CN104087594A

CN104087594A - Method for acquiring sheep activin II-type receptor gene and mutant thereof and application of sheep activin II-type receptor gene and mutant thereof

Info

Publication number: CN104087594A
Application number: CN201410338143.3A
Authority: CN
Inventors: 刘明军; 张雪梅; 李文蓉; 张宁; 贺三刚; 吴阳升; 安静
Original assignee: CHINA AUSTRALIA SHEEP RESEARCH CENTER ANIMAL SCIENCE ACADEMY OF XINJIANG UYGUR AUTONOMOUS REGION
Current assignee: CHINA AUSTRALIA SHEEP RESEARCH CENTER ANIMAL SCIENCE ACADEMY OF XINJIANG UYGUR AUTONOMOUS REGION
Priority date: 2014-07-16
Filing date: 2014-07-16
Publication date: 2014-10-08
Anticipated expiration: 2034-07-16
Also published as: CN104087594B

Abstract

The invention discloses a method for acquiring a sheep activin II-type receptor gene and a mutant thereof and application of the sheep activin II-type receptor gene and the mutant thereof. The method for acquiring the sheep activin II-type receptor gene and the mutant thereof comprises the following steps: cloning a total-length cDNA sequence of a coding region of an ActRIIB gene; constructing ActRIIB and a fixed point mutant lentiviral vector; screening cell lines which can stably express the ActRIIB and the mutant thereof. The method for acquiring the sheep activin II-type receptor gene and the mutant thereof has the beneficial effects that an ActRIIB mutant has a proliferative effect on sheep primary sarcogenic cells at a cellular level and a foundation is laid for exploring of molecular mechanism research, related in a liverstock muscle cell growth differentiation process, of the ActRIIB.

Description

Obtain method and the application of sheep activator II receptor gene and mutant thereof

Technical field

The present invention relates to animal genetic engineering field, specifically a kind of method and application of obtaining sheep activator II receptor gene and mutant thereof.

Background technology

Activator is the glycoprotein hormones of finding as far back as sexual gland, belongs to transforming growth factor TGF-beta superfamily member, separated, purifying from the liquor folliculi of ox first in 1986.Activin receptor ActR belongs to the serine/threonine protein kitase receptor of TGF-beta superfamily member, and according to the characteristic on its structure and function, activin receptor can be divided into two classes, activator I type and II receptor.Activator II receptor is a kind of glycoprotein, is also a kind of acceptor of structure activated form.It is comprised of 510 amino acid, contain an outer ligand binding domains 1-135aa of N end born of the same parents that is rich in halfcystine, serine/threonine kinase structural domain 159-510aa in a hydrophobic transmembrane and born of the same parents, comprises two hypotypes, i.e. activator II receptor A and activator II receptor B.The demonstration of sequence alignment result, between different plant species, there is very high homology in activator IIB receptor, and the sequence homology of the ActRIIB of ox and people, mouse is respectively 93% and 91%.

Thereby after ActRIIB and ligand binding, raise I receptor and form the transduction of ligand receptor mixture startup downstream signal, II receptor plays the dual-use function of ligand binding and specific recognition, so the structure and function of II receptor receives much concern.Existing studies have shown that the signal transduction pathway of Myostatin is similar to TGF-'beta ' family member, is all that the heterodimer by I type and II type serine/threonine kinase acceptor carries out signal transduction.The same with TGF-'beta ' family member, first the signal conduction that Myostatin causes will be combined with II receptor, and then be combined with I receptor, once heterodimer receptor complex forms, II receptor makes I receptor phosphorylation, and the acceptor I of phosphorylation further makes intracellular transcription factor Smad2/3 phosphorylation, and the Smad2/3 of phosphorylation can be further and Smad4 combination, and enter nucleus, thereby regulate the expression of target gene.

ActRIIB has multiple ligands, as Myostatin, it belongs to TGF-beta superfamily member, is the negative regulatory factor of generally acknowledged muscle growth, can by with it in conjunction with regulating muscle growth, antagonism myostatin has been proved to be the thin muscle quality that can increase animal at present.And activin receptor IIB mutant is combined the mixture of rear formation and can not be combined with I receptor with MSTN, thereby can reach the conduction of blocking-up MSTN downstream signal, suppress the function of MSTN.

The effect of ActRIIB in Myostatin signal transduction obtained the further support of testing in body.The Se-Jin Lee of Johns Hopkins university etc. set up the transgenic mice of expressing non-active structure territory ActRIIB, although the acceptor in this non-active structure territory can with Myostatin combination, but owing to lacking intracellular kinase structural domain, ActRIIB can not be combined with I receptor, thereby therefore can not activate Smad protein function blocking-up Myostatin biological function, causing transgenic mice body weight to be compared with control mice increases by 25%.In addition, ActRIIB mutant by transgene expression can with MSTN competitive binding, block or weaken the combination of the endogenous ActRIIB on MSTN and cytolemma, thereby suppress downstream signal conduction, finally block or weaken the restraining effect of MSTN to muscle growth, causing transgenic mice muscle paraplasm loose.The ActRIIB of the use solubilities such as Samuel M injects the C57BL/6 mouse of 8 weeks, and the mean body weight of injecting afterwards mouse for 28 days has increased by 16 ﹪ than control group.Se-Jin Lee in 2005 etc. have reported again the Activin IIB acceptor of solubility have been injected in wild-type mice body, and in 2 weeks, mouse muscle increases by 60% than control group.The expression of ActRIIB mutant on transgenic mouse causes that skeletal muscle is loose, illustrates that ActRIIB acceptor is playing keying action aspect adjusting muscle hypertrophy.2010, the utilization biotechnologies such as Xiaolan Zhou have been manufactured a soluble receptor body protein that is sActRIIB, the i.e. macromole Experimental agents that can simultaneously block myostatin and activin A, and be expelled in normal mouse muscle and cancer model mouse muscle, although found that not impact of tumor growth rate, and the not impact of increasing also on fatty loss and inflammatory factor, but effectively reversed muscle, melt, result causes the survival time of colorectal carcinoma mouse greatly to extend.In addition, Raouia etc. studies confirm that, ActRIIB mutant protein is compared with natural ActRIIB albumen, and the former can significantly increase myogenous cells quantity.These results suggest ActRIIB mutant may promote muscle growth by suppressing the genetic expression of Myostatin.

Due to what reported at present, for ActRIIB mutant blocking-up myostatin, promote the result of study of muscle growth mostly to concentrate on low grade on vertebrates and mouse, research on the large animals such as livestock and poultry has no report, and lack at present sheep ActRIIB full length sequence, therefore, clone sheep activator II receptor gene, resolve ActRIIB gene and the effect of mutant in domestic animal muscle cell process of growth thereof, for developing from now on short muscle growth preparation or transgenic animal, lay the foundation, also for improving domestic animal meat production, provide new thinking.

Summary of the invention

The object of the present invention is to provide a kind of method and application of obtaining sheep activator II receptor gene and mutant thereof, to solve the problem proposing in above-mentioned background technology.

