CN104087613B - Based on AAV ITR gene expression microcarrier and its construction method and application - Google Patents
Based on AAV ITR gene expression microcarrier and its construction method and application Download PDFInfo
- Publication number
- CN104087613B CN104087613B CN201410307720.2A CN201410307720A CN104087613B CN 104087613 B CN104087613 B CN 104087613B CN 201410307720 A CN201410307720 A CN 201410307720A CN 104087613 B CN104087613 B CN 104087613B
- Authority
- CN
- China
- Prior art keywords
- microcarrier
- itr
- gene expression
- sequences
- aav
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
It is a kind of based on AAV ITR gene expression microcarrier and its construction method and application.The microcarrier includes the gene expression frame for expression alien gene, and the gene expression frame two ends are connected to the ITR sequences of AAV genomes.Wherein, the gene expression frame is preferred to use linear expression cassette, cmv enhancer, Chicken β actin promoters, multiple cloning sites and the SV40 Ploy (A) being sequentially distributed between two sections of ITR sequences.Particularly preferably, D sequences are not included in the ITR sequences of the AAV genomes.The construction method of the microcarrier includes：The plasmid pUC57 minivector containing gene expression microcarrier sequence, microcarrier amplification plasmid pUC57 minivector EGFP etc. are built successively, through digestion, thermal denaturation and cooling treatment, obtain target product.The microcarrier of the present invention can in host cell efficiently, stablize lasting expression alien gene, and have no side effect, it is safe; meanwhile, its construction method is simple, with low cost; it is easy to scale implementation, is expected in the field extensive use such as gene therapy or genetic engineering.
Description
Technical field
The present invention relates to a kind of gene expression microcarrier, more particularly to it is a kind of it is new, based on adeno-associated virus（AAV）
Set terminal repetitive sequence（ITR）Gene expression microcarrier（AAV-ITR Mini Vector）And the gene expression microcarrier
Construction method and application.
Background technology
Gene therapy (gene therapy) refers to external source normal gene is imported into target cell by technique for gene engineering, replaced
For aberrant gene, close or dispel Disease-causing gene, repair defective gene or rebuild regulator control system etc., to correct or compensate due to base
Disease caused by defect and exception, so as to reach the purpose for the treatment of disease.Gene therapy has been widely used for treatment heredity
Disease, malignant tumour, angiocardiopathy, infectious diseases etc., in by the end of February, 2013 untill, 1902 kinds of genes are controlled in the world
Medicine is treated to enter in clinical test.The key technology of gene therapy is that foreign gene is effectively imported into acceptor from suitable carrier
Target cell, and effectively carry out exogenous gene expression.And the difficult point of gene therapy is the transfection of carrier, expression efficiency is low and deposits
In potential safety hazard, therefore research and development being capable of stable transfection and safely and effectively gene therapy vector is the research neck of gene therapy now
The emphasis in domain.Traditional gene therapy expression vector has virus expression carrier and plasmid expression vector.Although viral vector has
The advantage that transfection efficiency is high, targeting is strong, but its potential carcinogenicity, intoxicating risk, autoantigenic and cause cytopathy
The shortcomings of reason changes limits its extensive use in gene therapy to a certain extent.Replicated in plasmid vector containing bacterium
Sequence, resistant gene, unmethylated CpG sequences and some expression signals that may be hidden, these sequences are in plasmid replication
It is required, but serious safety issue may be triggered during gene therapy.So research and development are with stability, peace
The non-virus carrier of full property and targeting is increasingly subject to pay attention to.
The content of the invention
An object of the present invention is a kind of gene expression microcarrier based on AAV-ITR of offer, its energy in application
Efficient, stably, safe expression of the foreign gene in host cell is enough realized, so as to overcome deficiency of the prior art.
The second object of the present invention is to provide a kind of side for building the foregoing gene expression microcarrier based on AAV-ITR
Method.
The third object of the present invention is to provide the foregoing gene expression microcarrier based on AAV-ITR in expression alien gene
In application.
For achieving the above object, present invention employs following technical scheme：
A kind of gene expression microcarrier based on AAV-ITR, including the gene expression frame for expression alien gene, it is described
Gene expression frame two ends are connected to the ITR sequences of AAV genomes.
Further, the gene expression frame includes linear expression cassette.
