CN104087594B

CN104087594B - Obtain method and the application of sheep activin II receptors gene and its mutant

Info

Publication number: CN104087594B
Application number: CN201410338143.3A
Authority: CN
Inventors: 刘明军; 张雪梅; 李文蓉; 张宁; 贺三刚; 吴阳升; 安静
Original assignee: CHINA AUSTRALIA SHEEP RESEARCH CENTER ANIMAL SCIENCE ACADEMY OF XINJIANG UYGUR AUTONOMOUS REGION
Current assignee: CHINA AUSTRALIA SHEEP RESEARCH CENTER ANIMAL SCIENCE ACADEMY OF XINJIANG UYGUR AUTONOMOUS REGION
Priority date: 2014-07-16
Filing date: 2014-07-16
Publication date: 2017-08-08
Anticipated expiration: 2034-07-16
Also published as: CN104087594A

Abstract

The invention discloses a kind of method and application for obtaining sheep activin II receptors (ActRIIB) gene and its mutant, including clone ActRIIB gene coding regions full length cDNA sequence；ActRIIB and its rite-directed mutagenesis type slow virus carrier structure；Stable expression ActRIIB and mutant cell line selection.The present invention has found that ActRIIB mutant has proliferation function to sheep Primary myoblasts in cellular level, is that the further ActRIIB that explores lays the foundation in the Study on Molecular Mechanism involved by domestic animal muscle cell Growth and Differentiation process.

Description

Obtain method and the application of sheep activin II receptors gene and its mutant

Technical field

It is specifically a kind of acquisition sheep activin II receptors gene and its prominent the present invention relates to animal genetic engineering field The method of variant and application.

Background technology

Activin is the glycoprotein hormones most found early in sexual gland, belongs to TGF TGF-β superfamily member, Separate, purify from the liquor folliculi of ox first within 1986.Activin receptor ActR belong to the serine of TGF-β superfamily member/ Serineprotein kinase receptor, according to its characteristic structurally and functionally, activin receptor can be divided into two classes, activin I types With II receptors.Activin II receptors are a kind of glycoprotein, are also a kind of acceptor of structure activated form.It is by 510 amino Acid composition, contains an extracellular ligand binding domains 1-135aa of N-terminal for being rich in cysteine, a hydrophobic transmembrane and one Individual intracellular serine/threonine kinase domain 159-510aa, including two hypotypes, i.e. activin II receptors A and activin II receptors B.Sequence alignment result shows that activin IIB receptors have very high homology between different plant species, ox ActRIIB is respectively 93% and 91% with people, the sequence homology of mouse.

ActRIIB forms ligand receptor complex so as to start downstream signal transduction with raising I receptors after ligand binding, II receptors play the dual-use function of ligand binding and specific recognition, therefore the 26S Proteasome Structure and Function of II receptors receives much concern. All it is by I types and II types silk ammonia there are some researches prove Myostatin signal transduction pathway is similar to TGF-β family member The heterodimer of acid/threonine kinases receptors carries out signal transduction.As TGF-β family member, Myostatin triggers Signal transduction first have to be combined with II receptors, then combined again with I receptors, once heterodimer receptor complex shape Into II receptors make I receptor phosphorylations, and the acceptor I of phosphorylation further makes intracellular transcription factor Smad2/3 phosphoric acid Change, the Smad2/3 of phosphorylation can be combined further with Smad4, and enter nucleus, so as to adjust the expression of target gene.

ActRIIB has multiple ligands, such as Myostatin, and it belongs to TGF-beta superfamily members, is generally acknowledged muscle The negative regulatory factor of growth, can be by regulation muscle growth in connection, and current antagonism myostatin has been demonstrated can Increase the thin muscle quality of animal.And the compound that activin receptor IIB mutant is formed after being combined with MSTN can not with I types by Body is combined, so as to reach the function of blocking MSTN downstream signal transductions, suppress MSTN.

Effects of the ActRIIB in Myostatin signal transductions has obtained the further support of experiment in vivo.Johns Se-Jin Lee of Hopkins universities etc. set up expression non-active structure domain ActRIIB transgenic mice, this nonactive Although the acceptor of domain can be combined with Myostatin, due to lacking intracellular kinase domain so that ActRIIB can not Combined with I receptors, therefore Smad protein functions can not be activated to block Myostatin biological functions, cause transgenosis Mouse weight increases by 25% compared with control mice.In addition, can be competing with MSTN by the ActRIIB mutant of transgene expression Striving property is combined, and blocks or weaken the MSTN and endogenous ActRIIB on cell membrane combination, so that suppress downstream signal transduction, It is final to block or weaken inhibitory action of the MSTN to muscle growth, cause transgenic mice muscle paraplasm loose.Samuel M etc. injects the C57BL/6 mouse of 8 weeks with soluble ActRIIB, and the average weight that mouse is injected after 28 days increases than control group 16 ﹪ are added.Se-Jin Lee in 2005 etc. are reported again is injected into wild-type mice by soluble Activin IIB acceptors In vivo, mouse muscle increases by 60% than control group in 2 weeks.Expression of the ActRIIB mutant on trangenic mice causes skeletal muscle Hypertrophy, illustrates that ActRIIB acceptors play key effect in terms of muscle hypertrophy is adjusted.2010, Xiaolan Zhou etc. were used Biotechnology, which has manufactured a soluble receptor protein for being sActRIIB, i.e., one, can block myostatin simultaneously With activin A macromolecular Experimental agents, and it is injected into normal mouse muscle and cancer model mouse muscle, ties Fruit has found that while not to be influenceed on tumor growth rate, and does not also have shadow to fatty loss and increasing for inflammatory factor Ring, but effectively reversed muscle ablation, as a result cause the survival period of colon cancer mouse to greatly prolong.In addition, Raouia etc. Research confirms that ActRIIB mutant proteins are compared with natural ActRIIB albumen, and the former can dramatically increase myogenous cells quantity. These results prompting ActRIIB mutant may be by suppressing Myostatin gene expression promote muscle growth.

Due at present it has been reported that for ActRIIB mutant block myostatin promote muscle growth research knot Fruit is had focused largely on low vertebrate and mouse, and the research on the big animal such as livestock and poultry has no report, and lacks at present Sheep ActRIIB full length sequences, therefore, clone sheep activin II receptor genes parse ActRIIB genes and its mutant Effect in domestic animal muscle cell growth course, is that development promotees muscle growth preparation from now on or transgenic animals lay the foundation, Also new thinking is provided to improve domestic animal meat production.

The content of the invention

It is an object of the invention to provide a kind of method for obtaining sheep activin II receptors gene and its mutant with Using to solve the problems mentioned in the above background technology.

To achieve the above object, the present invention provides following technical scheme：

A kind of method for obtaining sheep activin II receptor full length gene code areas and its mutant, including ActRIIB Code area full length cDNA sequence clone；The rite-directed mutagenesis of ActRIIB genes and the structure of slow virus carrier；Stable expression ActRIIB and the screening of mutant cells system；Clone ActRIIB gene coding regions full length cDNA sequence, gathers sheep liver Dirty tissue, liver organization total serum IgE and reverse transcription, design cloning primer P1 are extracted with Trizol reagents：5’- GGCACCGCGGAACATGACGGCGCCCTGGGCGGCCC-3 ', P2：5 '-GTGTCCTGGGCTTAGATGCTC GACTC-3 ', Sheep ActRIIB full length coding regions sequence is expanded by RT-PCR method, expected size fragment will be met and be cloned into pMD 18T loads Body, sequencing, positive plasmid is named as pMD 18T-ActRIIB；Described ActRIIB and its rite-directed mutagenesis type slow virus carrier Build, using pMD 18T-ActRIIB plasmids as template, with primer P3：5’- ATAGGATCCGCACCGCGGAACATGACGGCGCCCTG-3 ' (BamH I), P：5’- GGCGCGGCCGCTTAAGCGTAGTCTGGGACGTCGTATGGGTAGATGCTCGACTC-3 ' (NotI), by ActRIIB Asias gram In the grand pLEX-MCS to Lentiviral, Lentiviral pLEX-ActRIIB is obtained, total length form can be expressed Sheep ActRIIB.