For achieving the above object, the invention provides following technical scheme:

Obtain a method for sheep activator II receptor full length gene coding region and mutant thereof, comprise ActRIIB coding region full length cDNA sequence clone; The rite-directed mutagenesis of ActRIIB gene and the structure of lentiviral vectors; The screening of stably express ActRIIB and mutant cells system; Described clone ActRIIB gene coding region full length cDNA sequence, gather sheep liver organization, with Trizol reagent, extract the total RNA of liver organization reverse transcription, design clone primer P1:5 '-GGCACCGCGGAACATGACGGCGCCCTGGGCGGCCC-3 ', P2:5 '-GTGTCCTGGGCTTAGATGCTC GACTC-3 ', by RT-PCR method amplification sheep ActRIIB full length coding region sequence, to meet the big or small fragment of expection and be cloned into pMD 18T carrier, order-checking, positive plasmid called after pMD 18T-ActRIIB; The structure of described ActRIIB and rite-directed mutagenesis type lentiviral vectors thereof, the pMD 18T-ActRIIB plasmid of take is template, with primer P3:5 '-ATA gGATCC gCACCGCGGAACATGACGGCGCCCTG-3 ' (BamH I), P:5 '-GGC gCGGCCGC tTAAGCGTAGTCTGGGACGTCGTATGGGTAGATGCTCGACTC-3 ' (NotI), by ActRIIB subclone to Lentiviral pLEX-MCS, obtain Lentiviral pLEX-ActRIIB, the sheep ActRIIB that can express total length form.

With primer P5:5 '-GCC gGATCC aTGGCCCTCGCCCTCCTCTG-3 ' (BamHI), P6:5 '-CCC cTCGAG tTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTT CTCCTCG-3 ' (XhoI), subclone enters lentiviral vectors pLEX-MCS, obtain Lentiviral pLEX-dnActRIIB, the ActRIIB that can express brachymemma, i.e. 7-100 amino acids sequence.It by upstream and downstream, is respectively the IgG-Fc gene fragment of AgeI and XhoI restriction enzyme site, be connected with the pLEX-dnActRIIB large fragment through AgeI and XhoI double digestion, obtain recombinant plasmid pLEX-dnActRIIB-IgG Fc, can express truncation type ActRIIB (7-100aa) the plasmid dnActRIIB-IgG Fc with IgG-Fc label.

Utilize Stratagene rite-directed mutagenesis test kit by the 79th amino acids Methionin (L) of dnActRIIB-IgG Fc sequence respectively rite-directed mutagenesis be proline(Pro) (P) and L-glutamic acid (E), L79P rite-directed mutagenesis forward primer is P7: 5 '-GAAGGGCTGCTGGCCGGACGACTTCAACT-3 ', reverse primer is P8:5 '-AGTTGAAGTCGTCCGGCCAGCAGCCCTTC-3 ', L79E rite-directed mutagenesis forward primer is respectively P9:5 '-CAAGAAGGGCTGCTGGGAGGACGACTTCAACTGC-3 ', reverse primer is P10:5 '-GCAGTTGAAGTCGTCCTCCCAGCAGCCCTTCTTG-3 '.Build respectively and obtain pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E slow virus recombinant expression plasmid;

The screening of described stably express ActRIIB gene and mutant cells system, by the ActRIIB gene building and the slow virus recombinant expression plasmid transfection 293T cell of mutant, carry out the packing of slow virus, and the primary sarcoplast of the sheep that infects separation and Culture, the sarcoplast that obtains stably express sheep ActRIIB total length and mutant is.

As the further scheme of the present invention: three kinds of mutant of described sheep ActRIIB gene, mutant form is aminoterminal brachymemma and single base mutation thereof.

As the further scheme of the present invention: the screening concrete steps of described stably express ActRIIB gene and mutant cells system are: a, 293T cell cultures: 37 ℃ of conditions, 5% CO ₂, complete culture solution (foetal calf serum of DMEM+10%), six paving 6-7 * 10, the every hole of orifice plate ⁵individual cell, after 20 hours, cell degree of converging reaches 80-90%; B, Lipofectamine 2000 liposome transfections: add after the Opti-MEM substratum of 250 μ L preheatings, in following ratio, add respectively transfection plasmid pLEX-ActRIIB, pLEX-dnActRIIB-IgG Fc, pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E 2 μ g, packaging plasmid psPAX2 1.5 μ g, coating plasmid pMD2.G 0.5 μ g, mix gently; Separately get 250 μ L Opti-MEM substratum, add wherein 8 μ L liposomes, room temperature is placed after 5min, and the DNA that above-mentioned dilution is good mixes with liposome, is placed in incubated at room 20 minutes; During this period, with Opti-MEM substratum, clean and treat transfectional cell once, liposome and DNA mixture are added to cell; Tissue Culture Plate is put back in 37 ℃ of incubators and hatched; After 2-4 hour, remove liposome and DNA mixture, in every hole, add the complete culture solution that 2ml is fresh, again Tissue Culture Plate is put back in 37 ℃ of incubators and cultivated; C, virus packing: after cultivating 48h, collect the supernatant liquor containing slow virus, with 0.45 μ m strainer, filter, collect filtered solution, now virus can directly be used for infection or-70 ℃ frozen; Collecting cell, extracts albumen and carries out the expression that Western blotting detects ActRIIB total length and ActRIIB mutant; D, virus infection: paving 4.5-5 * 10, every hole in 6 orifice plates ⁵the primary sarcoplast of individual sheep; When degree of converging reaches 70% left and right, discard nutrient solution next day, adds 500 μ L virus (c step filtered solution), 500 μ L complete culture solutions, adds 1 μ L polybrene simultaneously, and cell is placed in to 5% CO ₂, cultivate in 37 ℃ of incubators; E, stable cell lines screening: after virus infection 24h, discard virus liquid, the cell in 0.05% trysinization 6 orifice plates proceeds in 10cm culture dish, after cell is completely adherent, adds 0.25 μ g/mL Puromycin to screen; In order to obtain the express cell system of stable integration foreign gene, the selective medium of changing containing Puromycin every 2-3 days, normal cell control group is set simultaneously, and cellular control unit is all dead, and the experimental group cell getting off of surviving is the cell that infects foreign gene; Within 7-10 days, can obtain the cell of stable transfection, be continued enlarged culturing, get part cell and carry out Western blotting detection.

As the further scheme of the present invention: the application of described clone sheep activator II receptor gene and mutant thereof, it is the effect to the primary sarcoplast growth of sheep of ActRIIB and mutant, by the stably express ActRIIB total length of above-mentioned screening and the clone of mutant, respectively with 2 * 10 ³individual cell/every hole is seeded in 96 orifice plates, and every kind of cell is established 4 repetitions, and blank group is set simultaneously, utilizes Cell Counting Kit-8 method to measure cell growth curve; Every 24h, to experimental group and control group hole, respectively add CCK-8 reagent of 10 μ l, in 37 ℃ of incubators, hatch 4h, microplate reader is measured the absorbancy at 450 nm wavelength places, METHOD FOR CONTINUOUS DETERMINATION 7 days, count the mean value that repeat in each clone 4 holes, take cell cultures number of days as X-coordinate, OD ₄₅₀value is ordinate zou drafting cell growth curve.

The invention has the beneficial effects as follows: the present invention has obtained sheep ActRIIB gene order, for the sequence of sheep ActRIIB gene discharges, provide related data; Obtaining sheep ActRIIB gene fusion is the solubility ActRIIB mutant of Fc structural domain to IgG molecule rock steady structure territory, and it comprises the ActRIIB mutant of aminoterminal brachymemma and the mutant of single base mutation.About sheep activin receptor IIB gene and mutant research, yet there are no any report at present, and the present invention finds that at cell levels ActRIIB and mutant are to the primary myoblastic proliferation function of sheep, for further exploring the effect of ActRIIB mutant in domestic animal muscle cell Growth and Differentiation process and the Study on Molecular Mechanism of ActRIIB mutant blocking-up MSTN signal path, lay the foundation.

Accompanying drawing explanation

Fig. 1 is the amplification of sheep ActRIIB gene PCR;

Fig. 2 is that pLex-ActRIIB recombinant plasmid enzyme is cut detection;

Fig. 3 is that pLex-dnActRIIB-Fc recombinant plasmid enzyme is cut detection;

Fig. 4 is that the western blot of pLEX-ActRIIB, pLEX-dnActRIIB-Fc mutant detects;

Fig. 5 is that cell growth curve is measured.