As more one of preferred embodiment, the gene expression frame is included in the ITR sequences of two sections of AAV genomes
Between the CMV enhancers, Chicken β-actin promoters, multiple cloning sites and the SV40-Ploy (A) that are sequentially distributed.
As more one of preferred embodiment, D sequences are not included in the ITR sequences of the AAV genomes.
A kind of expression vector plasmid, it is characterised in that including the gene expression microcarrier described in as above any one.
As above any one gene expression microcarrier and the expression vector plasmid stablize table in host cell
Up to the purposes of foreign gene.
A kind of construction method of the gene expression microcarrier based on AAV-ITR, including：
（1）AAV-ITR expression cassettes are provided, and are cloned in the multiple cloning sites of pUC57 plasmids, obtains and contains the gene table
Up to the plasmid pUC57-minivector of microcarrier sequence, wherein, the gene expression microcarrier includes two groups of AAV genomes
The gene expression frame for expression alien gene is distributed between ITR sequences, two groups of ITR sequences；
（2）EGFP sequences are cloned into vector plasmid pUC57-minivector, microcarrier amplification plasmid pUC57- is obtained
minivector-EGFP；
（3）NotI digestions microcarrier expands plasmid pUC57-minivector-EGFP, and reclaims purpose fragment ds-
Minivector-EGFP, then carries out thermal denaturation and cooling treatment successively, obtains the gene expression microcarrier.
As more one of preferred embodiment, this method may also include：
（2X）Using pUC57-minivector-EGFP as template, PCR expand two groups of D sequences in two groups of ITR sequences it
Between DNA fragmentation, obtain microcarrier amplification plasmid pUC57-minivector- Δ D-EGFP；And,
（3X）With reference to step（3）Operation processing microcarrier amplification plasmid pUC57-minivector- Δ D-EGFP, obtain
The gene expression microcarrier of D sequences must be free of.
Specifically, this method includes：
（1）AAV-ITR expression cassettes are provided, and are cloned in the multiple cloning sites of pUC57 plasmids, obtains and contains the gene table
Up to the plasmid pUC57-minivector of microcarrier sequence；
（2）Using the plasmid pds-AAV-CB-EGFP containing EGFP as template, EGFP sequences are obtained by PCR amplifications, then will
EGFP sequences are cloned into vector plasmid pUC57-minivector, obtain microcarrier amplification plasmid pUC57-minivector-
EGFP；
（3）NotI digestions microcarrier expands plasmid pUC57-minivector-EGFP, and is returned with gel reclaims kit
Purpose fragment ds-minivector-EGFP is received, the double-stranded DNA of recovery carries out boiling water bath and handled to complete denaturation, then by heat change
Property DNA be immediately placed in cooled on ice, obtain the gene expression microcarrier.
The gene expression frame be included in be sequentially distributed between the ITR sequences of two sections of AAV genomes CMV enhancers,
Chicken β-actin promoters, multiple cloning sites and SV40-Ploy (A).
Compared with prior art, the present invention at least has the following advantages that：The gene expression microcarrier based on AAV-ITR can
With in host cell efficiently, stablize lasting expression alien gene, moreover, the expression vector only include foreign gene table
Up to required element, and the non-host cell DNA sequence dna such as bacterial replicon sequence, resistance gene sequences of plasmid is not contained, especially
It is the CpG sequences of bacterium, so as to reduce the adverse side effects, peace such as immune response, cellular inflammation reaction and cytotoxicity
Full property is higher, meanwhile, the construction method of the expression vector is simple, with low cost, it is easy to which scale is implemented.The present invention is expected to
In the field extensive use such as gene therapy or genetic engineering.
Brief description of the drawings
Fig. 1 is AAV-ITR secondary structure figure；
Fig. 2 be AAV ITR in D sequences structural representation；
Fig. 3 is a kind of structural representation of gene expression microcarrier of the present invention；
Fig. 4 is plasmid pUC57-minivector structural representation；
Fig. 5 is plasmid pUC57-minivector-EGFP r structural representation；
Fig. 6 is pUC57-minivector- Δ D-EGFP structure flow chart；
Fig. 7 is a kind of preparation technology flow chart of gene expression microcarrier of the present invention；
Fig. 8 is the electrophoretogram of S1 nucleic acid ferment treatment AAV-ITR microcarriers in a preferred embodiment of the present invention, wherein, 1-3 points
Wei not the plasmid without S1 nucleic acid ferment treatments, ds- DNA and AAV-ITR microcarriers；4-6 is respectively through S1 nucleic acid ferment treatments
Plasmid, ds- DNA and AAV-ITR microcarriers.As can be seen from the figure plasmid and double-stranded DNA can not be degraded by S1 nucleases, and
AAV-ITR microcarriers can be degradable by S1 nucleases；
Fig. 9 be same concentrations in a preferred embodiment of the present invention ds-DNA thermal denaturations after renaturation electrophoretogram, wherein, 1,
3rd, 5 roads are 1600bp, 2700bp, 1900bp double-stranded DNA；2nd, 4,6 roads are 1600bp, 2700bp, 1900bp single stranded DNA.