With primer P5：5’-GCCGGATCCATGGCCCTCGCCCTCCTCTG-3 ' (BamHI), P6：5’- CCCCTCGAGTTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTT CTCCTCG-3 ' (XhoI), Ya Ke It is grand enter slow virus carrier pLEX-MCS, obtain Lentiviral pLEX-dnActRIIB, the ActRIIB of truncation can be expressed, That is 7-100 amino acids sequence.It is the IgG-Fc genetic fragments of AgeI and XhoI restriction enzyme sites respectively by upstream and downstream, with warp The pLEX-dnActRIIB large fragments of AgeI and XhoI double digestions are attached, and obtain recombinant plasmid pLEX-dnActRIIB-IgG Fc, can express truncated-type ActRIIB (7-100aa) the plasmid dnActRIIB-IgG Fc with IgG-Fc labels.

The 79th amino acids of dnActRIIB-IgG Fc sequences are relied into ammonia using Stratagene site-directed mutagenesis kits Acid（L）Rite-directed mutagenesis is proline respectively（P）And glutamic acid（E）, L79P rite-directed mutagenesis forward primers are P7： 5’- GAAGGGCTGCTGGCCGGACGACTTCAACT-3 ', reverse primer is P8：5’- AGTTGAAGTCGTCCGGCCAGCAGCCCTTC-3 ', L79E rite-directed mutagenesis forward primer are P9 respectively：5’- CAAGAAGGGCTGCTGGGAGGACGACTTCAACTGC-3 ', reverse primer is P10：5’- GCAGTTGAAGTCGTCCTCCCAGCAGCCCTTCTTG-3’.Build respectively obtain pLEX-dnActRIIB-IgG Fc-L79P, PLEX-dnActRIIB-IgG Fc-L79E slow virus recombinant expression plasmids；

The stable expression ActRIIB genes and the screening of mutant cells system are by the ActRIIB genes of structure and are dashed forward The slow virus recombinant expression plasmid transfection 293T cells of variant, carry out the packaging of slow virus, and it is former to infect the sheep being separately cultured For sarcoblast, the sarcoblast system of stable expression sheep ActRIIB total lengths and mutant is obtained.

It is used as further scheme of the invention：Three kinds of mutant of described sheep ActRIIB genes, mutant form is ammonia Cardinal extremity is truncated and its single base mutation.

It is used as further scheme of the invention：The stable expression ActRIIB genes and the screening tool of mutant cells system Body step is：A, 293T cell culture：37 DEG C of condition, 5% CO₂, complete culture solution（DMEM+10% hyclone）, six holes Plate spreads 6-7 × 10 per hole⁵Individual cell, cell confluency degree reaches 80-90% after 20 hours；The lipid of b, Lipofectamine 2000 Body is transfected：After the Opti-MEM culture mediums for adding 250 μ L preheatings, transfected plasmids pLEX- is separately added into following ratio ActRIIB、pLEX-dnActRIIB-IgG Fc、pLEX-dnActRIIB-IgG Fc-L79P、pLEX-dnActRIIB-IgG The μ g of Fc-L79E 2, the μ g of packaging plasmid psPAX2 1.5, the μ g of envelope plasmid pMD2.G 0.5, gently mix；Separately take 250 μ L Opti-MEM culture mediums, add 8 μ L liposomes thereto, and room temperature is placed after 5min, the good DNA of above-mentioned dilution is mixed with liposome Close, be placed in incubation at room temperature 20 minutes；During this period, clean cell to be transfected once with Opti-MEM culture mediums, by liposome and DNA compounds add cell；Tissue Culture Plate is put back in 37 DEG C of incubators and is incubated；After 2-4 hours, liposome and DNA are removed Compound, the fresh complete culture solutions of 2ml are added in every hole, are again put back in 37 DEG C of incubators Tissue Culture Plate and are cultivated；c、 Virus packaging：The supernatant containing slow virus is collected after culture 48h, is filtered with 0.45 μm of filter, filtered solution is collected, it is now viral Infection can be used directly to or -70 DEG C freeze；Cell is collected, albumen is extracted and carries out Western blotting detections ActRIIB The expression of total length and ActRIIB mutant；D, virus infection：4.5-5 × 10 are spread in 6 orifice plates per hole⁵Individual sheep is primary thin into flesh Born of the same parents；Next day when degree of converging reaches 70% or so, discards nutrient solution, adds 500 μ L viruses（Step c filtered solution）, 500 μ L it is complete Nutrient solution, while add 1 μ L polybrene, cell is placed in 5% CO₂, cultivate in 37 DEG C of incubators；E, stable cell lines sieve Choosing：Virus liquid is discarded after virus infection 24h, the cell that 0.05% pancreatin is digested in 6 orifice plates is transferred in 10cm culture dishes, treats cell Completely it is adherent after, add 0.25 μ g/mL Puromycin screened；In order to obtain the expression cell of stable integration foreign gene System, the selective medium containing Puromycin was changed every 2-3 days, while setting normal cell controls group, cellular control unit is complete Portion is dead, and the cell that experimental group is survived is the cell for infecting foreign gene；The thin of stable transfection can be obtained within 7-10 days Born of the same parents, are continued to expand culture, take part cell to carry out Western blotting detections.

It is used as further scheme of the invention：The clone sheep activin II receptors gene and its mutant should With the effect that i.e. ActRIIB and mutant grow to sheep Primary myoblasts, by the stable expression ActRIIB of above-mentioned screening The cell line of total length and mutant, respectively with 2 × 10³Individual cell/be seeded to per hole in 96 orifice plates, every kind of cell sets 4 repetitions, Blank control group is set simultaneously, cell growth curve is determined using Cell Counting Kit-8 methods；Every 24h to experimental group And control group hole respectively adds and 4h is incubated in the 10 μ l reagents of CCK- 8,37 DEG C of incubators, ELIASA is determined at 450 nm wavelength Absorbance, METHOD FOR CONTINUOUS DETERMINATION 7 days counts the average value that each hole of cell line 4 is repeated, by abscissa of cell culture number of days, OD₄₅₀It is worth and is Ordinate draws cell growth curve.

The beneficial effects of the invention are as follows：It is sheep ActRIIB genes present invention obtains sheep ActRIIB gene orders Sequence release provide related data；It is Fc domains to obtain sheep ActRIIB Gene Fusions to IgG molecule rock-steady structures domain Soluble ActRIIB mutant, it includes the ActRIIB mutant of amino-terminal truncated version and the mutant of single base mutation.At present Any report is yet there are no on sheep activin receptor IIB genes and mutant research, and the present invention has found in cellular level ActRIIB and mutant, to the proliferation function of sheep Primary myoblasts, are further to explore ActRIIB mutant in domestic animal flesh Effect and ActRIIB mutant in meat cell growth atomization block the Study on Molecular Mechanism of MSTN signal paths to establish Basis.

Brief description of the drawings

Fig. 1 is the amplification of sheep ActRIIB gene PCRs；

Fig. 2 is pLex-ActRIIB recombinant plasmids digestion detection；

Fig. 3 is pLex-dnActRIIB-Fc recombinant plasmids digestion detection；

Fig. 4 is the western blot detections of pLEX-ActRIIB, pLEX-dnActRIIB-Fc mutant；

Fig. 5 is that cell growth curve is determined.