Embodiment

Below in conjunction with the embodiment of the present invention, the technical scheme in the embodiment of the present invention is clearly and completely described, obviously, described embodiment is only the present invention's part embodiment, rather than whole embodiment.Embodiment based in the present invention, those of ordinary skills, not making the every other embodiment obtaining under creative work prerequisite, belong to the scope of protection of the invention.

In embodiments of the invention, material used comprises: lentiviral vectors pLEX-MCS is given by much of U.S.'s crolla Li Chuanyuan professor laboratory; Cell: 293T, sheep sarcoplast preserve by this laboratory is separated; Animal material: sheep liver picks up from Urumqi City China and insults domestic animals slaughter market.Trizol, intestinal bacteria competence bacterial strain DH5 α, mouse-anti HA monoclonal antibody, a small amount of plasmid extraction kit, glue reclaim test kit all purchased from Beijing Tian Gen company; The sheep anti-mouse igg antibody of IRDye 800CW mark is purchased from U.S. LI-COR Biosciences company; The reagent such as high-fidelity DNA polymerase, Tag DNA polysaccharase, ThermoScript II, restriction enzyme, T4 DNA ligase, IPTG are all purchased from Dalian TaKaRa company; Middle amount plasmid extraction kit is purchased from QIAGEN company; QuickChange site-Directed Mutagenesis kit is purchased from Stratagene company; LipofectamineTM 2000 is purchased from Invitrogen company; DMEM in high glucose, Opti-MEM are purchased from GIBCO company; Foetal calf serum is purchased from HYCLONE company; CCK-8 reagent is purchased from Dojindo company; Other reagent are domestic analytical pure product.The clone of described gene and slow sick structure of expressing poisonous carrier thereof, test kit, the reagent selected are commercially available prod.

In the embodiment of the present invention, a kind of method of obtaining sheep activator II receptor gene and mutant thereof, comprises the following steps: clone ActRIIB gene coding region full length cDNA sequence; The rite-directed mutagenesis of ActRIIB gene and the structure of lentiviral vectors; The screening of stably express ActRIIB and mutant cells system.Described clone ActRIIB gene coding region full length cDNA sequence, first be to gather sheep liver organization, with Trizol reagent, extract the total RNA of liver organization reverse transcription, with reference to the ActRIIB sequence (GenBank Accession No. U57707) of announcing ox in ncbi database, design sheep Ovine ActRIIB clone primer, by RT-PCR method amplification sheep ActRIIB full length coding region sequence, to meet the big or small fragment of expection and be cloned into pMD 18T, order-checking, positive plasmid called after pMD 18T-ActRIIB.The structure of described ActRIIB and rite-directed mutagenesis type lentiviral vectors thereof, the pMD 18T-ActRIIB plasmid of take is template, with primer P3:5 '-ATA gGATCC gCACCGCGGAACATGACGGCGCCCTG-3 ' (BamH I), P4:5 '-GGC gCGGCCGC tTAAGCGTAGTCTGGGACGTCGTATGGGTAGATGCTCGACTC-3 ' (NotI), by ActRIIB subclone to Lentiviral pLEX-MCS, obtain Lentiviral pLEX-ActRIIB, the sheep ActRIIB that can express total length form.

With primer P5:5 '-GCC gGATCC aTGGCCCTCGCCCTCCTCTG-3 ' (BamHI), P6:5 '-CCC cTCGAG tTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTT CTCCTCG-3 ' (XhoI), subclone enters lentiviral vectors pLEX-MCS, obtain Lentiviral pLEX-dnActRIIB, the ActRIIB that can express brachymemma, i.e. 7-100 amino acids sequence.

It by upstream and downstream, is respectively the IgG-Fc gene fragment of AgeI and XhoI restriction enzyme site, be connected with the pLEX-dnActRIIB large fragment through AgeI and XhoI double digestion, obtain recombinant plasmid pLEX-dnActRIIB-IgG Fc, can express the truncation type 7-100aa ActRIIB sequence dnActRIIB-IgG Fc with IgG-Fc label.

Utilizing Stratagene rite-directed mutagenesis test kit is proline(Pro) P and L-glutamic acid E by the 79th amino acids Methionin L difference rite-directed mutagenesis of dnActRIIB-IgG Fc sequence, after order-checking is identified, builds respectively pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E slow virus recombinant expression plasmid.The screening of described stably express ActRIIB gene and mutant cells system, by the slow virus recombinant expression plasmid transfection 293T cell of the ActRIIB of above-mentioned structure and mutant, carry out the packing of slow virus, and infect the primary sarcoplast of sheep, obtain the sarcoplast system of stably express sheep ActRIIB total length and mutant: a, 293T cell cultures: 37 ℃ of conditions, 5% CO ₂, perfect medium (foetal calf serum of DMEM+10%), six paving 6-7 * 10, the every hole of orifice plate ⁵individual cell, after 20 hours, cell degree of converging reaches 80-90%; B, Lipofectamine 2000 liposome transfections: add after the Opti-MEM substratum of 250 μ L preheatings, in following ratio, add respectively transfection carrier pLEX-ActRIIB, pLEX-dnActRIIB-IgG Fc, pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E 2ug, packaging plasmid psPAX2 1.5ug, coating plasmid pMD2G 0.5ug, mix gently; Separately get 250 μ L Opti-MEM substratum, add wherein 8 μ L liposomes, room temperature is placed after 5min, and the DNA that above-mentioned dilution is good mixes with liposome, is placed in incubated at room 20min; During this period, with Opti-MEM substratum, clean and treat transfectional cell once, liposome and DNA mixture are added to cell; Tissue Culture Plate is put back in 37 ℃ of incubators and hatched; After 2-4 hour, remove liposome and DNA mixture, in every hole, add the nutrient solution that 2ml is fresh, again Tissue Culture Plate is put back in 37 ℃ of incubators and cultivated; C, virus packing: after cultivating 48h, collect the supernatant liquor containing slow virus, with 0.45 μ m strainer, filter, collect filtered solution, now virus can directly be used for infection or-70 ℃ frozen.Collecting cell, extracts albumen and carries out the expression that Western blotting detects ActRIIB total length and ActRIIB mutant.D, virus infection: paving 4.5-5 * 10, every hole in 6 orifice plates ⁵the primary sarcoplast of individual sheep; 24h, when degree of converging reaches 70% left and right, discards nutrient solution, adds 500ul to collect virus, 500ul perfect medium, add 1uL polybrene simultaneously, and final concentration reaches 10ug/mL, and cell is placed in to 5% CO ₂, cultivate in 37 ℃ of incubators; E, stable cell lines screening: after virus infection 24h, discard virus, by the cell in 6 orifice plates, 0.05% trysinization proceeds in 10cm culture dish, after cell is completely adherent, adds 0.25 μ g/mL Puromycin to screen.In order to obtain the express cell system of stable integration foreign gene, the selective medium of changing containing Puromycin every 2-3 days, normal cell control group is set simultaneously, and cellular control unit is all dead, and the experimental group cell getting off of surviving is the cell that infects foreign gene.Conventionally within 7-10 days, can obtain the cell of stable transfection, be continued enlarged culturing, get part cell and carry out Western blotting detection.Three kinds of mutant of sheep ActRIIB gene of the present invention, mutant form is aminoterminal brachymemma and single base mutation.