Electrophoresis result shows that the double-stranded DNA containing ITR sequences can be denatured completely, and without renaturation；And the double-stranded DNA without ITR sequences
Some DNA there occurs renaturation.
Figure 10 be various concentrations in a preferred embodiment of the present invention ds-DNA thermal denaturations after renaturation electrophoretogram, wherein 1-
6 roads are not comprising ITR double-strands 1, and unprocessed, 2-6 roads are respectively concentration 100ng/15uL, 150ng/15uL, 200ng/
15uL, 250ng/15uL, 300ng/15uL double-strand thermal denaturation processing；7-12 roads are the double-strand comprising ITR, 7, untreated, 8-
12 roads are respectively concentration 150ng/15uL, 200ng/15uL, 250ng/15uL, 300ng/15uL, 350ng/15uL double-strand heat
Denaturation treatment.As can be seen from the figure the double-stranded DNA without ITR sequences has occurred and that renaturation when concentration is 100ng/15uL,
In 300ng/15ul, renaturation degree is very high, and the double-stranded DNA containing ITR sequences is remained to when concentration reaches 300ng/15ul
Denaturation completely, when concentration is 350ng/15ul, there is small part renaturation；
Figure 11 is to survey equimolar plasmid, double-stranded DNA, AAV-ITR microcarriers, AAV-ITR- Δs D with flow cytometer
Expression efficiency collection of illustrative plates of the microcarrier in 293T cells.
Embodiment
In view of deficiency of the prior art, the present invention is intended to provide a kind of gene expression microcarrier（AAV-ITR Mini
Vector, or AAV-ITR microcarriers）, more specifically, the invention provides it is a kind of it is new, based on adeno-associated virus
（AAV）Inverted terminal repetitive sequence（ITR）Gene expression microcarrier（AAV-ITR Mini Vector）, additionally provide simultaneously
The construction method of the expression microcarrier and application.
The molecular structure of the gene expression microcarrier is similar to AAV genomes, i.e.,：Containing a single-stranded gene expression frame,
Single stranded DNA two ends are the ITR sequences of AAV genomes.
Wherein, ITR sequences can manage it into self complementary T-shaped hairpin structure in cell so that microcarrier is in cell
It is middle to form the cyclic multimeric and class chromatin Structure of stabilization, so as to be stabilized for a long time in cell, foreign gene
Just can continually and steadily it express.
And glm gene expression cassette then only contains promoter, enhancer, target gene and poly（A）Tailing sequence is smaller
Molecular weight be conducive to its transfectional cell and gene expression, be practically free of in addition bacterium or virus DNA sequence dna, moreover it is possible to so that exempting from
Epidemic disease reaction, cellular inflammation, cytotoxicity, silenced gene expression are preferably minimized.
It is used as one of those more preferred embodiment, the gene expression frame of the gene expression microcarrier（AAV-ITR
Expression cassette）Can be using following design：It is one between AAV ITR sequences, left and right ITR sequences that two ends, which are,
Can expression alien gene linear expression cassette, be followed successively by CMV enhancers, Chicken β-actin promoters, multiple cloning sites
And SV40-Ploy (A), common 1239bp (MCS).