Embodiment

Below in conjunction with the embodiment of the present invention, the technical scheme in the embodiment of the present invention is clearly and completely described, Obviously, described embodiment is only a part of embodiment of the invention, rather than whole embodiments.Based in the present invention Embodiment, the every other embodiment that those of ordinary skill in the art are obtained under the premise of creative work is not made, all Belong to the scope of protection of the invention.

Used material includes in embodiments of the invention：Slow virus carrier pLEX-MCS is by many universities of U.S.'s crolla Li Chuanyuan professors give in laboratory；Cell：293T, sheep sarcoblast are separated by this laboratory and preserved；Animal material：Sheep liver Dirty China of Urumqi City of picking up from insults domestic animals slaughter market.It is Trizol, E. coli competent bacterial strain DH5 α, the anti-HA monoclonal antibodies of mouse, small Amount plasmid extraction kit, glue reclaim kit are purchased from Beijing Tiangeng company；The sheep anti-mouse igg of IRDye 800CW marks Antibody is purchased from LI-COR Biosciences companies of the U.S.；High-fidelity DNA polymerase, Tag DNA polymerases, reverse transcriptase, limit The reagents such as property restriction endonuclease processed, T4 DNA ligases, IPTG are purchased from Dalian TaKaRa companies；Middle amount plasmid extraction kit is purchased from QIAGEN companies；QuickChange site-Directed Mutagenesis kit are purchased from Stratagene companies； LipofectamineTM 2000 is purchased from Invitrogen companies；DMEM in high glucose, Opti-MEM are purchased from GIBCO companies；Tire ox blood HYCLONE companies are purchased from clearly；CCK-8 reagents are purchased from Dojindo companies；Other reagents are domestic analysis net product.The base The clone of cause and its structure of slow disease expression poisonous carrier, kit, the reagent of selection are commercially available prod.

In the embodiment of the present invention, a kind of method for obtaining sheep activin II receptors gene and its mutant, including with Lower step：Clone ActRIIB gene coding regions full length cDNA sequence；The rite-directed mutagenesises of ActRIIB genes and slow virus carrier Build；Stable expression ActRIIB and the screening of mutant cells system.Clone ActRIIB gene coding regions full-length cDNA sequence Row, are collection sheep liver organization first, liver organization total serum IgE and reverse transcription are extracted with Trizol reagents, with reference to NCBI data The ActRIIB sequences of ox are announced in storehouse（GenBank Accession No. U57707）, design sheep Ovine ActRIIB gram Grand primer, expands sheep ActRIIB full length coding regions sequence by RT-PCR method, will meet expected size fragment and be cloned into PMD 18T, sequencing, positive plasmid is named as pMD 18T-ActRIIB.Described ActRIIB and its rite-directed mutagenesis type slow virus The structure of carrier, using pMD 18T-ActRIIB plasmids as template, with primer P3：5’- ATAGGATCCGCACCGCGGAACATGACGGCGCCCTG-3 ' (BamH I), P4：5’- GGCGCGGCCGCTTAAGCGTAGTCTGGGACGTCGTATGGGTAGATGCTCGACTC-3 ' (NotI), by ActRIIB Asias gram In the grand pLEX-MCS to Lentiviral, Lentiviral pLEX-ActRIIB is obtained, total length form can be expressed Sheep ActRIIB.

With primer P5：5’-GCCGGATCCATGGCCCTCGCCCTCCTCTG-3 ' (BamHI), P6：5’- CCCCTCGAGTTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTT CTCCTCG-3 ' (XhoI), Ya Ke It is grand enter slow virus carrier pLEX-MCS, obtain Lentiviral pLEX-dnActRIIB, the ActRIIB of truncation can be expressed, That is 7-100 amino acids sequence.

It is the IgG-Fc genetic fragments of AgeI and XhoI restriction enzyme sites respectively by upstream and downstream, and through AgeI and XhoI double digestions PLEX-dnActRIIB large fragments be attached, obtain recombinant plasmid pLEX-dnActRIIB-IgG Fc, can express band IgG- The truncated-type 7-100aa ActRIIB sequence dnActRIIB-IgG Fc of Fc labels.

The 79th amino acids of dnActRIIB-IgG Fc sequences are relied into ammonia using Stratagene site-directed mutagenesis kits Sour L difference rite-directed mutagenesis is proline P and glutamic acid E, builds pLEX-dnActRIIB-IgG Fc- respectively after sequencing identification L79P, pLEX-dnActRIIB-IgG Fc-L79E slow virus recombinant expression plasmids.The stabilization expresses ActRIIB genes and prominent The screening of variant cell line, is that the slow virus recombinant expression plasmid transfection 293T of the ActRIIB of above-mentioned structure and mutant is thin Born of the same parents, carry out the packaging of slow virus, and infect sheep Primary myoblasts, obtain stable expression sheep ActRIIB total lengths and mutation The sarcoblast system of body：A, 293T cell culture：37 DEG C of condition, 5% CO₂, complete medium（DMEM+10% tire ox blood Clearly）, six orifice plates paving 6-7 × 10 per hole⁵Individual cell, cell confluency degree reaches 80-90% after 20 hours；b、Lipofectamine 2000 liposome transfections：After the Opti-MEM culture mediums for adding 250 μ L preheatings, transfection carrier is separately added into following ratio pLEX-ActRIIB、pLEX-dnActRIIB-IgG Fc、pLEX-dnActRIIB-IgG Fc-L79P、pLEX-dnActRIIB- IgG Fc-L79E 2ug, packaging plasmid psPAX2 1.5ug, envelope plasmid pMD2G 0.5ug, gently mix；Separately take 250 μ L Opti-MEM culture mediums, add 8 μ L liposomes thereto, and room temperature is placed after 5min, the good DNA of above-mentioned dilution is mixed with liposome Close, be placed in incubation at room temperature 20min；During this period, clean cell to be transfected once with Opti-MEM culture mediums, by liposome and DNA compounds add cell；Tissue Culture Plate is put back in 37 DEG C of incubators and is incubated；After 2-4 hours, liposome and DNA are removed Compound, the fresh nutrient solutions of 2ml are added in every hole, are again put back in 37 DEG C of incubators Tissue Culture Plate and are cultivated；C, virus Packaging：The supernatant containing slow virus is collected after culture 48h, is filtered with 0.45 μm of filter, filtered solution is collected, now virus can It is used directly to infection or -70 DEG C freezes.Cell is collected, albumen is extracted and carries out Western blotting detection ActRIIB total lengths With the expression of ActRIIB mutant.D, virus infection：4.5-5 × 10 are spread in 6 orifice plates per hole⁵Individual sheep Primary myoblasts； 24h discards nutrient solution when degree of converging reaches 70% or so, add 500ul collect virus, 500ul complete mediums, while plus Enter 1uL polybrene, final concentration reaches 10ug/mL, cell is placed in 5% CO₂, cultivate in 37 DEG C of incubators；E, stabilization are thin The screening of born of the same parents system：Virus is discarded after virus infection 24h, by the cell in 6 orifice plates, the digestion of 0.05% pancreatin is transferred in 10cm culture dishes, After cell is completely adherent, adds 0.25 μ g/mL Puromycin and screened.In order to obtain the table of stable integration foreign gene Up to cell line, the selective medium containing Puromycin was changed every 2-3 days, while setting normal cell controls group, control group Complete cell death, the cell that experimental group is survived is the cell for infecting foreign gene.It can generally obtain within 7-10 days steady Surely the cell transfected, is continued to expand culture, takes part cell to carry out Western blotting detections.It is of the present invention Sheep ActRIIB genes three kinds of mutant, mutant form be amino-terminal truncated version and single base mutation.