In the embodiment of the present invention, the application of described clone sheep activator II receptor gene and mutant thereof, it is the effect to the growth of the primary sarcoplast of sheep of the clone of stably express ActRIIB gene and mutant, by the stably express ActRIIB total length of above-mentioned screening and the cell of mutant protein, respectively with 2 * 10 ³individual cell/every hole is seeded in 96 orifice plates, and every kind of cell is established 4 multiple holes, and blank group is set simultaneously, utilizes Cell Counting Kit-8 method to measure cell growth curve.Every 24h, to experimental group and the every hole of cellular control unit, add CCK-8 reagent of 10 μ L, in 37 ℃ of incubators, hatch 4h, microplate reader is measured the absorbancy at 450 nm wavelength places, METHOD FOR CONTINUOUS DETERMINATION 7 days.Ask the mean value in 4 holes, take cell cultures number of days as X-coordinate, OD ₄₅₀value is ordinate zou drafting cell growth curve.

The present invention has obtained sheep ActRIIB gene order, for the application of sheep ActRIIB gene lays the foundation; Also comprise that obtaining sheep ActRIIB gene fusion is the solubility ActRIIB mutant of Fc structural domain to IgG molecule rock steady structure territory, it comprises the ActRIIB mutant of aminoterminal brachymemma and the mutant of single base mutation.Yet there are no any about sheep activin receptor IIB gene and mutant research report, and the present invention finds that at cell levels ActRIIB and mutant are to the primary myoblastic proliferation function of sheep, for further exploring the effect of ActRIIB mutant in domestic animal muscle cell Growth and Differentiation process and the Study on Molecular Mechanism of ActRIIB mutant blocking-up MSTN signal path, lay the foundation.

Embodiment 1 clone ActRIIB gene coding region full length cDNA sequence

(1) laboratory sample collection is extracted with total RNA

Gather sheep liver organization, pack in cryopreservation tube and be placed in rapidly liquid nitrogen preservation and take back.Get after about 100mg organizes sample to grind in liquid nitrogen and move in 1.5 mL centrifuge tubes, add 1 mL Trziol reagent, standing 5 min of room temperature, carry out the extraction of total RNA according to Trizol test kit operation instruction.

(2) RT-PCR

According to the reverse transcription test kit specification sheets of the precious biotech firm in Dalian, to sheep liver organization, RNA carries out reverse transcription, and reverse transcription system is carried out with reference to specification sheets.

(3) design of primers

ActRIIB sequence (GenBank Accession No. U57707) with reference to the ox of announcing in ncbi database, utilize Oligo6.0 software design sheep Ovine ActRIIB clone primer, P1:5 '-GGCACCGCGGAACATGACG GCGCCCTGGGCGGCCC-3 ', P2:5 '-GTGTCCTGGGCTTAGATGCTCGACTC-3 ', as shown in sequence table in sequence table 5, by RT-PCR method amplification sheep ActRIIB full length sequence.

(4) pcr amplification

Pcr amplification system: 5 * Buffer 10 μ L, dNTP2.5mm, 4 μ L, the equal 1 μ L of P1, P2,10 μ mol/L, high-fidelity DNA polymerase 0.5 μ L, cDNA 2 μ L moisturizing to 50 μ L; Pcr amplification program: 95 ℃ of denaturation 10min; 95 ℃ of sex change 30 s, 60 ℃ of annealing 45s, 72 ℃ are extended 90 s, 35 circulations; Last 72 ℃ are extended 10 min.PCR product detects with 1% agarose gel electrophoresis, and electrophoresis result is shown in Fig. 1.

(5) Cloning and sequencing

The amplified production of sheep ActRIIB gene is reclaimed after purifying, utilize T4 DNA ligase that it is connected with pMD-18T carrier, Transformed E .coli DH5 α; Utilize penbritin plate screening, and identify with PCR method and Restriction Enzyme cutting method, positive colony order-checking is completed by Shanghai biotechnology company limited; Positive plasmid called after pMD 18T-ActRIIB after order-checking is identified, sequencing result is shown in sequence table 1 in sequence table, this sequence is committed to GeneBank simultaneously, the number of logging in is: JX422071.1.

embodiment 2 rite-directed mutagenesises of ActRIIB gene and the structure of lentiviral vectors

Refer to Fig. 2 and Fig. 3, the sheep ActRIIB full length sequence obtaining according to embodiment 1, design primer P1, P2, is cloned into goal gene in Lentiviral, obtains sheep ActRIIB Gene Lentiviral Vector; The PMD 18T-ActRIIB plasmid of take is template simultaneously, design primer P3, and P4, builds the 7-100aa ActRIIB sequence of brachymemma and inserts lentiviral vectors pLEX-MCS, name pLEX-dnActRIIB; By the existing IgG-Fc gene fragment in laboratory through AgeI and XhoI double digestion, glue reclaims goal gene fragment, be connected with the pLEX-dnActRIIB of XhoI double digestion with same AgeI, obtain recombinant plasmid pLEX-dnActRIIB-IgG Fc, by double digestion and order-checking, identify recombinant plasmid; Utilizing Stratagene company sudden change test kit is proline(Pro) P and L-glutamic acid E by the 79th amino acids Methionin L difference rite-directed mutagenesis of dnActRIIB-IgG Fc sequence, after order-checking is identified, builds respectively pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E slow virus recombinant expression plasmid.Concrete steps are as follows:

(1) design of primers:

Primer according to sequencing result design clone ActRIIB to Lentiviral, upstream primer P3:5 '-ATA gGATCC gCACCGCGGAACATGACGGCGCCCTG-3 ' BamH I, downstream primer P4:5 '-GGC gCGGCCGC tTA aGCGTAGTCTGGGACGTCGTATGGGTAgATGCTCGACTC-3 ' Not I; Design upstream primer P5:5 '-GCC simultaneously gGATCC aTGGCCCTCGCCCTCCTCTG-3 ' BamH I, downstream primer P6:5 '-CCC cTCGAG tTA aGCGTAGTCTGGGACGTCGTATGGGTAg TACACCTGGGGGTTCTCCTCG-3 ' Xho I, black roman is HA-Tag, builds the 7-100aa ActRIIB sequence of brachymemma and inserts lentiviral vectors pLEX-MCS, as shown in sequence table 6.

(2) build Lentiviral:

1. the structure of Lentiviral pLEX-ActRIIB:

Take pMD 18T-ActRIIB as template, utilize respectively specificity upstream and downstream primer P1, P2 to carry out PCR reaction, its reaction system is: 1 μ L pMD 18T-ActRIIB plasmid, 2.5 μ L 10 * PCR buffer, the equal 2.5mM of 2 μ L dNTP, the equal 1 μ L of upstream and downstream primer 10 mM, 1 μ L DMSO, 1UTaq enzyme, uses ddH ₂o is adjusted to 25 μ L.PCR reaction conditions is: 95 ℃ of 5min, 95 ℃ of 30 s, 61 ℃ of 45 s, 72 ℃ of 90 s, 35 circulations, 72 ℃ of 10 min; Getting pcr amplification product 5 μ L detects through 1% agarose gel electrophoresis.BamH I and Not I double digestion, glue reclaim object fragment, are connected with the pLEX-MCS carrier of Not I double digestion with same BamH I, connect product Transformed E .coli DH5 α; Utilize penbritin to carry out plate screening, and identify with PCR method and Restriction Enzyme cutting method.After sequence verification, obtain recombinant plasmid pLEX-ActRIIB.