For foregoing ITR, its structure see Fig. 1.Specifically, ITR systems are AAV（Adeno-associated
Virus, adeno-associated virus）The inverted terminal repetitive sequence at genome two ends（inverted terminal repeats）, its point
It is not made up of 145 bases, wherein preceding 125nts（1~125nt）The differences such as sequence can be divided into A, B, B successively ', C, C ', A '
Section, form 3 sections of palindromes, B and B ', C and C ' reverse complementals can form the top of T-shaped hairpin structure, A and A ' constitute T
It is long-armed, in addition, also having an end to unwind site on ITR（Terminal resolution site , Trs）With a D
Sequence, the D sequences refer in particular to rear 20 bases of ITR sequences, and left and right two ends are referred to as D (-) sequence
（CTCCATCACTAGGGGTTCC）With D (+) sequence（AGGAACCCCT AGTGATGGAG）（Refering to Fig. 2）.D sequences are ITR sequences
Unique non-palindromic sequence in row, contains end and unwinds site（trs）And packaging signal.
In the present invention, microcarrier is expressed for forementioned gene, after the D sequences of ITR sequences are removed, can also makes gene table
It is higher than plasmid up to efficiency.
Technical scheme is further described below in conjunction with a preferred embodiment.
First, the design of AAV-ITR microcarriers sequence
According to AAV gene structure characteristic Design AAV-ITR Expression cassette：Two ends are AAV ITR sequences
Row, between the ITR sequences of left and right for one can expression alien gene linear expression cassette, Expression element is followed successively by CMV
Enhancer, Chicken β-actin promoter, Multiple cloning site, SV40-Ploy (A), common 1239bp
（Refering to Fig. 3）.
2nd, AAV-ITR microcarriers expand the structure of plasmid
AAV-ITR Expression cassette sequences are synthesized by Suzhou Jin Weizhi companies, are placed on pUC57 plasmids
Multiple cloning sites, two ends be NotI restriction enzyme sites, be easy to the amplification and preparation of microcarrier, the recombinant plasmid is pUC57-
minivector（Refering to Fig. 4）, AAV-ITR Expression cassette can be identified by NotI digestions.
Utilize the software Design primers of primer premier 5.0, sense primer UP1：5’- CCCATCGATGCCGCCATG
GTGAGCAAGGGC；Anti-sense primer LP2：5 '-CCCATCGATTTACTTGTACAGCTCGTCC-3 ', two design of primers contain
ClaI restriction enzyme sites.PCR reaction systems are 50 μ L, each comprising 50ng template plasmids pds-AAV-CB-EGFP, upstream and downstream primer
0.3 μM, dNTP 0.2mM, MgSO4 1.5mM, 1 × PCR buffer solutions and 1U KOD-Plus-Neo（It is limited that biotechnology spins in Japan
Company, Shanghai）.PCR amplification procedures use three-step approach：95 °C of pre-degenerations 5 min, 95 °C of denaturation 50sec, 57 °C of annealing 50
Sec, 72 °C of 90 sec of extension, totally 30 circulations, 72 °C extend 7 min eventually.Carrier pUC57-minivector plasmids ClaI
Digestion, while dephosphorylation process is prevented connecting certainly for carrier segments, reaction system is 20 μ L, includes 16 μ L pUC57-
Minivector plasmids, 2 10 × Buffer of μ L, 1 μ L Cla I and 1 μ L Fast AP, reaction condition are 37 DEG C of water-bath effects
30min；PCR primer EGFP sequences ClaI digestions, reaction system is 50 μ L, comprising 23 μ L PCR purpose fragments, 5 μ L 10 ×
Buffer, 1 μ L Cla I, 37 DEG C of water-baths act on 30min.Then Cycle pure kit kits are used（Omega companies）Quickly
Reclaim digestion products.（All restriction enzymes mentioned in text are Fermentas Products）.Carrier endonuclease bamhi and
Target gene endonuclease bamhi is in T4 ligases（NEB companies）In the presence of, coupled reaction 30min at 22 DEG C.Reaction system is 20 μ
L, comprising 2 μ L pUC57-minivector plasmid enzyme restrictions products, 5.5 μ L purpose fragments digestion products, 2 10 × Buffer of μ L,
1 μ L T4 ligases.Connection product transformed competence colibacillus cell（sure cell）, 37 DEG C of incubated overnights, ammonia benzyl resistance is put down after 12 h
There is single bacterium colony on single bacterium colony appearance, picking experimental group flat board on plate, 16h is cultivated in the LB of the benzyl containing ammonia, extract recombinant plasmid matter
Grain pUC57-minivector-EGFP, the recombinant plasmid is identified by digestion and transfection in vitro cell.