In the embodiment of the present invention, the application of the clone sheep activin II receptors gene and its mutant stablizes The effect that the cell line of expression ActRIIB genes and mutant grows to sheep Primary myoblasts, is by the steady of above-mentioned screening Surely the cell of ActRIIB total lengths and mutant protein is expressed, respectively with 2 × 10³Individual cell/be seeded to per hole in 96 orifice plates, often Plant cell and set 4 multiple holes, while setting blank control group, utilize Cell Counting Kit-8 methods to determine cell growth curve. Respectively added per hole to experimental group and cellular control unit in the 10 μ L reagents of CCK- 8,37 DEG C of incubators every 24h and be incubated 4h, enzyme mark Instrument determines the absorbance at 450 nm wavelength, METHOD FOR CONTINUOUS DETERMINATION 7 days.The average value in 4 holes is sought, by abscissa of cell culture number of days, OD₄₅₀It is worth and draws cell growth curve for ordinate.

It is that the application of sheep ActRIIB genes lays the foundation present invention obtains sheep ActRIIB gene orders；Also wrap Acquisition sheep ActRIIB Gene Fusions are included to the IgG molecule rock-steady structures domain i.e. soluble ActRIIB mutant of Fc domains, It includes the ActRIIB mutant of amino-terminal truncated version and the mutant of single base mutation.It yet there are no any sharp on sheep Activin acceptor IIB genes and mutant research report, and the present invention has found that ActRIIB and mutant are former to sheep in cellular level It is further to explore ActRIIB mutant during domestic animal muscle cell Growth and Differentiation for the proliferation function of sarcoblast Effect and ActRIIB mutant block the Study on Molecular Mechanism of MSTN signal paths to lay the foundation.

The clone ActRIIB of embodiment 1 gene coding regions full length cDNA sequence

(1) laboratory sample collection and Total RNAs extraction

Sheep liver organization is gathered, is fitted into cryopreservation tube and is immediately placed in preserve in liquid nitrogen and take back.About 100mg is taken to organize sample Moved to after being ground in liquid nitrogen in 1.5 mL centrifuge tubes, add 1 mL Trziol reagents, 5 min are stored at room temperature, according to Trizol Kit operation instruction carries out the extraction of total serum IgE.

(2) RT-PCR

According to the reverse transcription reagent box specification of the precious biotech firm in Dalian, reverse transcription is carried out to sheep liver organization RNA, instead Transcription refers to specification progress.

(3) design of primers

With reference to the ActRIIB sequences for the ox announced in ncbi database（GenBank Accession No. U57707）, Utilize Oligo6.0 Software for Design sheep Ovine ActRIIB cloning primers, P1：5’-GGCACCGCGGAACATGACG GCGCCCTGGGCGGCCC-3 ', P2：5 '-GTGTCCTGGGCTTAGATGCTCGACTC-3 ', such as the institute of sequence table 5 in sequence table Show, sheep ActRIIB full length sequences are expanded by RT-PCR method.

(4) PCR is expanded

PCR amplification system：5 × Buffer 10 μ L, dNTP2.5mm, the 4 equal 1 μ L of μ L, P1, P2,10 μm of ol/L, Gao Bao True archaeal dna polymerase 0.5 μ L, cDNA 2 μ L moisturizings to 50 μ L；PCR amplification programs：95 DEG C of pre-degeneration 10min；95 DEG C of 30 s of denaturation, 60 DEG C of annealing 45s, 72 DEG C of 90 s of extension, 35 circulations；10 min of last 72 DEG C of extensions.PCR primer is coagulated with 1% agarose Gel electrophoresis are detected that electrophoresis result is shown in Fig. 1.

(5) clone and be sequenced

The amplified productions of sheep ActRIIB genes is carried out after recovery purifying, using T4 DNA ligases by itself and pMD- 18T carriers are connected, Transformed E .coli DH5 α；Screened using ampicillin plate, and with PCR methods and Restriction Enzyme cutting method Identification, positive colony sequencing is completed by Shanghai bioengineering Co., Ltd；Positive plasmid after sequencing identification is named as pMD 18T-ActRIIB, sequencing result is shown in sequence table 1 in sequence table, while this sequence is committed into GeneBank, the number of logging in is： JX422071.1。

The rite-directed mutagenesis of the ActRIIB genes of embodiment 2 and the structure of slow virus carrier

Fig. 2 and Fig. 3 are referred to, the sheep ActRIIB full length sequences obtained according to embodiment 1 design primer P1, P2, will Target gene is cloned into Lentiviral, obtains sheep ActRIIB Gene Lentiviral Vectors；Simultaneously with PMD 18T- ActRIIB plasmids are template, design primer P3, P4, build the 7-100aa ActRIIB sequences truncated and insert slow virus carrier PLEX-MCS, names pLEX-dnActRIIB；By the existing IgG-Fc genetic fragments in laboratory through AgeI and XhoI double digestions, glue Target gene fragment is reclaimed, is attached with the pLEX-dnActRIIB of same AgeI and XhoI double digestions, recombinant plasmid is obtained PLEX-dnActRIIB-IgG Fc, pass through double digestion and sequencing identification recombinant plasmid；Reagent is mutated using Stratagene companies The 79th amino acids lysine L difference rite-directed mutagenesises of dnActRIIB-IgG Fc sequences are proline P and glutamic acid E by box, Build pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E respectively after sequencing identification sick slowly Malicious recombinant expression plasmid.Comprise the following steps that：

(1) design of primers：

According to sequencing result design clone ActRIIB to the primer of Lentiviral, sense primer P3：5’- ATAGGATCCGCACCGCGGAACATGACGGCGCCCTG-3 ' BamH I, anti-sense primer P4：5’- GGCGCGGCCGCTTAAGCGTAGTCTGGGACGTCGTATGGGTAGATGCTCGACTC-3’ NotⅠ；Upstream is designed simultaneously to draw Thing P5：5’-GCCGGATCCATGGCCCTCGCCCTCCTCTG -3 ' BamH I, anti-sense primer P6：5’- CCCCTCGAGTTAAGCGTAGTCTGGGACGTCGTATGGGTAG TACACCTGGGGGTTCTCCTCG-3 ' Xho I, black is just Body is HA-Tag, builds the 7-100aa ActRIIB sequences truncated and inserts slow virus carrier pLEX-MCS, such as the institute of sequence table 6 Show.

（2）Build Lentiviral：

1. Lentiviral pLEX-ActRIIB structure：

Using pMD 18T-ActRIIB as template, it is utilized respectively specific upstream and downstream primer P1, P2 and enters performing PCR reaction, its is anti- The system is answered to be:1 μ L pMD 18T-ActRIIB plasmids, 2.5 μ 10 × PCR of L buffer, the 2 μ L equal 2.5mM of dNTP, upstream and downstream The equal 1 μ L of the mM of primer 10,1 μ L DMSO, 1UTaq enzymes use ddH₂O is adjusted to 25 μ L.PCR reaction conditions are：95 DEG C of 5min, 95 DEG C 30 s, 61 DEG C of 45 s, 72 DEG C of 90 s, 35 circulations, 72 DEG C of 10 min；The μ L of pcr amplification product 5 are taken through 1% agarose Detected through gel electrophoresis.BamH I and the double digestions of Not I, glue reclaim purpose fragment, with same BamH I and the pLEX- of the double digestions of Not I MCS carriers are attached, connection product Transformed E .coli DH5 α；Plate screening is carried out using ampicillin, and with PCR Method and the identification of Restriction Enzyme cutting method.After sequence verification, recombinant plasmid pLEX-ActRIIB is obtained.