2. the structure of Lentiviral pLEX-dnActRIIB-Fc:

A, the pMD 18T-ActRIIB plasmid of take are template, utilize specificity upstream primer P5, downstream primer P6 to carry out PCR reaction, its reaction system is: 1 μ L pMD-18T-ActRIIB plasmid, 2.5 μ L 10 * PCR buffer, 2 μ L dNTP(2.5mM each), the equal 1 μ L of upstream and downstream primer 10 mM, 1 μ L DMSO, 1U Taq enzyme, uses ddH ₂o is adjusted to 25 μ L.PCR reaction conditions is: 95 ℃ of 5min, 95 ℃ of 30 s, 61 ℃ of 30 s, 72 ℃ of 30 s, 35 circulations, 72 ℃ of 10 min; Getting pcr amplification product 5 μ L detects through agarose gel electrophoresis.BamH I and Xho I double digestion, glue reclaim goal gene fragment, are connected with the pLEX-MCS carrier of Xho I double digestion with same BamH I, connect product Transformed E .coli DH5 α; Utilize penbritin to carry out plate screening, and identify with PCR method and Restriction Enzyme cutting method ,order-checking is identified, obtains recombinant plasmid pLEX-dnActRIIB.

B, by upstream and downstream, be respectively the IgG-Fc gene fragment of AgeI and XhoI restriction enzyme site, be connected with the pLEX-dnActRIIB large fragment through AgeI and XhoI double digestion, connect product Transformed E .coli DH5 α; Utilize penbritin to carry out plate screening, and identify with PCR method and Restriction Enzyme cutting method.After sequence verification, obtain recombinant plasmid pLEX-dnActRIIB-IgG-Fc, sequencing result is shown in sequence table 2 in sequence table.

(3) ActRIIB site-directed point mutation

1. design of primers

Utilize http://www.genomics.agilent.com/primerDesignProgram.jsp to design online primer, by the 79th amino acids Methionin (L) of ActRIIB gene order respectively rite-directed mutagenesis be proline(Pro) (P) and L-glutamic acid (E).The upstream and downstream primer of L79P is respectively: upstream primer P7:5 '-GAAGGGCTGCTGGCCGGACGACTTCAACT-3 '; Downstream primer P8:5 '-AGTTGAAGTCGTCCGGCCAGCAGCCCTTC-3 '; The upstream and downstream primer of L79E is respectively: upstream primer P9:5 '-CAAGAAGGGCTGCTGGGAGGACGACTTCAACTGC-3 '; Downstream primer P10:5 '-GCAGTTGAAGTCGTCCTCCCAGCAGCCCTTCTTG-3 ', as shown in sequence table in sequence table 7.

2. pcr amplification

Utilize Stratagene rite-directed mutagenesis test kit to carry out pcr amplification, system is: 10 * Buffer, 5 μ L, dNTP(2.5mM each), 4 μ L, the equal 1.25 μ L of upstream and downstream primer, pLEX-dnActRIIB-Fc plasmid 1 μ L, pfu Ultra HF archaeal dna polymerase 1.0 μ L, moisturizing to 50 μ L; PCR response procedures: 95 ℃ of denaturation 30 s; 95 ℃ of sex change 30 s, 55 ℃ of annealing 60s, 68 ℃ are extended 12min, 16 circulations; Last 4 ℃ of 5 min.

3. digestion

Get 1.0 μ L DpnI restriction endonucleases and add in above-mentioned 50 μ L pcr amplification products and mix, 37 ℃ of water-bath 3h.

4. transform

A, get 50 μ L XL 1-Blue competent cells and be placed on ice, add the PCR product of digestion in 5 μ L steps 3 to mix, ice bath 30min.

Ice bath 2min after b, 42 ℃ of water-bath 45s, adds 500 μ L SOC substratum to mix and is placed on 37 ℃ of shaking table concussion cultivation 1h, rotating speed: 200rpm.

C, utilize penbritin to carry out plate screening, picking list bacterium colony to order-checking after SOC substratum shaking culture 12-16h is identified, the positive slow virus recombinant expression plasmid called after obtaining: pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E, sequencing result is shown in sequence table 3 and sequence table 4 in sequence table.

the screening of embodiment 3 stably express ActRIIB genes and mutant protein clone

Refer to Fig. 4, by the slow virus recombinant expression plasmid transfection 293T cell of the ActRIIB of above-mentioned structure and mutant, carry out the packing of slow virus, and infector is for the sheep sarcoplast of separation and Culture, obtains the sarcoplast system of stably express sheep ActRIIB and three kinds of ActRIIB mutant:

In 293T cell, pack recombinant slow virus step:

(1) the 1st day: 293T cell culture condition:

37 ℃, 5% CO ₂, substratum adopts the foetal calf serum of DMEM+10%, six paving 6-7 * 10, the every hole of orifice plate ⁵individual 293T cell, guarantees that the 2nd day cell degree of converging in complete culture solution reaches 80-90%;

(2) the 2nd days: Lipofectamine 2000 liposome transfections:

First, in 24 orifice plates, prepare liposome and DNA mixture.

Add after the Opti-MEM substratum of 250 μ L preheatings, in following ratio, add respectively object carrier pLEX-ActRIIB, pLEX-dnActRIIB-IgG Fc, pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E and viral package carrier.

Transfection carrier 2 ug

Packaging plasmid pSPAX2 1.5ug

Coating plasmid pMD2G 0.5ug

Before using Lipofectamine 2000, first mix gently liposome, then in 24 orifice plates, add the Opti-MEM substratum of 250 μ L preheatings, add again 8ul Lipofectamine 2000, mixing gently rear room temperature places after 5min, the DNA that above-mentioned dilution is good mixes with liposome, and mixture is placed in incubated at room 20min; During this period, with Opti-MEM substratum, clean in six orifice plates and treat that transfectional cell once, liposome and DNA mixture are added to cell, Tissue Culture Plate is put back in 37 ℃ of incubators and hatched, after 2-4 hour, remove liposome and DNA mixture, in the six every holes of orifice plate, add the nutrient solution that 2ml is fresh, again Tissue Culture Plate is put back in 37 ℃ of incubators and cultivated.

(3) the 4th days: collect virus

After cultivating 48h, collect the cell culture supernatant containing slow virus.Cell conditioned medium is filtered with 0.45 μ m strainer, collects filtered solution, now virus can directly be used for infecting or-70 ℃ frozen.Collecting cell, extracts albumen and carries out the expression that Western blotting detects ActRIIB full length gene and each mutant of ActRIIB, the protein band of 53KDa, 38KDa, 38KDa, 38KDa detected respectively, in the same size with expection.

(4) virus infection: in 6 orifice plate middle berth 4.5-5 * 10 ⁵the primary sarcoplast of individual sheep; When degree of converging reaches 70% left and right, discard nutrient solution next day, adds 500ul to collect virus, 500ul perfect medium, adds 1ul polybrene simultaneously, and final concentration reaches 10ug/ml, and cell is placed in to 5% CO ₂, 37 ℃ of incubators cultivate.

(5) stable cell lines screening: discard after virus infection 24h, 0.05% trysinization proceeds in 10cm culture dish, after cell is completely adherent, adds 0.25 μ g/mL Puromycin to screen.In order to obtain the express cell system of stable integration foreign gene, the selective medium of changing containing Puromycin every 2-3 days, normal cell control group is set simultaneously, normal cell control group is all dead, the survive cell that gets off of experimental group is the cell that infects foreign gene, conventionally within 7-10 days, can obtain the cell of stable transfection.

the effect of the clone of embodiment 4 stably express ActRIIB genes and mutant in the primary sarcoplast growth of sheep

Refer to Fig. 5, for the effect in the primary sarcoplast growth of sheep of upgrowth situation, ActRIIB gene and the mutant of relatively ActRIIB gene and mutant cells system, the clone of the stable infection goal gene obtaining is carried out to the drafting of growth curve, and experiment is divided into 4 groups, surveys 7 days.Use CCK-8 method to measure cell proliferation, concrete steps are as follows:

(1) clone of the stable infection goal gene obtaining is reached to 90% left and right at degree of converging and digest and count, be inoculated in 96 well culture plates respectively with 2000, every hole cell, every group arranges 4 repetitions, is placed in 5% CO ₂, cultivate in 37 ℃ of incubators.Meanwhile, arrange and only contain the not celliferous control wells of substratum, obtain background luminescence value, measure 7 times, the 0th day to the 6th day, need 7 96 identical orifice plates of paving.