Design primer upstream UP3：5’-GCG TCTAGAGGTACCCTAGTTATTATTAGTAATC；Anti-sense primer LP4：
5 '-GCG TCT AGA TAA AAAACCTCCCACACCTCCC, with XbaI enzyme cutting site.With pUC57-minivector-
EGFP plasmids are the DNA fragmentation between the left and right D sequences of template amplification, substitute the microcarrier sequence comprising D sequences with this, obtain
Another microcarrier expands plasmid pUC57-minivector- Δ D-EGFP, and concrete operation method is ibid.
3rd, the preparation of AAV-ITR microcarriers
Plasmid pUC57-minivector-EGFP is expanded with NotI digestions, gel reclaims kit reclaims purpose fragment
ds-minivector-EGFP（About 2000bp）.The double-stranded DNA boiling water bath 5min of recovery, makes it be denatured completely, then puts rapidly
In cooled on ice 2min, that is, obtain AAV-ITR microcarriers（Refering to Fig. 7）.
4th, the Structural Identification of microcarrier
（1）Single-stranded identification
S1 nucleases are a kind of highly single-stranded special endonucleases, and under most suitable reaction condition, can degrade list
Chain DNA or RNA.Handle AAV-ITR microcarriers, plasmid and double-stranded DNA respectively with S1 nucleases, reaction system is 30 μ L, comprising
4.4 μ L DNA samples, 5.5 μ L purpose fragments digestion products, 65 × Buffer of μ L, 0.1 μ L S1 nucleases.Reaction condition is：
25 DEG C, 30min.Electrophoresis result shows that plasmid and double-stranded DNA can not be degraded by S1 nucleases, and AAV-ITR microcarriers can be by S1
Nuclease is degradable, it was demonstrated that form single-stranded really（Refering to Fig. 8）.
（2）The identification of ITR structures
Respectively with XbaI, NotI digestion processing plasmid pUC57-minivector-EGFP, glue reclaim obtains length and is respectively
The 1600bp and 2700bp double-stranded segment without ITR sequences, while with ds-minivector-EGFP fragments（Contain ITR sequences
Row, 1900bp）Carry out thermal denaturation processing（Rapid ice bath 2min after boiling water bath 5min）, Goldview dyeing electrophoresis is then carried out,
Experimental result shows that the double-stranded DNA containing ITR sequences can be denatured completely, and without renaturation；And the double-stranded DNA without ITR sequences
Some DNA there occurs renaturation in electrophoresis process（Refering to Fig. 9）.
In addition, by the double-stranded segment without ITR sequences of various concentrations（1600bp）With the ds- of various concentrations
Minivector-EGFP fragments carry out thermal denaturation processing, and ibid, electrophoresis detection compares the difference of the two to processing method.Electrophoresis knot
Fruit shows that the double-stranded DNA containing ITR sequences remains to denaturation completely when concentration reaches 300ng/15ul, is 350ng/ in concentration
During 15ul, there is small part renaturation；And without ITR sequences double-stranded DNA concentration be 300ng/15ul when, renaturation degree is very high,
When concentration is 100ng/15ul, still there is DNA renaturation（Refering to Figure 10）.Prove that obtained microcarrier is included by the above results
ITR structures.
5th, the expression of AAV-ITR microcarriers in vitro in cell
Growth period human embryonic kidney cell 293T cell of taking the logarithm is inoculated in 24 orifice plates, per hole 500ul, and density is 2 ×
105/ mL, culture is containing 10% calf serum, penicillin, in each 100U/L of streptomysin DMEM culture mediums, is placed in 37 DEG C, 5% CO2
Saturated humidity incubator in cultivate.It is about 60% to treat cell density（Generally 18-24h）, you can carry out DNA transfection.By heat
Microcarrier AAV-ITR- Δ D- EGFP that denaturation treatment is obtained, original microcarrier AAV-ITR- EGFP, amplification plasmid and unchanged
Property double-stranded DNA carries out cell transfecting respectively, and 1 μ g stand 10min after adding HBS to 50 μ L, mixing；PEI（50mM, 0.9 μ L）Plus
HBS stands 10min to 50 μ L after mixing；The two is mixed（100μL）, stand 10min after mixing, the PEI-DNA mixed liquors are added
Enter to the 293T cell surfaces cleaned with PBS solution, add appropriate culture medium, be placed in 37 DEG C, 5% CO2Saturated humidity
Cultivated in incubator, respectively at 24h, 48h, 60h, 72h after transfection, utilize fluorescence microscope GFP expression.The
During 72h, digested with 0.25% pancreatin, 1000r/min, cell is collected by centrifugation in 5min, then cell is resuspended with 1mL PBS solutions,
Pass through flow cytomery GFP expression.As a result find, original microcarrier AAV-ITR- EGFP luciferase expression effect
Rate is less than amplification plasmid and undenatured double-stranded DNA；And remove the fluorescence table of the microcarrier AAV-ITR- Δ D- EGFP after D sequences
Significantly improved up to efficiency, even more than expand plasmid and undenatured double-stranded DNA（Refering to Figure 11）.
