CN104087567B - Preparation method of Ruditapes philippinarum antimicrobial protein - Google Patents

Preparation method of Ruditapes philippinarum antimicrobial protein Download PDF

Info

Publication number
CN104087567B
CN104087567B CN201410196291.6A CN201410196291A CN104087567B CN 104087567 B CN104087567 B CN 104087567B CN 201410196291 A CN201410196291 A CN 201410196291A CN 104087567 B CN104087567 B CN 104087567B
Authority
CN
China
Prior art keywords
preparation
ruditapes philippinarum
ecor
extracted
follows
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201410196291.6A
Other languages
Chinese (zh)
Other versions
CN104087567A (en
Inventor
丁鉴锋
闫喜武
杨凤
赵力强
秦艳杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dalian Ocean University
Original Assignee
Dalian Ocean University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dalian Ocean University filed Critical Dalian Ocean University
Priority to CN201410196291.6A priority Critical patent/CN104087567B/en
Publication of CN104087567A publication Critical patent/CN104087567A/en
Application granted granted Critical
Publication of CN104087567B publication Critical patent/CN104087567B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2462—Lysozyme (3.2.1.17)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01017—Lysozyme (3.2.1.17)

Abstract

The invention discloses a preparation method of a Ruditapes philippinarum antimicrobial protein. The preparation method comprises the following steps: carrying out a PCR reaction by using cDNA represented by SEQ ID NO:1 as a template and a PCR reaction primer having two enzyme digestion sites of EcoR I and NotI, wherein an upstream primer EcoR I is represented by 5'- GAATTCATGGCTTGGCTGACAGCATCTG -3', and a downstream primer NotI is represented by 5'- GCGGCCGCTTATTTGTCTTTAACAGCTCTC ATTCTGC -3'; connecting the obtained PCR reaction product with a cloning vector, and converting to competent cells; extracting the obtained cloning and expression vector plasmid, respectively carrying out double enzyme digestion by using EcoR I and Not I, carrying out glue recovery to recover target fragments, connecting the target fragment with a ligase, and converting to competent cells; extracting positive cloning, and carrying out IPTG inducible expression on the obtained positive cloning; and extracting and purifying expressed recombinant proteins.