2. Lentiviral pLEX-dnActRIIB-Fc structure：

A, using pMD 18T-ActRIIB plasmids as template, enter performing PCR using specific forward primer P5, anti-sense primer P6 React, its reaction system is:1 μ L pMD-18T-ActRIIB plasmids, 2.5 μ 10 × PCR of L buffer, 2 μ L dNTP （2.5mM each）, the equal 1 μ L of the mM of upstream and downstream primer 10,1 μ L DMSO, 1U Taq enzymes use ddH₂O is adjusted to 25 μ L.PCR reacts Condition is：95 DEG C of 5min, 95 DEG C of 30 s, 61 DEG C of 30 s, 72 DEG C of 30 s, 35 circulations, 72 DEG C of 10 min；PCR is taken to expand The volume increase μ L of thing 5 are detected through agarose gel electrophoresis.BamH I and the double digestions of Xho I, glue reclaim target gene fragment, it is and same The pLEX-MCS carriers of BamH I and the double digestions of Xho I are attached, connection product Transformed E .coli DH5 α；Utilize ammonia benzyl mould Element carries out plate screening, and identifies that sequencing identification obtains recombinant plasmid pLEX- with PCR methods and Restriction Enzyme cutting method dnActRIIB。

B, by upstream and downstream be respectively AgeI and XhoI restriction enzyme sites IgG-Fc genetic fragments, and through the double enzymes of AgeI and XhoI The pLEX-dnActRIIB large fragments cut are attached, connection product Transformed E .coli DH5 α；Put down using ampicillin Screen is selected, and is identified with PCR methods and Restriction Enzyme cutting method.After sequence verification, recombinant plasmid pLEX- is obtained DnActRIIB-IgG-Fc, sequencing result is shown in sequence table 2 in sequence table.

(3) ActRIIB site-directed point mutations

1. design of primers

Utilize http://www.genomics.agilent.com/primerDesignProgram.jsp Photographing On-lines draw Thing, by the 79th amino acids lysine (L) of ActRIIB gene orders, rite-directed mutagenesis is proline (P) and glutamic acid respectively (E).L79P upstream and downstream primer is respectively：Sense primer P7：5’-GAAGGGCTGCTGGCCGGACGACTTCAACT-3’；Under Swim primer P8：5’-AGTTGAAGTCGTCCGGCCAGCAGCCCTTC-3’；L79E upstream and downstream primer is respectively：Sense primer P9：5’-CAAGAAGGGCTGCTGGGAGGACGACTTCAACTGC-3’；Anti-sense primer P10：5’- GCAGTTGAAGTCGTCCTCCCAGCAGCCCTTCTTG-3 ', as shown in sequence table 7 in sequence table.

2. PCR is expanded

Enter performing PCR amplification using Stratagene site-directed mutagenesis kits, system is：10 × Buffer 5 μ L, dNTP （2.5mM each）, 4 μ L, equal μ L, the pfu Ultra HF of 1.25 μ L, pLEX-dnActRIIB-Fc plasmid 1 of upstream and downstream primer The μ L of archaeal dna polymerase 1.0, moisturizing to 50 μ L；PCR response procedures：95 DEG C of s of pre-degeneration 30；95 DEG C of 30 s of denaturation, 55 DEG C of annealing 60s, 68 DEG C of extension 12min, 16 circulations；Last 4 DEG C of 5 min.

3. digest

Take 1.0 μ L DpnI restriction endonucleases to add in above-mentioned 50 μ L pcr amplification products to mix, 37 DEG C of water-bath 3h.

4. convert

A, take 50 μ L XL 1-Blue competent cells to be placed on ice, add the PCR primer that digests in 5 μ L steps 3 and mix, Ice bath 30min.

Ice bath 2min after b, 42 DEG C of water-bath 45s, adds after 500 μ L SOC culture mediums are mixed and is placed in 37 DEG C of shaking table concussion and cultivates 1h, rotating speed：200rpm.

C, using ampicillin carry out plate screening, picking single bacterium drop down onto after SOC culture medium shaken cultivations 12-16h survey Sequence identifies that the positive slow virus recombinant expression plasmid of acquisition is named as：pLEX-dnActRIIB-IgG Fc-L79P、pLEX- DnActRIIB-IgG Fc-L79E, sequencing result is shown in sequence table 3 and sequence table 4 in sequence table.

The screening of the stable expression ActRIIB genes of embodiment 3 and mutant protein cell line

Referring to Fig. 4, it is thin that the slow virus recombinant expression plasmid of the ActRIIB of above-mentioned structure and mutant is transfected into 293T Born of the same parents, carry out the packaging of slow virus, and the sheep sarcoblast that infector generation is separately cultured, and obtain stable expression sheep ActRIIB With the sarcoblast system of three kinds of ActRIIB mutant：

Recombinant slow virus step is packed in 293T cells：

（1）1st day：293T cell culture conditions：

37 DEG C, 5% CO₂, culture medium is using DMEM+10% hyclone, six orifice plates paving 6-7 × 10 per hole⁵Individual 293T Cell, it is ensured that cell degree of converging in complete culture solution reached 80-90% in the 2nd day；

（2）2nd day：The liposome transfections of Lipofectamine 2000：

First, liposome and DNA compounds are prepared in 24 orifice plates.

After the Opti-MEM culture mediums for adding 250 μ L preheatings, purpose carrier pLEX- is separately added into following ratio ActRIIB、pLEX-dnActRIIB-IgG Fc、pLEX-dnActRIIB-IgG Fc-L79P、pLEX-dnActRIIB-IgG Fc-L79E and viral package carrier.

The ug of transfection carrier 2

Packaging plasmid pSPAX2 1.5ug

Envelope plasmid pMD2G 0.5ug

Liposome is gently first mixed before using Lipofectamine 2000,250 μ L are then added in 24 orifice plates The Opti-MEM culture mediums of preheating, add 8ul Lipofectamine 2000, and room temperature is placed after 5min after gently mixing, will The good DNA of above-mentioned dilution is mixed with liposome, and mixture is placed in incubation at room temperature 20min；During this period, Opti-MEM culture mediums are used Cell to be transfected in six orifice plates is cleaned once, liposome and DNA compounds to be added into cell, Tissue Culture Plate is put back into 37 DEG C of trainings Support in case and be incubated, after 2-4 hours, remove liposome and DNA compounds, the fresh nutrient solutions of 2ml are added in six orifice plates are per hole, Again Tissue Culture Plate is put back in 37 DEG C of incubators and cultivated.

（3）4th day：Collect virus

The cell culture supernatant containing slow virus is collected after culture 48h.Cell conditioned medium is filtered with 0.45 μm of filter, received Collect filtered solution, now virus can be used directly to infection or -70 DEG C freeze.Cell is collected, albumen is extracted and carries out Western Blotting detects the expression of ActRIIB full length genes and each mutant of ActRIIB, detect respectively 53KDa, 38KDa, 38KDa, 38KDa protein band, it is in the same size with expection.

（4）Virus infection：In 6 orifice plate middle berth 4.5-5 × 10⁵Individual sheep Primary myoblasts；Next day, degree to be converged reached When 70% or so, nutrient solution is discarded, 500ul is added and collects virus, 500ul complete mediums, while 1ul polybrene are added, Final concentration reaches 10ug/ml, and cell is placed in into 5% CO₂, 37 DEG C of incubator cultures.

（5）Stable cell lines are screened：Discarded after virus infection 24h, the digestion of 0.05% pancreatin is transferred in 10cm culture dishes, is treated Cell completely it is adherent after, add 0.25 μ g/mL Puromycin screened.In order to obtain the expression of stable integration foreign gene Cell line, the selective medium containing Puromycin was changed every 2-3 days, while setting normal cell controls group, normal cell Control group is all dead, and the cell that experimental group is survived is the cell for infecting foreign gene, can be obtained within usual 7-10 days The cell of stable transfection.

The cell line of the stable expression ActRIIB genes of embodiment 4 and mutant is in the growth of sheep Primary myoblasts Effect

Referring to Fig. 5, in order to compare the upgrowth situation of ActRIIB genes and mutant cells system, ActRIIB genes and prominent Effect of the variant in the growth of sheep Primary myoblasts, carries out growth bent by the stable cell line for infecting target gene of acquisition The drafting of line, experiment is divided into 4 groups, surveys 7 days.Cell is determined using CCK-8 methods to breed, and is comprised the following steps that：

（1）The cell line of the stable infection target gene of acquisition is reached that 90% or so is digested and counted in degree of converging Number, is inoculated in 96 well culture plates, 4 repetitions of every group of setting are placed in 5% CO with every 2000 cells in hole respectively₂, 37 DEG C of cultures Cultivated in case.Meanwhile, set containing only the not celliferous control wells of culture medium, obtain background luminescence value, determine 7 times, i.e., the 0th day extremely 6th day, 7 orifice plates of identical 96 need to be spread.

（2）After cell is completely adherent, 10 μ l CCK-8 reagents are added to every hole cell, incubator is placed in and is incubated 3.5-4h Afterwards, the extinction at 450nm wavelength is determined using ELIASA.

（3）Determined once every 24h, a nutrient solution, METHOD FOR CONTINUOUS DETERMINATION 7 days, finally the numerical value of 7 days were changed every 2 days Drafting pattern, produces one using cell culture number of days as abscissa, OD₄₅₀It is worth the cell growth curve for ordinate.As a result table Bright, the sarcoblast of three kinds of mutant of stable expression is than the high cell growth speed of stable expression ActRIIB total lengths.With SPSS13.0 softwares carry out significance difference analysis, show that the 0th day four kinds of cell growth differences of bed board are not notable；Stable expression PLEX-dnActRIIB-Fc-L79P1 cell is compared with stable expression pLEX-dnActRIIB-Fc-L79E3 cells, 1-6 Its difference is not notable, P ＞ 0.05；Stable expression pLEX-dnActRIIB-Fc-L79P1, pLEX-dnActRIIB-Fc- L79E3 cells are dramatically speeded up than stable expression pLEX-dnActRIIB-Fc, pLEX-ActRIIB vitro growth rates, the 1st day Difference is notable, P ＜ 0.05, and inequality heteropole is notable within the 2-6 days, P ＜ 0.01.

It is obvious to a person skilled in the art that the invention is not restricted to the details of above-mentioned one exemplary embodiment, Er Qie In the case of without departing substantially from spirit or essential attributes of the invention, the present invention can be realized in other specific forms.Therefore, no matter From the point of view of which point, embodiment all should be regarded as exemplary, and be nonrestrictive, the scope of the present invention is by appended power Profit is required rather than described above is limited, it is intended that all in the implication and scope of the equivalency of claim by falling Change is included in the present invention.

Moreover, it will be appreciated that although the present specification is described in terms of embodiments, not each embodiment is only wrapped Containing an independent technical scheme, this narrating mode of specification is only that for clarity, those skilled in the art should Using specification as an entirety, the technical solutions in the various embodiments may also be suitably combined, forms those skilled in the art It may be appreciated other embodiment.

Sequence table 1：The sequencing result of PMD 18T-ActRIIB genes

ATGACGGCGCCCTGGGCGGCCCTCGCCCTCCTCTGGGGATCGCTGTGCGCCGGTTCCGGGCGCGGGGAGGCCGAGAC GCGG 81

1 M T A P W A A L A L L W G S L C A G S G R G E A E T R

GAGTGCATCTACTACAACGCCAACTGGGAGCTGGAGCGCACCAACCAGAGCGACCTGGAGCGCTGTGAGGGCGAGCG GGAC 162

28 E C I Y Y N A N W E L E R T N Q S D L E R C E G E R D

AAGCGGCTGCACTGCTACGCCTCCTGGCGCAACAGCTCGGGCACCATCGAGCTCGTCAAGAAGGGCTGCTGGCTGGA CGAC 243

55 K R L H C Y A S W R N S S G T I E L V K K G C W L D D

TTCAACTGCTACGACAGGCAGGAGTGCGTGGCCACCGAGGAGAACCCCCAGGTGTACTTCTGCTGCTGCGAAGGCAA CTTC 324

82 F N C Y D R Q E C V A T E E N P Q V Y F C C C E G N F

TGCAACGAGCGCTTCACCCACCTTCCCGAGGCGGGCGGCCCAGAAGTCACGTACGAGCCACCCCCGACAGCCCCCAC CCTG 405

109 C N E R F T H L P E A G G P E V T Y E P P P T A P T L

CTCACTGTGCTGGCCTACTCGCTGCTGCCCGTCGGGGGCCTCTCCCTCATTGCCCTGCTGGCCTTCTGGATGTACCG ACAT 486

136 L T V L A Y S L L P V G G L S L I A L L A F W M Y R H

CGCAAGCCCCCCTACGGCCACGTGGACATCCACGAGGACCCTGGACCTCCACCCCCGTCCCCTCTGGTGGGCCTGAA GCCT 567

163 R K P P Y G H V D I H E D P G P P P P S P L V G L K P

CTGCAGCTGCTGGAGATCAAGGCTCGGGGGCGCTTCGGTTGTGTCTGGAAGGCGCAGCTCATGAACGACTTCGTGGC TGTC 648

190 L Q L L E I K A R G R F G C V W K A Q L M N D F V A V

AAGATCTTCCCACTCCAGGACAAGCAGTCGTGGCAGAGTGAGCGGGAGATCTTCAGCACGCCTGGCATGAAGCACGA GAAC 729

217 K I F P L Q D K Q S W Q S E R E I F S T P G M K H E N

CTGCTGCAGTTCATTGCCGCTGAGAAGCGAGGCTCCAGCCTGGAGGCGGAGCTGTGGCTCATCACAGCCTTCCACGA CAAG 810

244 L L Q F I A A E K R G S S L E A E L W L I T A F H D K

GGCTCCCTCACGGATTACCTCAAGGGGAACATCATCACATGGAACGAGCTGTGTCACGTGGCGGAGACCATGTCTAG AGGC 891

271 G S L T D Y L K G N I I T W N E L C H V A E T M S R G

CTCTCATACCTACACGAGGATGTGCCCTGGTGCCGGGGCGAGGGCCACAAGCCGTCTATTGCCCACAGGGACTTCAA GAGC 972

298 L S Y L H E D V P W C R G E G H K P S I A H R D F K S

AAGAATGTATTGCTGAAGAGTGACCTCACTGCTGTGCTGGCTGACTTTGGCCTGGCTGTTCGGTTTGAGCCAGGGAA ACCT 1053

325 K N V L L K S D L T A V L A D F G L A V R F E P G K P

CCGGGGGACACTCACGGGCAGGTGGGCACGCGGCGGTACATGGCCCCCGAGGTGCTCGAGGGAGCCATCAACTTCCA GAGA 1134

352 P G D T H G Q V G T R R Y M A P E V L E G A I N F Q R

GACGCCTTTCTGCGCATCGACATGTACGCCATGGGGCTGGTGCTCTGGGAGCTCGTGTCCCGCTGCAAAGCTGCCGA CGGA 1215

379 D A F L R I D M Y A M G L V L W E L V S R C K A A D G

CCTGTGGATGAGTACATGCTGCCTTTTGAGGAGGAGATCGGCCAGCACCCGTCACTGGAGGAGCTGCAGGAGGTTGT GGTG 1296

406 P V D E Y M L P F E E E I G Q H P S L E E L Q E V V V

CATAAGAAGATGCGGCCGGCCATCAAGGATCACTGGCTGAAACACCCGGGCCTGGCCCAGCTCTGCGTGACAATCGA GGAG 1377

433 H K K M R P A I K D H W L K H P G L A Q L C V T I E E

TGCTGGGACCACGACGCGGAGGCTCGCCTGTCCGCGGGCTGCGTGGAGGAGCGAGTGTCCCTGATTCGGAGGTCGGT CAAC 1458

460 C W D H D A E A R L S A G C V E E R V S L I R R S V N

GGCACTACCTCGGACTGTCTCGTCTCCCTGGTGACCTCCGTCACCAACGTGGACCTGCCCCCGAAGGAGTCGAGCAT CTAA 1539

487 G T T S D C L V S L V T S V T N V D L P P K E S S I -

Sequence table 2：The sequencing result of pLEX-dnActRIIB-IgG Fc genes

ATGGCCCTCGCCCTCCTCTGGGGATCGCTGTGCGCCGGTTCCGGGCGCGGGGAGGCCGAGACGCGGGAGTGCATCTA CTAC 81

1 M A L A L L W G S L C A G S G R G E A E T R E C I Y Y

AACGCCAACTGGGAGCTGGAGCGCACCAACCAGAGCGACCTGGAGCGCTGTGAGGGCGAGCGGGACAAGCGGCTGCA CTGC 162

28 N A N W E L E R T N Q S D L E R C E G E R D K R L H C

TACGCCTCCTGGCGCAACAGCTCGGGCACCATCGAGCTCGTCAAGAAGGGCTGCTGGCTGGACGACTTCAACTGCTA CGAC 243

55 Y A S W R N S S G T I E L V K K G C W L D D F N C Y D

AGGCAGGAGTGCGTGGCCACCGAGGAGAACCCCCAGGTGTACTACCCATACGACGTCCCAGACTACGCTCTCGAGCC CAGA 324

82 R Q E C V A T E E N P Q V Y Y P Y D V P D Y A L E P R

GGGCCCACAATCAAGCCCTGTCCTCCATGCAAATGCCCAGCACCTAACCTCTTGGGTGGACCATCCGTCTTCATCTT CCCT 405

109 G P T I K P C P P C K C P A P N L L G G P S V F I F P

CCAAAGATCAAGGATGTACTCATGATCTCCCTGAGCCCCATAGTCACATGTGTGGTGGTGGATGTGAGCGAGGATGA CCCA 486

136 P K I K D V L M I S L S P I V T C V V V D V S E D D P

GATGTCCAGATCAGCTGGTTTGTGAACAACGTGGAAGTACACACAGCTCAGACACAAACCCATAGAGAGGATTACAA CAGT 567

163 D V Q I S W F V N N V E V H T A Q T Q T H R E D Y N S

ACTCTCCGGGTGGTCAGTGCCCTCCCCATCCAGCACCAGGACTGGATGAGTGGCAAGGAGTTCAAATGCAAGGTCAA CAAC 648

190 T L R V V S A L P I Q H Q D W M S G K E F K C K V N N

AAAGACCTCCCAGCGCCCATCGAGAGAACCATCTCAAAACCCAAAGGGTCAGTAAGAGCTCCACAGGTATATGTCTT GCCT 729

217 K D L P A P I E R T I S K P K G S V R A P Q V Y V L P

CCACCAGAAGAAGAGATGACTAAGAAACAGGTCACTCTGACCTGCATGGTCACAGACTTCATGCCTGAAGACATTTA CGTG 810

244 P P E E E M T K K Q V T L T C M V T D F M P E D I Y V

GAGTGGACCAACAACGGGAAAACAGAGCTAAACTACAAGAACACTGAACCAGTCCTGGACTCTGATGGTTCTTACTT CATG 891

271 E W T N N G K T E L N Y K N T E P V L D S D G S Y F M

TACAGCAAGCTGAGAGTGGAAAAGAAGAACTGGGTGGAAAGAAATAGCTACTCCTGTTCAGTGGTCCACGAGGGTCT GCAC 972

298 Y S K L R V E K K N W V E R N S Y S C S V V H E G L H

AATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGTAAATAA 1017

325 N H H T T K S F S R T P G K -

Sequence table 3：The sequencing result of pLEX-dnActRIIB-IgG Fc-L79P genes

1 M A L A L L W G S L C A G S G R G E A E T R E C I Y Y

28 N A N W E L E R T N Q S D L E R C E G E R D K R L H C

TACGCCTCCTGGCGCAACAGCTCGGGCACCATCGAGCTCGTCAAGAAGGGCTGCTGGCCGGACGACTTCAACTGCTA CGAC 243

55 Y A S W R N S S G T I E L V K K G C W P D D F N C Y D

82 R Q E C V A T E E N P Q V Y Y P Y D V P D Y A L E P R

109 G P T I K P C P P C K C P A P N L L G G P S V F I F P

136 P K I K D V L M I S L S P I V T C V V V D V S E D D P

163 D V Q I S W F V N N V E V H T A Q T Q T H R E D Y N S

190 T L R V V S A L P I Q H Q D W M S G K E F K C K V N N

217 K D L P A P I E R T I S K P K G S V R A P Q V Y V L P

244 P P E E E M T K K Q V T L T C M V T D F M P E D I Y V

271 E W T N N G K T E L N Y K N T E P V L D S D G S Y F M

298 Y S K L R V E K K N W V E R N S Y S C S V V H E G L H

AATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGTAAATAA 1017

325 N H H T T K S F S R T P G K -

Sequence table 4：The sequencing result of pLEX-dnActRIIB-IgG Fc-L79E genes

1 M A L A L L W G S L C A G S G R G E A E T R E C I Y Y

28 N A N W E L E R T N Q S D L E R C E G E R D K R L H C

TACGCCTCCTGGCGCAACAGCTCGGGCACCATCGAGCTCGTCAAGAAGGGCTGCTGGGAGGACGACTTCAACTGCTA CGAC 243

55 Y A S W R N S S G T I E L V K K G C W E D D F N C Y D

82 R Q E C V A T E E N P Q V Y Y P Y D V P D Y A L E P R

109 G P T I K P C P P C K C P A P N L L G G P S V F I F P

136 P K I K D V L M I S L S P I V T C V V V D V S E D D P

163 D V Q I S W F V N N V E V H T A Q T Q T H R E D Y N S

190 T L R V V S A L P I Q H Q D W M S G K E F K C K V N N

217 K D L P A P I E R T I S K P K G S V R A P Q V Y V L P

CCACCAGAAGAAGAGATGACTAATAAACAGGTCACTCTGACCTGCATGGTCACAGACTTCATGCCTGAAGACATTTA CGTG 810

244 P P E E E M T N K Q V T L T C M V T D F M P E D I Y V

271 E W T N N G K T E L N Y K N T E P V L D S D G S Y F M

298 Y S K L R V E K K N W V E R N S Y S C S V V H E G L H

AATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGTAAATAA 1017

325 N H H T T K S F S R T P G K -

Sequence table 5:With reference to the ActRIIB sequences of ox（GenBank Accession No. U57707）Utilize Oligo6.0 Software for Design sheep Ovine ActRIIB cloning primers

Cloning primer P1：5'-GGCACCGCGGAACATGACGGCGCCCTGGGCGGCCC-3'

Cloning primer P2：5'-GTGTCCTGGGCTTAGATGCTCGACTC-3'

Sequence table 6:Clone ActRIIB, the ActRIIB truncated to Lentiviral primer

P3：5'-ATAGGATCCGCACCGCGGAACATGACGGCGCCCTG-3'(BamH I)

P4：5'-GGCGCGGCCGCTTAAGCGTAGTCTGGGACGTCGTATGGGTAGATGCTCGACTC-3'（NotⅠ）

P5：5'-GCCGGATCCATGGCCCTCGCCCTCCTCTG（BamHⅠ）-3'

P6：5'-CCCCTCGAGTTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTTCTCCTCG- 3' (XhoI)

Sequence table 7:79th amino acids lysine of ActRIIB gene orders（L）Rite-directed mutagenesis is proline respectively （P）And glutamic acid（E）Design of primers

The forward primer P7 of L79P rite-directed mutagenesises：5'-GAAGGGCTGCTGGCCGGACGACTTCAACT-3'

The anti-sense primer P8 of L79P rite-directed mutagenesises：5'-AGTTGAAGTCGTCCGGCCAGCAGCCCTTC-3'

The forward primer P9 of L79E rite-directed mutagenesises：5'-CAAGAAGGGCTGCTGGGAGGACGACTTCAACTGC-3'

The anti-sense primer P10 of L79E rite-directed mutagenesises：5'-GCAGTTGAAGTCGTCCTCCCAGCAGCCCTTCTTG-3'

Claims

1. a kind of method of the sarcoblast of the sheep activin II receptor genes of acquisition L79P rite-directed mutagenesises, its feature exists In comprising the steps：

ActRIIB gene coding regions full length cDNA sequence is cloned, is comprised the following steps that：Sheep liver organization is gathered, Trizol is used Reagent extracts liver organization total serum IgE and reverse transcription, designs cloning primer, P1：5’- GGCACCGCGGAACATGACGGCGCCCTGGGCGGCCC-3 ', P2：5 '-GTGTCCTGGGCTTAGATGCTCGACTC-3 ', lead to RT-PCR method amplification sheep ActRIIB full length coding regions sequence is crossed, expected size fragment will be met and be cloned into pMD 18T loads Body, sequencing, positive plasmid is named as pMD 18T-ActRIIB；The structure of ActRIIB slow virus carriers, with pMD 18T- ActRIIB plasmids are template, with primer P3：5 '-ATAGGATCCGCACCGCGGAACATGACGGCGCCCTG-3 ', P4：5’- GGCGCGGCCGCTTAAGCGTAGTCTGGGACGTCGTATGG GTAGATGCTCGACTC-3 ', ActRIIB is subcloned to slow In virus expression carrier pLEX-MCS, Lentiviral pLEX-ActRIIB is obtained, the sheep of total length form can be expressed ActRIIB；

With primer P5：5 '-GCCGGATCCATGGCCCTCGCCCTCCTCTG-3 ', P6：5’- CCCCTCGAGTTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTTCT CCTCG-3 ', are subcloned into slow disease Poisonous carrier pLEX-MCS, obtains Lentiviral pLEX-dnActRIIB, can express the ActRIIB of truncation, i.e. 7-100 Amino acids sequence；

The 79th amino acids lysine of dnActRIIB-IgG Fc sequences is determined using Stratagene site-directed mutagenesis kits Point mutation is proline, and L79P rite-directed mutagenesis forward primers are P7：5 '-GAAGGGCTGCTGGCCGGACGACTTCAACT-3 ', Reverse primer is P8：5’-AGTTGAAGTCGTCCGGCCAGCAGCCCTTC-3’；Build and obtain pLEX-dnActRIIB- IgGFc-L79P slow virus recombinant expression plasmids；

The pLEX-dnActRIIB-IgG Fc-L79P slow virus recombinant expression plasmid of structure is transfected into 293T cells again, carried out slow The packaging of virus, and the sheep Primary myoblasts being separately cultured are infected, obtain sarcoblast.

2. a kind of method of the sarcoblast of the sheep activin II receptor genes of acquisition L79E rite-directed mutagenesises, its feature exists In comprising the following steps：

Clone ActRIIB gene coding regions full length cDNA sequence, it is comprised the following steps that：Sheep liver organization is gathered, is used Trizol reagents extract liver organization total serum IgE and reverse transcription, design cloning primer, P1：5’- GGCACCGCGGAACATGACGGCGCCCTGGGCGGCCC-3 ', P2：5 '-GTGTCCTGGGCTTAGATGCTCGACTC-3 ', lead to RT-PCR method amplification sheep ActRIIB full length coding regions sequence is crossed, expected size fragment will be met and be cloned into pMD 18T loads Body, sequencing, positive plasmid is named as pMD 18T-ActRIIB；The structure of ActRIIB slow virus carriers, with pMD 18T- ActRIIB plasmids are template, with primer P3：5 '-ATAGGATCCGCACCGCGGAACATGACGGCGCCCTG-3 ', P4：5’- GGCGCGGCCGCTTAAGCGTAGTCTGGGACGTCGTATGG GTAGATGCTCGACTC-3 ', ActRIIB is subcloned to slow In virus expression carrier pLEX-MCS, Lentiviral pLEX-ActRIIB is obtained, the sheep of total length form can be expressed ActRIIB；With primer P5：5 '-GCCGGATCCATGGCCCTCGCCCTCCTCTG-3 ', P6：5’- CCCCTCGAGTTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTTCT CCTCG-3 ', are subcloned into slow disease Poisonous carrier pLEX-MCS, obtains Lentiviral pLEX-dnActRIIB, can express the ActRIIB of truncation, i.e. 7-100 Amino acids sequence；

The 79th amino acids lysine of dnActRIIB-IgG Fc sequences is determined using Stratagene site-directed mutagenesis kits Point mutation is glutamic acid, and L79E rite-directed mutagenesis forward primers are P9：5’- CAAGAAGGGCTGCTGGGAGGACGACTTCAACTGC-3 ', reverse primer is P10：5’- GCAGTTGAAGTCGTCCTCCCAGCAGCCCTTCTTG-3’；Build and obtain pLEX-dnActRIIB-IgGFc-L79E slow virus Recombinant expression plasmid；

The pLEX-dnActRIIB-IgG Fc-L79E slow virus recombinant expression plasmid of structure is transfected into 293T cells again, carried out slow The packaging of virus, and the sheep Primary myoblasts being separately cultured are infected, obtain sarcoblast.

3. method according to claim 1 or 2, it is characterised in that the specific method of wherein final step is：

A, 293T cell culture：37 DEG C of condition, 5% CO₂, complete culture solution, and complete culture solution is DMEM+10% tire ox Serum, six orifice plates spread 6-7 × 10 per hole⁵Individual cell, cell confluency degree reaches 80-90% after 20 hours；

The liposome transfection of b, Lipofectamine 2000：After the Opti-MEM culture mediums for adding 250 μ L preheatings, in following ratio It is separately added into the slow virus recombinant expression plasmid 2ug, packaging plasmid 1.5ug, envelope plasmid pMD2G 0.5ug, gently mixes, 250 μ L Opti-MEM culture mediums separately are taken, 8 μ L liposomes are added thereto, room temperature is placed after 5min, by the good DNA of above-mentioned dilution Mixed with liposome, be placed in incubation at room temperature 20 minutes；During this period, cell to be transfected is cleaned once with Opti-MEM culture mediums, Liposome and DNA compounds are added into cell；Tissue Culture Plate is put back in 37 DEG C of incubators and is incubated；After 2-4 hours, fat is removed Plastid and DNA compounds, the fresh complete culture solutions of 2ml are added in every hole, Tissue Culture Plate is put back into 37 DEG C of incubators again Middle culture；

C, virus packaging：The supernatant containing slow virus is collected after packaging 48h, is filtered with 0.45 μm of filter, filtered solution is collected, this When virus can be used directly to infection or -70 DEG C freeze；Cell is collected, albumen is extracted and carries out Western blotting detections The expression of ActRIIB mutant；

D, virus infection：4.5-5 × 10 are spread in 6 orifice plates per hole⁵Individual sheep Primary myoblasts；Next day, degree to be converged reached 70% During left and right, nutrient solution is discarded, add 500ul and collect virus, 500ul complete mediums, while addition 1ul hexadimethrine bromides, Cell is placed in 5%CO₂, cultivate in 37 DEG C of incubators；

E, stable cell lines screening：Virus liquid is discarded after virus infection 24h, the cell that 0.05% pancreatin is digested in 6 orifice plates is transferred to In 10cm culture dishes, after cell is completely adherent, adds 0.25 μ g/mL puromycins and screened；Changed and contain every 2-3 days Puromycin selective medium, while setting normal cell controls group, cellular control unit is all dead, experimental group survival The cell got off is the cell for infecting foreign gene；The cell of stable transfection can be obtained within 7-10 days, be continued to expand training Support, take part cell to carry out Western blotting detections.