It is pointed out that the foregoing is only preferably embodiment, but protection scope of the present invention of the invention
Be not limited thereto, it is any be familiar with the people of the technology disclosed herein technical scope in, the change that can readily occur in or
Replace, should all be included within the scope of the present invention.Therefore, protection scope of the present invention should be with the protection of claim
Scope is defined.
Claims (1)
1. a kind of method of gene expression microcarrier high efficiency stable expression foreign gene in host cell based on AAV-ITR,
It is characterized in that：
The wherein described gene expression microcarrier based on AAV-ITR includes the gene expression frame for expression alien gene, wherein,
The gene expression frame two ends are connected to the ITR sequences of AAV genomes, and the gene expression frame is linear expression cassette, and
And the gene expression frame be included in the cmv enhancer being sequentially distributed between the ITR sequences of two sections of AAV genomes, Chicken β-
D sequences are not included in actin promoters, multiple cloning sites and SV40-Ploy (A), the ITR sequences of the AAV genomes；
Its step is as follows：
(1) AAV-ITR expression cassettes are provided, and are cloned in the multiple cloning sites of pUC57 plasmids, obtains and contains gene expression microcarrier
The plasmid pUC57-minivector of sequence, wherein, the gene expression microcarrier includes the ITR sequences of two groups of AAV genomes,
The gene expression frame for expression alien gene is distributed between two groups of ITR sequences；
(2) EGFP sequences are cloned into vector plasmid pUC57-minivector, obtain microcarrier amplification plasmid pUC57-
Minivector-EGFP, then using pUC57-minivector-EGFP as template, PCR expands two groups of D in two groups of ITR sequences
DNA fragmentation between sequence, the PCR upstream primer sequences that use of amplification for 5 '-
GCGTCTAGAGGTACCCTAGTTATTATTAGTAATC, downstream primer sequence is 5 '-GCG TCTAGATAA
AAAACCTCCCACACCTCCC, by XbaI enzyme cutting microcarrier expand plasmid pUC57-minivector-EGFP, and by its with
Fragment connection between the obtained left and right D sequences of PCR amplifications obtain microcarrier amplification plasmid pUC57-minivector- Δs D-
EGFP；
(3) NotI digestions microcarrier amplification plasmid pUC57-minivector- Δ D-EGFP, and reclaim purpose fragment, then according to
Secondary progress thermal denaturation and cooling treatment, obtain the gene expression microcarrier without D sequences；
(4) expression is free of the AAV-ITR of D sequences gene expression microcarrier in cell in vitro.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410307720.2A CN104087613B (en) | 2014-06-30 | 2014-06-30 | Based on AAV ITR gene expression microcarrier and its construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410307720.2A CN104087613B (en) | 2014-06-30 | 2014-06-30 | Based on AAV ITR gene expression microcarrier and its construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104087613A CN104087613A (en) | 2014-10-08 |
| CN104087613B true CN104087613B (en) | 2017-08-29 |
Family
ID=51635372
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410307720.2A Active CN104087613B (en) | 2014-06-30 | 2014-06-30 | Based on AAV ITR gene expression microcarrier and its construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104087613B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019219947A1 (en) * | 2018-05-18 | 2019-11-21 | Sorbonne Universite | Molecular tools and methods for transgene integration and their transposition dependent expression |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086012A (en) * | 2016-06-23 | 2016-11-09 | 百奥迈科生物技术有限公司 | A kind of external preparation method of linear double-strand adeno-associated virus genome |
| CN107670029A (en) * | 2017-09-06 | 2018-02-09 | 江苏农牧科技职业学院 | A kind of recombination avian adeno-associated virus live vector vaccine for expressing duck hepatitis virus VP1 genes and its preparation method and application |
| JP2020532981A (en) * | 2017-09-08 | 2020-11-19 | ジェネレーション バイオ カンパニー | Modified Closed DNA (CEDNA) |