Description

The preparation method of Ruditapes philippinarum antibacterial protein
Technical field
The present invention relates to a kind of preparation method of antibacterial protein, especially one kind have antibacterial activity and adaptation to various bacterium The preparation method of the Ruditapes philippinarum antibacterial protein of briny environment.
Background technology
In order to prevent and treat aquatic animal disease, antibiotic is widely used in aquaculture.Research shows, by water The antibiotic that lively thing absorbs can enter human body by food chain, and the health of the mankind is had undesirable effect.Enter in addition Antibiotic in briny environment, can result in germ drug resistance in breeding environment, cause secondary pollution.Although may be used at present Antibacterial biologic product, it is intended to substitute antibiotics, to avoid the phenomenon existing for abuse of antibiotics, but exists inadaptable mostly The problem of briny environment and fungistatic effect difference.
The content of the invention
The present invention is in order to solve the above-mentioned technical problem existing for prior art, there is provided one kind there is antibacterial to live various bacterium Property and adapt to briny environment Ruditapes philippinarum antibacterial protein preparation method.
The present invention technical solution be：A kind of preparation method of Ruditapes philippinarum antibacterial protein, it is characterised in that according to It is secondary to carry out as follows：
A. Ruditapes philippinarum total serum IgE is extracted；
B. reverse transcription synthesizes Ruditapes philippinarum phage type lysozyme gene mature peptide cDNA, such as SEQ ID NO：1 institute Show；
C. with resulting cDNA as template, with the PCR of I two restriction enzyme sites of EcoR I and Not react primer Enter performing PCR reaction；The PCR reactions primer sequence is as follows：
Upstream primer EcoR I：
5'- GAATTCATGGCTTGGCTGACAGCATCTG -3'
Downstream primer Not I：
5'- GCGGCCGCTTATTTGTCTTTAACAGCTCTCATTCTGC -3' ；
D. PCR product is connected with cloning vector, and is transformed into competent cell；
E. institute's DCRP and expression vector plasmid are extracted, respectively with EcoR I and Not I double digestions, glue reclaim purpose piece Duan Houyong ligases connect, then are transformed into competent cell；
F. extract positive colony and gained positive colony is carried out into IPTG abduction deliverings；
G. the recombinant protein to expressing is extracted and purified.
The step c PCR reaction condition is as follows：
94 DEG C of 4 min of denaturation, 1 circulation；
；
72 DEG C of 10 min of extension, 1 circulation
4 DEG C of insulations.
The Step d is as follows：PCR product is connected on pMD-18T carriers, is transformed intoE.coliTop10 experiences State cell.
The step e is as follows：
Institute's DCRP and expression vector pET30a plasmids are extracted, respectively with EcoR I and Not I double digestions 3 hours, glue Reclaim and connected 6 ~ 12 hours with T4 DNA ligases after purpose fragment, then be transformed into E.coli Top10 competent cells.
The f steps are as follows：
Positive colony is extracted, gained positive colony is proceeded to into the LB fluid nutrient mediums containing 100 μ g/ml ampicillins In, 200r/min, 37 DEG C are cultivated 6 ~ 12 hours；Plasmid is extracted, and plasmid is diluted to into 10ng/ μ l；Take the plasmid after 1 μ l dilutions Convert 200 μ l BL21（DE3）PLysS competent cells；Converted product is accessed into 10ml and contains 100 μ g/ml ampicillins, 34 μ In the LB culture mediums of g/ml chloramphenicol, 200r/min, 37 DEG C are cultivated 6 ~ 12 hours；Culture idling is accessed into 300ml and contains 100 μ In g/ml ampicillins, the LB culture mediums of 34 μ g/ml chloramphenicol, 200r/min, 37 DEG C are cultivated 1 ~ 3 hour, work as OD600Reach When 0.5 ~ 0.8, the IPTG for adding final concentration of 0.5mM continues to cultivate 4 hours.
The g steps are as follows：4 DEG C, 5000rpm, centrifugation 10min is collected by centrifugation bacterial sediment, adds pH7.4
PBS after, with ultrasonic cell disruption instrument by clasmatosis, then with entering with the nickel post of histone label Row purifying obtains active albumen.
Present invention firstly discovers that it is molten that the most strong phage type of antibacterial activity in known lysozyme is there is in Ruditapes philippinarum Bacterium enzyme gene mature peptide, and with its cDNA as template, with designed primer performing PCR is entered, and then is carried out gram with PCR product It is grand etc., prepare the recombinant expression protein of Ruditapes philippinarum phage type antalzyme protein.With other phage type lysozymes Compare, the present invention more adapts to briny environment, and prepared recombinant protein is thin to endangering larger vibrio in mariculture industry Bacterium（Belong to Gram-negative bacteria）And negative bacteria（Escherichia coli）Stronger antibacterial activity is respectively provided with, can be used as bait or addition Agent is applied in sea-farming.
Description of the drawings
Fig. 1 is 1% agarose gel electrophoresis figure of embodiment of the present invention PCR primer.
Fig. 2 is the antibacterial experiment design sketch of the recombinant protein that the embodiment of the present invention is obtained.
Fig. 3 be the embodiment of the present invention obtain recombinant protein in briny environment antibacterial experiment design sketch.
Specific embodiment
Carry out as follows：
A. according to the method for prior art, Ruditapes philippinarum total serum IgE is extracted；
B. reverse transcription synthesizes Ruditapes philippinarum phage type lysozyme gene mature peptide cDNA, such as SEQ ID NO：1 institute Show；
C. with resulting cDNA as template, with the PCR of I two restriction enzyme sites of EcoR I and Not react primer Enter performing PCR reaction；The PCR reactions primer sequence is as follows：
Upstream primer EcoR I：
5'- GAATTCATGGCTTGGCTGACAGCATCTG -3'
Downstream primer Not I：
5'- GCGGCCGCTTATTTGTCTTTAACAGCTCTCATTCTGC -3' ；
PCR reaction conditions are as follows：
94 DEG C of 4 min of denaturation, 1 circulation；
；
72 DEG C of 10 min of extension, 1 circulation
4 DEG C of insulations；
1% agarose gel electrophoresis figure of PCR primer is as shown in figure 1, M: DL2,000 DNA Maker；1,2:Philippine Clam son's specific fragment；
D. PCR product is connected on pMD-18T carriers, is transformed intoE.coliTop10 competent cells；
E. institute's DCRP and expression vector pET30a are extracted（Novagen USA）Plasmid, respectively with EcoR I and Not I double digestions 3 hours, are connected 6 ~ 12 hours after glue reclaim purpose fragment with T4 DNA ligases, then are transformed into E.coli Top10 competent cells；
F. positive colony is extracted, gained positive colony is proceeded to into the LB Liquid Cultures containing 100 μ g/ml ampicillins In base, 200r/min, 37 DEG C are cultivated 6 ~ 12 hours；Plasmid is extracted, its concentration is determined on ultraviolet specrophotometer, and by plasmid It is diluted to 10ng/ μ l；Take the plasmid after 1 μ l dilutions and convert 200 μ l BL21（DE3）PLysS competent cells；By converted product Access 10ml to contain in 100 μ g/ml ampicillins, the LB culture mediums of 34 μ g/ml chloramphenicol, 200r/min, 37 DEG C of cultures 6 ~ 12 Hour；Culture idling is accessed into 300ml to contain in 100 μ g/ml ampicillins, the LB culture mediums of 34 μ g/ml chloramphenicol, 200r/min, 37 DEG C are cultivated 1 ~ 3 hour, work as OD600When reaching 0.5 ~ 0.8, the IPTG for adding final concentration of 0.5mM continues to cultivate 4 Hour；
G. 4 DEG C, 5000rpm, centrifugation 10min is collected by centrifugation bacterial sediment, after adding the PBS of pH7.4, uses super Sound wave cell crushing instrument is by clasmatosis, then is carried out purifying the active albumen of acquisition with the nickel post with histone label.
Test：
1. bacteriostatic activity detection
Using turbidimetry for Determination embodiment of the present invention gained protein active, respectively with vibrio alginolyticus（V. alginolyticus）, Vibrio harveyi（Vibro harveyi）, Edwardsiella tarda（V. anguillarum）, leather it is blue Escherichia coli in family name's negative bacteria（E. coli）With the hay bacillus in gram-positive bacteria（B. subtilis）For substrate, It is measured as control with HEL, PBS liquid.
Concrete operations are as follows：
1）The above-mentioned bacterium solution of 5ml fresh cultureds is taken respectively, and 12000 × g centrifugation 5min abandon supernatant；
2）Use 5ml PBS（pH7.4）Resuspended bacterium solution, 12000 × g centrifugation 5min, abandons supernatant；
3）Repeat step 2）Once；
4）Use PBS（pH7.4）Resuspended bacterium solution, makes the absorbance OD450 close 0.5 of bacterium solution；
5）Take the resuspended bacterium solutions of 260 μ l to be added in 96 orifice plates, be divided into 5 groups, per group the embodiment of the present invention is separately added into Restructuring antalzyme protein liquid, the lysozyme liquid with concentration egg, each 40 μ l of blank PBS liquid；
6）Each sample does three repetitions；
7）After standing 30min, it is measured with ELIASA；Enzyme activity computing formula：
8）The computing formula of lysozyme antibiotic activity：Antibacterial activity（U）=[CFUinitial-CFUfinal]/ CFUinitial.As a result it is as shown in Figure 2.
From figure 2 it can be seen that the restructuring antalzyme protein of the present invention is to vibrio alginolyticus（V. alginolyticus）, breathe out Vickers vibrios（V. harveyi）, Edwardsiella tarda（V. anguillarum）, large intestine bar in gramnegative bacterium Bacterium（E. coli）With the hay bacillus in gram-positive bacteria（B. subtilis）There is bacteriostasis, especially seawater is supported Grow and larger vibrio bacteria is endangered in industry（Belong to Gram-negative bacteria）And negative bacteria（Escherichia coli）Resist with stronger Bacterium activity,
2. briny environment bacteriostatic activity test experience
Protein active is determined using Bactericidal test, with vibrio alginolyticus（V. alginolyticus）And Vibrio harveyi （V. harveyi）It is measured for substrate.
Concrete operations are as follows：
1）Vibrio alginolyticus and the Vibrio harveyi bacterium solution of 100 μ l fresh cultureds are taken respectively, are dripped on 2216E culture mediums and are applied Cloth is uniform；
2）The Oxford cup of sterilizing is gently placed in tweezers is carried disease germs on culture medium flat plate, each flat board places three；
3）After by the restructuring antalzyme protein freeze-drying of the embodiment of the present invention, concentration is made into as 1mg/ml with bacteriological filtration seawater Protein solution, add the 50 μ l protein solutions into each Oxford cup respectively；
4）Flat board is put in incubated base, after 28 DEG C of culture 24h, around observation filter Oxford cup the presence or absence of inhibition zone and Size, as a result as shown in Figure 3.
From figure 3, it can be seen that the restructuring antalzyme protein of the embodiment of the present invention in briny environment to vibrio alginolyticus and Vibrio harveyi has obvious bacteriostatic activity.
Sequence table
<110>Dalian Ocean University
<120>The preparation method of Ruditapes philippinarum antibacterial protein
<160> 3
<210> 1
<211> 465
<212> DNA
<213>Ruditapes philippinarum phage type lysozyme gene mature peptide
<400> 1
ATGGCTTGGCTGACAGCATCTGAAGTTGATAGAATCAAAGCCCAGCTGAAGGTAGATGAGGGGTTTGATGATAAGAT ATATCTAGACAGTGTTGGATTACGGACATTTGGTATTGGTCACTTGATAAAGGAAGGCGACCCTGAGTATAAGTTAG AAGTTGGTACATCCATTGGTCAAGACAGAATTGACAGTGCCTTTGTCCAGGACTTCAATGAAGCAGCAGCACTAACA AAAGAAATCTACCCTGAATGCGAGACGTGGCCTAGTGAAGTAAAAGAAATCATTGTAAATATGGCGTTCAATCTTGG AGGAAGACTTAAAGGTTTCAAGAATTTGGCCAAAGCTCTTGAAAAACGAAACTGGACTACGGCCGCTGATGAAATGA AAAACAGCAAATGGTACGGTCAAGTTAAATCAAGGGGAGAAAGATTAGTTAGCAGAATGAGAGCTGTTAAAGACAAA TAA 465
<210> 2
<211> 28
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400>2
GAATTCATGGCTTGGCTGACAGCATCTG 28
<210> 3
<211> 37
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400>3
GCGGCCGCTTATTTGTCTTTAACAGCTCTCATTCTGC

Claims (6)

1. a kind of preparation method of Ruditapes philippinarum antibacterial protein, it is characterised in that carry out as follows successively：
A. Ruditapes philippinarum total serum IgE is extracted；
B. reverse transcription synthesizes Ruditapes philippinarum phage type lysozyme gene mature peptide cDNA, such as SEQ ID NO：Shown in 1；
C. carry out with resulting cDNA as template, to react primer with the PCR of I two restriction enzyme sites of EcoR I and Not PCR reacts；The PCR reactions primer sequence is as follows：
Upstream primer EcoR I：
5'- GAATTCATGGCTTGGCTGACAGCATCTG -3'
Downstream primer Not I：
5'- GCGGCCGCTTATTTGTCTTTAACAGCTCTCATTCTGC -3'
D. PCR product is connected with cloning vector, and is transformed into competent cell；
E. institute's DCRP and expression vector plasmid are extracted, respectively with EcoR I and Not I double digestions, glue reclaim
Connected with ligase after purpose fragment, then be transformed into competent cell；
F. extract positive colony and converted product is built with gained positive colony, IPTG induction tables are carried out to gained converted product Reach；
G. the recombinant protein to expressing is extracted and purified.
2. the preparation method of Ruditapes philippinarum antibacterial protein according to claim 1, it is characterised in that step c PCR is anti- Answer condition as follows：
94 DEG C of 4 min of denaturation, 1 circulation；
；
72 DEG C of 10 min of extension, 1 circulation；
4 DEG C of insulations.
3. the preparation method of Ruditapes philippinarum antibacterial protein according to claim 1 or claim 2, it is characterised in that the Step d is such as Under：PCR product is connected on pMD-18T carriers, is transformed intoE.coliTop10 competent cells.
4. the preparation method of Ruditapes philippinarum antibacterial protein according to claim 3, it is characterised in that the step e is as follows：
Institute's DCRP and expression vector pET30a plasmids are extracted, respectively with EcoR I and Not I double digestions 3 hours, glue reclaim Connected 6 ~ 12 hours with T4 DNA ligases after purpose fragment, then be transformed into E.coli Top10 competent cells.
5. the preparation method of Ruditapes philippinarum antibacterial protein according to claim 4, it is characterised in that the f steps are as follows：
Positive colony is extracted, gained positive colony is proceeded in the LB fluid nutrient mediums containing 100 μ g/ml ampicillins, 200r/min, 37 DEG C are cultivated 6 ~ 12 hours；Plasmid is extracted, and plasmid is diluted to into 10ng/ μ l；Take the plasmid after 1 μ l dilutions to turn Change 200 μ l BL21（DE3）PLysS competent cells；Converted product is accessed into 10ml and contains 100 μ g/ml ampicillins, 34 μ g/ In the LB culture mediums of ml chloramphenicol, 200r/min, 37 DEG C are cultivated 6 ~ 12 hours；Culture idling is accessed into 300ml and contains 100 μ g/ In ml ampicillins, the LB culture mediums of 34 μ g/ml chloramphenicol, 200r/min, 37 DEG C are cultivated 1 ~ 3 hour, work as OD600Reach 0.5 When ~ 0.8, the IPTG for adding final concentration of 0.5mM continues to cultivate 4 hours.
6. the preparation method of Ruditapes philippinarum antibacterial protein according to claim 5, it is characterised in that described
G steps are as follows：4 DEG C, 5000rpm is centrifuged 10min, and collects thalline precipitation after adding the PBS of pH7.4, uses super Sound wave cell crushing instrument is by clasmatosis, then is carried out purifying the active albumen of acquisition with nickel post.
CN201410196291.6A 2014-05-12 2014-05-12 Preparation method of Ruditapes philippinarum antimicrobial protein Expired - Fee Related CN104087567B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410196291.6A CN104087567B (en) 2014-05-12 2014-05-12 Preparation method of Ruditapes philippinarum antimicrobial protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410196291.6A CN104087567B (en) 2014-05-12 2014-05-12 Preparation method of Ruditapes philippinarum antimicrobial protein

Publications (2)

Publication Number Publication Date
CN104087567A CN104087567A (en) 2014-10-08
CN104087567B true CN104087567B (en) 2017-04-12

Family

ID=51635328

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410196291.6A Expired - Fee Related CN104087567B (en) 2014-05-12 2014-05-12 Preparation method of Ruditapes philippinarum antimicrobial protein

Country Status (1)

Country Link
CN (1) CN104087567B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110408624A (en) * 2019-08-09 2019-11-05 大连海洋大学 A kind of Ruditapes philippinarum c-type agglutinant protein and the preparation method and application thereof
CN111073894B (en) * 2020-01-22 2023-05-23 大连海洋大学 Philippine little clam APE gene fragment, coded protein, preparation method and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102363784A (en) * 2011-10-14 2012-02-29 中国科学院烟台海岸带研究所 Ruditapes philippinarum Defensin B gene, its recombinant protein and application
CN102363783A (en) * 2011-10-14 2012-02-29 中国科学院烟台海岸带研究所 Venerupis philippinarum defensin A gene, and recombinant protein and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102363784A (en) * 2011-10-14 2012-02-29 中国科学院烟台海岸带研究所 Ruditapes philippinarum Defensin B gene, its recombinant protein and application
CN102363783A (en) * 2011-10-14 2012-02-29 中国科学院烟台海岸带研究所 Venerupis philippinarum defensin A gene, and recombinant protein and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Mitochondrial thioredoxin-2 from Manila clam (Ruditapes philippinarum) is a potent antioxidant enzyme involved in antibacterial response;Navaneethaiyer Umasuthan et al.;《Fish & Shellfish Immunology》;20120430;513–523 *

Also Published As

Publication number Publication date
CN104087567A (en) 2014-10-08

Similar Documents

Publication Publication Date Title
Alonso et al. Isolation and partial characterization of lactic acid bacteria from the gut microbiota of marine fishes for potential application as probiotics in aquaculture
CN105238722B (en) The preparation method and application of one bacillus amyloliquefaciens bacterial strain and its bacterium powder preparation
CN104862297B (en) It is a kind of to transform staphylococcus aureus bacteriophage lyases and preparation method and application through genetic engineering
CN105567598A (en) Tibetan pig origin bacillus amyloliquefaciens and application thereof
CN109762760A (en) A kind of preparation method and application of Bei Laisi bacillus DH82 and its antibacterial protein
CN105237630A (en) Pesticin and phage lysozyme fusion protein and encoding gene and application thereof
CN109748962A (en) Asiatic migrotory locust serpin serpin1 and its encoding gene and application
CN103789317A (en) Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application
CN103382462B (en) A kind of Bacillus licheniformis N,O-Diacetylmuramidase and production method thereof and application
CN110004096A (en) One lactobacillus plantarum and its application
CN102304484A (en) New strain of pseudoalteromonas flavipulchra and use thereof
CN104087567B (en) Preparation method of Ruditapes philippinarum antimicrobial protein
CN105779346B (en) A kind of enterococcus faecium and its application of bacteriocinogeny
CN104263709A (en) Egg-white lysozyme and preparation method thereof
CN108017698B (en) Garlic antibacterial peptide AR117 and application thereof
CN104530215A (en) Antibacterial peptide VIP (vasoactive intestinal peptide)-like peptide and preparation method thereof
CN103966122B (en) One strain Providence and the application in preparation antibacterials thereof
CN103103196A (en) Modified goat defensin gene and preparation method and application thereof
CN117384267A (en) Exopalaemon carinicauda antibacterial peptide, encoding gene EcCrustin, recombinant strain and application thereof
CN107022549A (en) Pelteobagrus fulvidraco beta-defensin gene and its beta-defensin antibacterial peptide and its application
CN101886081A (en) Procambarus clarkia chitin peptide gene and encoded chitin peptide and application thereof
CN103667330A (en) Method for preparing freshwater crayfish SWD protease inhibitor
CN1459506A (en) Recombination expression and application of Chinese prawn antibacterial peptide gene
CN106883288A (en) A kind of cecropin B gene V21 and application thereof
CN1807645A (en) Fusion gene of nisin and bee peptide and its construct method and uses

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20170412

Termination date: 20180512

CF01 Termination of patent right due to non-payment of annual fee