(2) after cell is completely adherent, to every porocyte, add 10 μ l CCK-8 reagent, be placed in incubator and hatch after 3.5-4h, use microplate reader to measure the extinction at 450nm wavelength place.

(3) every 24h, measure once, every 2 days, change a nutrient solution, METHOD FOR CONTINUOUS DETERMINATION 7 days, finally the numerical value drafting pattern of 7 days, produces one and take cell cultures number of days as X-coordinate, OD ₄₅₀value is the cell growth curve of ordinate zou.Result shows, the sarcoplast of three kinds of mutant of stably express is all than the high cell growth speed of stably express ActRIIB total length.With SPSS13.0 software, carry out significance of difference analysis, show that the 0th day four kinds of Growth of Cells differences of bed board are all not remarkable; The cell of stably express pLEX-dnActRIIB-Fc-L79P1 is compared with stably express pLEX-dnActRIIB-Fc-L79E3 cell, and within 1-6 days, difference is all not remarkable, P > 0.05; Stably express pLEX-dnActRIIB-Fc-L79P1, pLEX-dnActRIIB-Fc-L79E3 cell are all significantly accelerated than stably express pLEX-dnActRIIB-Fc, pLEX-ActRIIB Growth of Cells speed, within the 1st day, difference is all remarkable, P < 0.05, within 2-6 days, inequality heteropole is remarkable, P < 0.01.

To those skilled in the art, obviously the invention is not restricted to the details of above-mentioned one exemplary embodiment, and in the situation that not deviating from spirit of the present invention or essential characteristic, can realize the present invention with other specific form.Therefore, no matter from which point, all should regard embodiment as exemplary, and be nonrestrictive, scope of the present invention is limited by claims rather than above-mentioned explanation, is therefore intended to include in the present invention dropping on the implication that is equal to important document of claim and all changes in scope.

In addition, be to be understood that, although this specification sheets is described according to embodiment, but not each embodiment only comprises an independently technical scheme, this narrating mode of specification sheets is only for clarity sake, those skilled in the art should make specification sheets as a whole, and the technical scheme in each embodiment also can, through appropriately combined, form other embodiments that it will be appreciated by those skilled in the art that.

The sequencing result of sequence table 1:PMD 18T-ActRIIB gene

ATGACGGCGCCCTGGGCGGCCCTCGCCCTCCTCTGGGGATCGCTGTGCGCCGGTTCCGGGCGCGGGGAGGCCGAGACGCGG 81

1 M T A P W A A L A L L W G S L C A G S G R G E A E T R

GAGTGCATCTACTACAACGCCAACTGGGAGCTGGAGCGCACCAACCAGAGCGACCTGGAGCGCTGTGAGGGCGAGCGGGAC 162

28 E C I Y Y N A N W E L E R T N Q S D L E R C E G E R D

AAGCGGCTGCACTGCTACGCCTCCTGGCGCAACAGCTCGGGCACCATCGAGCTCGTCAAGAAGGGCTGCTGGCTGGACGAC 243

55 K R L H C Y A S W R N S S G T I E L V K K G C W L D D

TTCAACTGCTACGACAGGCAGGAGTGCGTGGCCACCGAGGAGAACCCCCAGGTGTACTTCTGCTGCTGCGAAGGCAACTTC 324

82 F N C Y D R Q E C V A T E E N P Q V Y F C C C E G N F

TGCAACGAGCGCTTCACCCACCTTCCCGAGGCGGGCGGCCCAGAAGTCACGTACGAGCCACCCCCGACAGCCCCCACCCTG 405

109 C N E R F T H L P E A G G P E V T Y E P P P T A P T L

CTCACTGTGCTGGCCTACTCGCTGCTGCCCGTCGGGGGCCTCTCCCTCATTGCCCTGCTGGCCTTCTGGATGTACCGACAT 486

136 L T V L A Y S L L P V G G L S L I A L L A F W M Y R H

CGCAAGCCCCCCTACGGCCACGTGGACATCCACGAGGACCCTGGACCTCCACCCCCGTCCCCTCTGGTGGGCCTGAAGCCT 567

163 R K P P Y G H V D I H E D P G P P P P S P L V G L K P

CTGCAGCTGCTGGAGATCAAGGCTCGGGGGCGCTTCGGTTGTGTCTGGAAGGCGCAGCTCATGAACGACTTCGTGGCTGTC 648

190 L Q L L E I K A R G R F G C V W K A Q L M N D F V A V

AAGATCTTCCCACTCCAGGACAAGCAGTCGTGGCAGAGTGAGCGGGAGATCTTCAGCACGCCTGGCATGAAGCACGAGAAC 729

217 K I F P L Q D K Q S W Q S E R E I F S T P G M K H E N

CTGCTGCAGTTCATTGCCGCTGAGAAGCGAGGCTCCAGCCTGGAGGCGGAGCTGTGGCTCATCACAGCCTTCCACGACAAG 810

244 L L Q F I A A E K R G S S L E A E L W L I T A F H D K

GGCTCCCTCACGGATTACCTCAAGGGGAACATCATCACATGGAACGAGCTGTGTCACGTGGCGGAGACCATGTCTAGAGGC 891

271 G S L T D Y L K G N I I T W N E L C H V A E T M S R G

CTCTCATACCTACACGAGGATGTGCCCTGGTGCCGGGGCGAGGGCCACAAGCCGTCTATTGCCCACAGGGACTTCAAGAGC 972

298 L S Y L H E D V P W C R G E G H K P S I A H R D F K S

AAGAATGTATTGCTGAAGAGTGACCTCACTGCTGTGCTGGCTGACTTTGGCCTGGCTGTTCGGTTTGAGCCAGGGAAACCT 1053

325 K N V L L K S D L T A V L A D F G L A V R F E P G K P

CCGGGGGACACTCACGGGCAGGTGGGCACGCGGCGGTACATGGCCCCCGAGGTGCTCGAGGGAGCCATCAACTTCCAGAGA 1134

352 P G D T H G Q V G T R R Y M A P E V L E G A I N F Q R

GACGCCTTTCTGCGCATCGACATGTACGCCATGGGGCTGGTGCTCTGGGAGCTCGTGTCCCGCTGCAAAGCTGCCGACGGA 1215

379 D A F L R I D M Y A M G L V L W E L V S R C K A A D G

CCTGTGGATGAGTACATGCTGCCTTTTGAGGAGGAGATCGGCCAGCACCCGTCACTGGAGGAGCTGCAGGAGGTTGTGGTG 1296

406 P V D E Y M L P F E E E I G Q H P S L E E L Q E V V V

CATAAGAAGATGCGGCCGGCCATCAAGGATCACTGGCTGAAACACCCGGGCCTGGCCCAGCTCTGCGTGACAATCGAGGAG 1377

433 H K K M R P A I K D H W L K H P G L A Q L C V T I E E

TGCTGGGACCACGACGCGGAGGCTCGCCTGTCCGCGGGCTGCGTGGAGGAGCGAGTGTCCCTGATTCGGAGGTCGGTCAAC 1458

460 C W D H D A E A R L S A G C V E E R V S L I R R S V N

GGCACTACCTCGGACTGTCTCGTCTCCCTGGTGACCTCCGTCACCAACGTGGACCTGCCCCCGAAGGAGTCGAGCATCTAA 1539

487 G T T S D C L V S L V T S V T N V D L P P K E S S I -

The sequencing result of sequence table 2:pLEX-dnActRIIB-IgG Fc gene

ATGGCCCTCGCCCTCCTCTGGGGATCGCTGTGCGCCGGTTCCGGGCGCGGGGAGGCCGAGACGCGGGAGTGCATCTACTAC 81

1 M A L A L L W G S L C A G S G R G E A E T R E C I Y Y

AACGCCAACTGGGAGCTGGAGCGCACCAACCAGAGCGACCTGGAGCGCTGTGAGGGCGAGCGGGACAAGCGGCTGCACTGC 162

28 N A N W E L E R T N Q S D L E R C E G E R D K R L H C

TACGCCTCCTGGCGCAACAGCTCGGGCACCATCGAGCTCGTCAAGAAGGGCTGCTGGCTGGACGACTTCAACTGCTACGAC 243

55 Y A S W R N S S G T I E L V K K G C W L D D F N C Y D

AGGCAGGAGTGCGTGGCCACCGAGGAGAACCCCCAGGTGTACTACCCATACGACGTCCCAGACTACGCTCTCGAGCCCAGA 324

82 R Q E C V A T E E N P Q V Y Y P Y D V P D Y A L E P R

GGGCCCACAATCAAGCCCTGTCCTCCATGCAAATGCCCAGCACCTAACCTCTTGGGTGGACCATCCGTCTTCATCTTCCCT 405

109 G P T I K P C P P C K C P A P N L L G G P S V F I F P

CCAAAGATCAAGGATGTACTCATGATCTCCCTGAGCCCCATAGTCACATGTGTGGTGGTGGATGTGAGCGAGGATGACCCA 486

136 P K I K D V L M I S L S P I V T C V V V D V S E D D P

GATGTCCAGATCAGCTGGTTTGTGAACAACGTGGAAGTACACACAGCTCAGACACAAACCCATAGAGAGGATTACAACAGT 567

163 D V Q I S W F V N N V E V H T A Q T Q T H R E D Y N S

ACTCTCCGGGTGGTCAGTGCCCTCCCCATCCAGCACCAGGACTGGATGAGTGGCAAGGAGTTCAAATGCAAGGTCAACAAC 648

190 T L R V V S A L P I Q H Q D W M S G K E F K C K V N N

AAAGACCTCCCAGCGCCCATCGAGAGAACCATCTCAAAACCCAAAGGGTCAGTAAGAGCTCCACAGGTATATGTCTTGCCT 729

217 K D L P A P I E R T I S K P K G S V R A P Q V Y V L P

CCACCAGAAGAAGAGATGACTAAGAAACAGGTCACTCTGACCTGCATGGTCACAGACTTCATGCCTGAAGACATTTACGTG 810

244 P P E E E M T K K Q V T L T C M V T D F M P E D I Y V

GAGTGGACCAACAACGGGAAAACAGAGCTAAACTACAAGAACACTGAACCAGTCCTGGACTCTGATGGTTCTTACTTCATG 891

271 E W T N N G K T E L N Y K N T E P V L D S D G S Y F M

TACAGCAAGCTGAGAGTGGAAAAGAAGAACTGGGTGGAAAGAAATAGCTACTCCTGTTCAGTGGTCCACGAGGGTCTGCAC 972

298 Y S K L R V E K K N W V E R N S Y S C S V V H E G L H

AATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGTAAATAA 1017

325 N H H T T K S F S R T P G K -

The sequencing result of sequence table 3:pLEX-dnActRIIB-IgG Fc-L79P gene

1 M A L A L L W G S L C A G S G R G E A E T R E C I Y Y

28 N A N W E L E R T N Q S D L E R C E G E R D K R L H C

TACGCCTCCTGGCGCAACAGCTCGGGCACCATCGAGCTCGTCAAGAAGGGCTGCTGGCCGGACGACTTCAACTGCTACGAC 243

55 Y A S W R N S S G T I E L V K K G C W P D D F N C Y D

82 R Q E C V A T E E N P Q V Y Y P Y D V P D Y A L E P R

109 G P T I K P C P P C K C P A P N L L G G P S V F I F P

136 P K I K D V L M I S L S P I V T C V V V D V S E D D P

163 D V Q I S W F V N N V E V H T A Q T Q T H R E D Y N S

190 T L R V V S A L P I Q H Q D W M S G K E F K C K V N N

217 K D L P A P I E R T I S K P K G S V R A P Q V Y V L P

244 P P E E E M T K K Q V T L T C M V T D F M P E D I Y V

271 E W T N N G K T E L N Y K N T E P V L D S D G S Y F M

298 Y S K L R V E K K N W V E R N S Y S C S V V H E G L H

AATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGTAAATAA 1017

325 N H H T T K S F S R T P G K -

The sequencing result of sequence table 4:pLEX-dnActRIIB-IgG Fc-L79E gene

1 M A L A L L W G S L C A G S G R G E A E T R E C I Y Y

28 N A N W E L E R T N Q S D L E R C E G E R D K R L H C

TACGCCTCCTGGCGCAACAGCTCGGGCACCATCGAGCTCGTCAAGAAGGGCTGCTGGGAGGACGACTTCAACTGCTACGAC 243

55 Y A S W R N S S G T I E L V K K G C W E D D F N C Y D

82 R Q E C V A T E E N P Q V Y Y P Y D V P D Y A L E P R

109 G P T I K P C P P C K C P A P N L L G G P S V F I F P

136 P K I K D V L M I S L S P I V T C V V V D V S E D D P

163 D V Q I S W F V N N V E V H T A Q T Q T H R E D Y N S

190 T L R V V S A L P I Q H Q D W M S G K E F K C K V N N

217 K D L P A P I E R T I S K P K G S V R A P Q V Y V L P

CCACCAGAAGAAGAGATGACTAATAAACAGGTCACTCTGACCTGCATGGTCACAGACTTCATGCCTGAAGACATTTACGTG 810

244 P P E E E M T N K Q V T L T C M V T D F M P E D I Y V

271 E W T N N G K T E L N Y K N T E P V L D S D G S Y F M

298 Y S K L R V E K K N W V E R N S Y S C S V V H E G L H

AATCACCACACGACTAAGAGCTTCTCCCGGACTCCGGGTAAATAA 1017

325 N H H T T K S F S R T P G K -

Sequence table 5: utilize Oligo6.0 software design sheep Ovine ActRIIB clone primer with reference to the ActRIIB sequence (GenBank Accession No. U57707) of ox

Clone's primer P1:5'-GGCACCGCGGAACATGACGGCGCCCTGGGCGGCCC-3'

Clone's primer P2:5'-GTGTCCTGGGCTTAGATGCTCGACTC-3'

Sequence table 6: the ActRIIB of clone ActRIIB, brachymemma is to the primer of Lentiviral

P3：5'-ATAGGATCCGCACCGCGGAACATGACGGCGCCCTG-3'(BamH I)

P4：5'-GGCGCGGCCGCTTAAGCGTAGTCTGGGACGTCGTATGGGTAGATGCTCGACTC-3'（NotⅠ）

P5：5'-GCCGGATCCATGGCCCTCGCCCTCCTCTG（BamHⅠ）-3'

P6：5'-CCCCTCGAGTTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTTCTCCTCG-3' (XhoI)

The 79th amino acids Methionin (L) of sequence table 7:ActRIIB gene order respectively rite-directed mutagenesis is the design of primers of proline(Pro) (P) and L-glutamic acid (E)

The forward primer P7:5'-GAAGGGCTGCTGGCCGGACGACTTCAACT-3' of L79P rite-directed mutagenesis

The downstream primer P8:5'-AGTTGAAGTCGTCCGGCCAGCAGCCCTTC-3' of L79P rite-directed mutagenesis

The forward primer P9:5'-CAAGAAGGGCTGCTGGGAGGACGACTTCAACTGC-3' of L79E rite-directed mutagenesis

The downstream primer P10:5'-GCAGTTGAAGTCGTCCTCCCAGCAGCCCTTCTTG-3' of L79E rite-directed mutagenesis

Claims

1. a method of obtaining sheep activator II receptor (ActRIIB) gene and mutant thereof, is characterized in that, comprises clone ActRIIB gene coding region full length cDNA sequence, the rite-directed mutagenesis of ActRIIB gene and the structure of lentiviral vectors, the screening of stably express ActRIIB gene and mutant cells system, described clone ActRIIB gene coding region full length cDNA sequence, gather sheep liver organization, with Trizol reagent, extract the total RNA of liver organization reverse transcription, design clone primer, P1:5 '-GGCACCGCGGAACATGACGGCGCCCTGGGCGGCCC-3 ', P2:5 '-GTGTCCTGGGCTTAGATGCTC GACTC-3 ', by RT-PCR method amplification sheep ActRIIB full length coding region sequence, to meet the big or small fragment of expection and be cloned into pMD 18T carrier, order-checking, positive plasmid called after pMD 18T-ActRIIB, the structure of described ActRIIB and rite-directed mutagenesis type lentiviral vectors thereof, the pMD 18T-ActRIIB plasmid of take is template, with primer P3:5 '-ATA gGATCC gCACCGCGGAACATGACGGCGCCCTG-3 ' (BamH I), P4:5 '-GGC gCGGCCGC tTAAGCGTAGTCTGGGACGTCGTATGGGTAGATGCTCGACTC-3 ' (NotI), by ActRIIB subclone to Lentiviral pLEX-MCS, obtain Lentiviral pLEX-ActRIIB, the sheep ActRIIB that can express total length form, with primer P5:5 '-GCC gGATCC aTGGCCCTCGCCCTCCTCTG-3 ' (BamHI), P6:5 '-CCC cTCGAG tTAAGCGTAGTCTGGGACGTCGTATGGGTAGTACACCTGGGGGTT CTCCTCG-3 ' (XhoI), subclone enters lentiviral vectors pLEX-MCS, obtain Lentiviral pLEX-dnActRIIB, the ActRIIB that can express brachymemma, i.e. 7-100 amino acids sequence, it by upstream and downstream, is respectively the IgG-Fc gene fragment of AgeI and XhoI restriction enzyme site, be connected with the pLEX-dnActRIIB large fragment through AgeI and XhoI double digestion, obtain recombinant plasmid pLEX-dnActRIIB-IgG Fc, can express the truncation type 7-100aa ActRIIB sequence dnActRIIB-IgG Fc with IgG-Fc label, utilize Stratagene rite-directed mutagenesis test kit by the 79th amino acids Methionin (L) of dnActRIIB-IgG Fc sequence respectively rite-directed mutagenesis be proline(Pro) (P) and L-glutamic acid (E), L79P rite-directed mutagenesis forward primer is P7:5 '-GAAGGGCTGCTGGCCGGACGACTTCAACT-3 ', reverse primer is P8:5 '-AGTTGAAGTCGTCCGGCCAGCAGCCCTTC-3 ', L79E rite-directed mutagenesis forward primer is P9:5 '-CAAGAAGGGCTGCTGGGAGGACGACTTCAACTGC-3 ', reverse primer is P10:5 '-GCAGTTGAAGTCGTCCTCCCAGCAGCCCTTCTTG-3 ', build respectively and obtain pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E slow virus recombinant expression plasmid, the screening of described stably express ActRIIB and mutant cells system, by the recombinant expressed ActRIIB building and the slow virus plasmid transfection 293T cell of mutant, carry out the packing of slow virus, and the primary sarcoplast of the sheep that infects separation and Culture, the sarcoplast that obtains stably express sheep ActRIIB total length and mutant is.

2. the method for obtaining clone sheep activator II receptor gene and mutant thereof according to claim 1, is characterized in that, three kinds of mutant of described sheep ActRIIB gene, and mutant form is aminoterminal brachymemma and single base mutation.

3. the method for obtaining clone sheep activator II receptor gene and mutant thereof according to claim 1, is characterized in that, the screening of described stably express ActRIIB gene and mutant cells system, and concrete steps are:

A, 293T cell cultures: 37 ℃ of conditions, 5% CO ₂, complete culture solution (foetal calf serum of DMEM+10%), six paving 6-7 * 10, the every hole of orifice plate ⁵individual cell, after 20 hours, cell degree of converging reaches 80-90%;

B, Lipofectamine 2000 liposome transfections: add after the Opti-MEM substratum of 250 μ L preheatings, in following ratio, add respectively transfection plasmid pLEX-ActRIIB, pLEX-dnActRIIB-IgG Fc, pLEX-dnActRIIB-IgG Fc-L79P, pLEX-dnActRIIB-IgG Fc-L79E 2ug, coating plasmid pMD2G 0.5ug, mix gently, separately get 250 μ L Opti-MEM substratum, add wherein 8 μ L liposomes, room temperature is placed after 5min, the DNA that above-mentioned dilution is good mixes with liposome, is placed in incubated at room 20 minutes; During this period, with Opti-MEM substratum, clean and treat transfectional cell once, liposome and DNA mixture are added to cell; Tissue Culture Plate is put back in 37 ℃ of incubators and hatched; After 2-4 hour, remove liposome and DNA mixture, in every hole, add the complete culture solution that 2ml is fresh, again Tissue Culture Plate is put back in 37 ℃ of incubators and cultivated;

C, virus packing: after packing 48h, collect the supernatant liquor containing slow virus, with 0.45 μ m strainer, filter, collect filtered solution, now virus can directly be used for infection or-70 ℃ frozen; Collecting cell, extracts albumen and carries out the expression that Western blotting detects ActRIIB total length and ActRIIB mutant;

D, virus infection: paving 4.5-5 * 10, every hole in 6 orifice plates ⁵the primary sarcoplast of individual sheep; When degree of converging reaches 70% left and right, discard nutrient solution next day, adds 500ul to collect virus, 500ul perfect medium (c step filtered solution), add 1ul polybrene simultaneously, and cell is placed in to 5% CO ₂, cultivate in 37 ℃ of incubators;

E, stable cell lines screening: after virus infection 24h, discard virus liquid, the cell in 0.05% trysinization 6 orifice plates proceeds in 10cm culture dish, after cell is completely adherent, adds 0.25 μ g/mL Puromycin to screen; Every 2-3 days, change the selective medium containing Puromycin, normal cell control group is set simultaneously, cellular control unit is all dead, and the experimental group cell getting off of surviving is the cell that infects foreign gene; Within 7-10 days, can obtain the cell of stable transfection, be continued enlarged culturing, get part cell and carry out Western blotting detection.

4. one kind according to the application of sheep activator II receptor gene and mutant thereof described in claim 1-3, it is the effect to the primary sarcoplast growth of sheep of ActRIIB and mutant, it is characterized in that, by the stably express ActRIIB total length of above-mentioned screening and the clone of mutant, respectively with 2 * 10 ³individual cell/every hole is seeded in 96 orifice plates, and every kind of cell is established 4 repetitions, and blank group is set simultaneously, utilizes Cell Counting Kit-8 method to measure cell growth curve; Every 24h, to experimental group and control group hole, respectively add CCK-8 reagent of 10 μ l, in 37 ℃ of incubators, hatch 4h, microplate reader is measured the absorbancy at 450 nm wavelength places, METHOD FOR CONTINUOUS DETERMINATION 7 days, count the mean value that repeat in each clone 4 holes, take cell cultures number of days as X-coordinate, OD ₄₅₀value is ordinate zou drafting cell growth curve.