| CN107630037A (en) * | 2017-10-19 | 2018-01-26 | 和元生物技术（上海）股份有限公司 | A kind of purifying process for obtaining high-purity gland relevant viral vector |
| CN108187037A (en) * | 2017-11-29 | 2018-06-22 | 江苏农牧科技职业学院 | A kind of recombination avian adeno-associated virus live vector vaccine for expressing duck hepatitis virus VP3 genes and its preparation method and application |
| CN109868267B (en) * | 2019-01-30 | 2020-03-20 | 广州派真生物技术有限公司 | Method for improving transfection efficiency of EGFP plasmid |
| CN117802161A (en) * | 2022-06-30 | 2024-04-02 | 苏州吉恒基因科技有限公司 | Accurate recombinant adeno-associated virus vector and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6221349B1 (en) * | 1998-10-20 | 2001-04-24 | Avigen, Inc. | Adeno-associated vectors for expression of factor VIII by target cells |
| CN103014064A (en) * | 2011-09-22 | 2013-04-03 | 北京五加和分子医学研究所有限公司 | Construction and application of AAV vector with ITRs arranged co-directionally |
| CN102634542B (en) * | 2012-04-12 | 2014-03-26 | 北京工业大学 | Recombinant adeno-associated virus (rAAV) vector for expressing full genes of human antibody and construction method of rAAV carrier |
-
2014
- 2014-06-30 CN CN201410307720.2A patent/CN104087613B/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019219947A1 (en) * | 2018-05-18 | 2019-11-21 | Sorbonne Universite | Molecular tools and methods for transgene integration and their transposition dependent expression |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104087613A (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104087613B (en) | Based on AAV ITR gene expression microcarrier and its construction method and application | |
| Myers et al. | The recombination hot spot chi activates RecBCD recombination by converting Escherichia coli to a recD mutant phenocopy. | |
| CN111849979B (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
| Prudhomme et al. | Diversity of Tn 4001 transposition products: the flanking IS 256 elements can form tandem dimers and IS circles | |
| US20230212612A1 (en) | Genome editing system and method | |
| Yoichi et al. | Two single-strand DNA initiation signals located in the oriV region of plasmid RSF1010 | |
| CN105602972B (en) | Method based on CRISPR-Cas9 engineered ex vivo adenovirus vector | |
| CN112680443B (en) | Promoter pCalm1 and application thereof | |
| CN112899276A (en) | Mini promoter pHSP90AA1 and application thereof | |
| CN112522307A (en) | BSMV (human cytomegalovirus) viral vector-mediated CRISPR (clustered regularly interspaced short palindromic repeats)/Cas 9 recombinant vector and application thereof | |
| WO2023206871A1 (en) | Optimized crispr/spcas12f1 system, engineered guide rna and use thereof | |
| CN107384957B (en) | A kind of construction method, screening technique and the application of AAV auxiliary package carrier and the carrier that expressing miRNA | |
| CA3225082A1 (en) | Enzymes with ruvc domains | |
| US20230374479A1 (en) | Technique for modifying target nucleotide sequence using crispr-type i-d system | |
| Huang et al. | Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing | |
| CN116004716A (en) | Method for efficiently editing genes by using replication dCAS9-FokI system | |
| CN109456995A (en) | Gene knockout plasmid, cell line and preparation method and application | |
| US20230310555A1 (en) | Compositions for genome editing and methods of use thereof | |
| Becker et al. | Relaxed specificity of the R1162 nickase: a model for evolution of a system for conjugative mobilization of plasmids | |
| CN108517335A (en) | A kind of Lentiviral and its construction method of liver cell miR-199b low expressions | |
| Frey et al. | Induction of interferon in L cells by defective-interfering (DI) particles of vesicular stomatitis virus: lack of correlation with content of [±] snapback RNA | |
| WO2020018166A1 (en) | Nuclease-mediated nucleic acid modification | |
| CN113667671B (en) | Mini promoter pRTN1 and application thereof | |
| CN113652427B (en) | Mini promoter pATP1B1 and application thereof | |
| US20240200047A1 (en) | Enzymes with ruvc domains |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |