table 1.

Table 1, lysine production measurement result

Bacterium numbering	Methionin g/L
		MG1655	0.8
MG1655/pUC-lysC	24.5±3.1
		MG1655/pUC-lysC342	40.2±3.4
pUC-lysC342-dapA81	54.6±3.6

From table 1, saltant type E.C. 2.7.2.4. of the present invention is carried out to overexpression, can improve the output of Methionin in intestinal bacteria.Method of the present invention provides more more options for optimizing the biosynthesizing of Methionin, contributes to build Strains for Lysine Production or improves lysine production.

It will be apparent to one skilled in the art that, do not deviating under the prerequisite of scope and spirit of the present invention, can carry out various modifications and changes to it, the combination between above-mentioned every technical characterictic and other technical scheme change completing according to foregoing all belong to the scope of the invention.

Claims (10)

1. a polypeptide with E.C. 2.7.2.4. III activity, is characterized in that, the 342nd the Isoleucine residue of E.C. 2.7.2.4. III replaced by the arbitrary amino acid residue except Isoleucine.

2. polypeptide according to claim 1, is characterized in that, the 342nd the Isoleucine residue of E.C. 2.7.2.4. III replaced by alanine residue.

3. polypeptide according to claim 1 and 2, is characterized in that, described E.C. 2.7.2.4. III has the aminoacid sequence as shown in SEQ ID NO:1.

4. a polypeptide with E.C. 2.7.2.4. III activity, is characterized in that, inserts, lacks or replace one or more amino-acid residues on the basis of the polypeptide in as claim 1-3 as described in any one.

5. a polynucleotide, is characterized in that, the polypeptide of described polymerized nucleoside acid encoding as described in any one in claim 1-4.

6. an expression vector, is characterized in that, comprises polynucleotide as claimed in claim 5.

7. a host cell, is characterized in that, comprises polynucleotide as claimed in claim 5 or expression vector as claimed in claim 6.

8. host cell according to claim 7, is characterized in that, described host cell is bacterium.

9. host cell according to claim 8, is characterized in that, described bacterium is intestinal bacteria, and preserving number is CCTCC M2013100.

10. the application of host cell in producing Methionin as claimed in any one of claims 7-9.