CN103382462B - A kind of Bacillus licheniformis N,O-Diacetylmuramidase and production method thereof and application - Google Patents

Abstract

The invention discloses a kind of N,O-Diacetylmuramidase, there is the nucleotide sequence shown in SEQIDNO:1.Accordingly, the invention provides the production method of the N,O-Diacetylmuramidase with this nucleotide sequence, utilize intestinal bacteria, yeast or subtilis all can carry out high expression to N,O-Diacetylmuramidase of the present invention, N,O-Diacetylmuramidase of the present invention can tolerate stomach en-, the trypsinase of higher temperature and higher concentration, feed can be widely used in, food, the industries such as agricultural as fungistat.

Description

A kind of Bacillus licheniformis N,O-Diacetylmuramidase and production method thereof and application

Technical field

The present invention relates to field of molecular microbiology, specifically a kind of N,O-Diacetylmuramidase (lysozyme) and produce and application.

Background technology

N,O-Diacetylmuramidase is a kind of enzyme of solubilized bacteria cell wall, the β-Isosorbide-5-Nitrae glycosidic link in energy bacterium for degrading cell walls between-acetylmuramic acid and NAG, thus destroys cell walls, makes bacterium dead due to infiltration dissolving.Because it has bacteriolysis, therefore called after N,O-Diacetylmuramidase.

N,O-Diacetylmuramidase is extensively present in the Various Tissues of humans and animals, juice as in tears, saliva, also extensively exists in certain plants, microorganism.Such as, in the white cell of people, serum, placenta, saliva, milk, cervical mucus and kidney, all containing N,O-Diacetylmuramidase, (human lysozyme is a kind of small molecular basic protein, it is secreted by monocytes/macrophages, nonspecific defense reaction is played) in human organism, and in the fresh juice of papaya, pineapple and Fructus Fici, also all contain abundant N,O-Diacetylmuramidase, their antiviral relevant also with plant by inference.

Generally divide 6 classes by N,O-Diacetylmuramidase: C type (hen's egg-white lysozyme), g type (goose albumen N,O-Diacetylmuramidase), invertebrates type, phage, bacterium and plant origin N,O-Diacetylmuramidase.The molecular weight of the N,O-Diacetylmuramidase of different sources, amino acid form and enzyme characteristic is had nothing in common with each other, but the N,O-Diacetylmuramidase in various source all has inhibitory effect, is all the important natural immunity factor in multiple biology, the process of opposing bacterial invasion cell.

Compared with other antimicrobial factors, N,O-Diacetylmuramidase have activity stabilized, can the freezing or advantage such as drying treatment, has a broad antifungal spectrum, therefore in medical science and foodstuffs industry, anti-infective material and sanitas is used as, main Application Areas comprises the food preservatives as high security, there is certain health-care effect, can optionally, on purpose killing microorganisms and other materials of not acting in food, ensure that the original nutritive ingredient of food is not suffered a loss; In milk-product, be used as to add putridness microorganism in factor pair enteron aisle have special killing action, promote the increment of bifidus bacillus in enteron aisle directly or indirectly, be the antibacterial protein in infant food simultaneously; In food flexible packing by lysozyme immobilization in packaging material for food, produce and resist the packaging material for food of effect, to reach sterilizing fresh-keeping function; Preservative activity is played at wine and beverage; Have anti-infective at health functional food and strengthen microbiotic action potency, promoting hemopexis and anastalsis, in a organized way regeneration; For feed anticorrosion agent and sterilant in livestock industry, there is the effect of control grice diarrhoea, the health of chicken body can be promoted, promote the digestion of feed Middle nutrition material, absorption.

Because N,O-Diacetylmuramidase has above-mentioned multiple use, being in great demand to N,O-Diacetylmuramidase on market.At present, people mainly produce N,O-Diacetylmuramidase from Ovum Gallus domesticus album.But the N,O-Diacetylmuramidase in Ovum Gallus domesticus album source to produce cost higher, and waste egg starting material and have with the food needs of the mankind and conflict.As a large amount of as food, fodder additives, cause the cost on market higher and N,O-Diacetylmuramidase that is that conflict with human foods is hard to carry on.

Therefore, this area is badly in need of a kind of method of biological fermentation that can utilize and is produced N,O-Diacetylmuramidase, and reduce the cost of N,O-Diacetylmuramidase, the N,O-Diacetylmuramidase produced has again good antagonistic property, can be used as the harmless food of pure natural, fodder additives.

Summary of the invention

As mentioned above, for the needs of this area, the invention discloses a kind of Bacillus licheniformis N,O-Diacetylmuramidase of high temperature resistant, strong stress resistance.Disclosed N,O-Diacetylmuramidase can By Direct Pyrolysis bacterium, and it is strong to have withstand high temperatures ability, and tolerance pH value of solution scope is large, can resist the higher stomach en-of concentration and trypsinase, the features such as antibacterial spectrum width.

Further, the invention also discloses the production method of described Bacillus licheniformis N,O-Diacetylmuramidase, method disclosed by the invention can make its high expression in intestinal bacteria, pichia spp, subtilis, thus reduction production cost, improve unit output and production efficiency, be convenient to suitability for industrialized production.

Accordingly, the invention also discloses the application of described Bacillus licheniformis N,O-Diacetylmuramidase, the experiment that applicant carries out shows this N,O-Diacetylmuramidase and has wide spectrum, Wide High-efficient Antibacterial, can the effectively multiple Gram-positive of cracking and Gram-negative bacteria, not only may be used for prevention and control bacteriosis, additive can also be used as in various food, biological products, play antibacterial antisepsis and sterilization effect widely.

For achieving the above object, the present invention is achieved through the following technical solutions:

A kind of Bacillus licheniformis N,O-Diacetylmuramidase, has the nucleotide sequence shown in sequence table SEQ ID NO:1.

This N,O-Diacetylmuramidase is separated from the Bacillus licheniformis natural soils to obtain, applicant is identified by the method for 16s the used Bacillus licheniformis screened from soil, the sequence of the 16SrRNA through PCR lichem bacillus strain has out been carried out comparison with the Bacillus licheniformis of genebank lane database, the sequence of the sequence 99.9% of 16SrRNA is coincide, can judge that screened bacterial strain is as the Bacillus licheniformis of biologically widely applying, the sequence of the 16SrRNA of this bacterial strain is as shown in SEQ IDNO:2.

The zymetology performance of applicant to the N,O-Diacetylmuramidase of gained measures, and display gained N,O-Diacetylmuramidase has following physico-chemical property:

The molecular weight 35KD of N,O-Diacetylmuramidase;

The optimal pH of N,O-Diacetylmuramidase is 8;

The optimum temperature of N,O-Diacetylmuramidase is 37 DEG C;

The iso-electric point >8 of N,O-Diacetylmuramidase;

The pH stability of N,O-Diacetylmuramidase and thermostability: enzyme has good stability in pH2 ~ 10, enzyme can keep good stability 55 DEG C time.

Accordingly, the invention discloses the production method of described Bacillus licheniformis N,O-Diacetylmuramidase, N,O-Diacetylmuramidase of the present invention can in multiple Strain Vector high expression, include but not limited to following several:

(1) adopt e. coli strain bl21 as expressive host, using pET21, pET28 series plasmids as expression vector, produce Bacillus licheniformis N,O-Diacetylmuramidase with IPTG (isopropylthiogalactoside) abduction delivering.

(2) adopt Pichia pastoris GS115 bacterial strain as expressive host, using the plasmid of pPIC9K series as expression vector, with methanol induction Expression product Bacillus licheniformis N,O-Diacetylmuramidase.

(3) adopt subtilis WB800 as expressive host, produce Bacillus licheniformis N,O-Diacetylmuramidase using autonomously replicationg vector PGJ103 plasmid as expression vector.

When the production method adopting e. coli bl21 as Bacillus licheniformis N,O-Diacetylmuramidase of the present invention, concrete comprises the steps:

1, seed culture: picking mono-clonal from flat board, is inoculated in LB substratum, incubated overnight at 37 DEG C;

2, abduction delivering: get seed culture medium and be inoculated in fermention medium LB, cultivates after to OD value to 0.6, adds IPTG induction, cultivates at 20 DEG C;

3, protein extraction: centrifugal acquisition cell by its ultrasonication, centrifugal removing cell residue, membrane filtration.

Further, in above-mentioned production expression method, the step of the protein extract of step 3 being carried out purifying by nickel post is also comprised.

Wherein, in above-mentioned steps, culture condition, inoculum size, filter membrane specification, nickel post type can be selected according to actual needs.

In the above-mentioned methods, applicant is connected to the vector plasmid carrier construction expression plasmids such as pET21 and carries out inscribe with Ndel, XhoI endonuclease after not specifically describing and N,O-Diacetylmuramidase DNA fragmentation pcr amplification being gone out full-length gene fragment and obtains monoclonal process, and this process is that those skilled in the art extensively adopt for expressing with pET21 construction recombination plasmid in intestinal bacteria.

When the production method adopting Pichia pastoris GS115 bacterial strain as Bacillus licheniformis N,O-Diacetylmuramidase of the present invention, Bacillus licheniformis lysozyme gene is using the plasmid of pPIC9K series as vector integration on the karyomit(e) of Pichia pastoris GS115 bacterial strain; Methyl alcohol phenotype used both can utilize Quick-type (mut+) with methyl alcohol, also type (muts or must-) at a slow speed can be utilized with methyl alcohol, first this production method builds the Expression vector pPIC9K containing Bacillus licheniformis gene in bacillus coli DH 5 alpha, Plastid transformation in pichia spp, is then carried out following process by the method adopting electricity to transform:

1, seed culture: connect bacterium liquid from glycerine pipe in YPD substratum, is inoculated in BMGY substratum after cultivation, in 30 DEG C of cultivations;

2, fermentation culture: by bacterium liquid access automatic fermenter in BMGY, with 50% ammoniacal liquor control pH for 6.0, temperature 30 DEG C, regulates mixing speed and air flow to maintain dissolved oxygen more than 30%, flows glycerol adding during glycerol depletion, until OD600 arrives 250;

3, abduction delivering: after thalline hunger 0.5 ~ 1h, add methyl alcohol and start abduction delivering.Wherein methanol feeding carries out according to dissolved oxygen, and whole process dissolved oxygen is controlled 30 ~ 50%.

4, purifying: the pichia spp nutrient solution 10-50 ten thousand containing Bacillus licheniformis N,O-Diacetylmuramidase is retained molecular film ultrafiltration collect filtrate, with 5000 dam molecular weight ultrafiltration collection dope; Dope adds carboxymethyl cellulose, elution buffer wash-out, collects elutriant, desalination, frost drying, measures protein content and lysozyme activity.

In the above-mentioned methods, culture condition, inoculum size etc. can be selected according to actual needs.

In the above-mentioned methods, applicant is connected to pPIC9K vector plasmid carrier construction expression plasmid and carries out double digestion with EcoRI, NotI after not specifically describing and N,O-Diacetylmuramidase DNA fragmentation pcr amplification being gone out full-length gene fragment and obtains monoclonal process, and this process is that those skilled in the art extensively adopt for pPIC9K construction recombination plasmid.

When the production method adopting subtilis WB800 as Bacillus licheniformis N,O-Diacetylmuramidase of the present invention, Bacillus licheniformis lysozyme gene is under P43 promotor controls, with autonomously replicationg vector PGJ103 plasmid as carrier, plasmid is free in dyeing vivoexpression, and concrete comprises the steps:

1, in bacillus coli DH 5 alpha, build the PGJ105 plasmid vector containing Bacillus licheniformis gene;

2, the method for electricity conversion is adopted by PGJ105 Plastid transformation in subtilis;

3, culture expression albumen in LB substratum, is inoculated in seed culture medium in fermention medium, cultivates at 37 DEG C, and the centrifugal ultrasonication of albumen sample thief of will cultivate, check protein expression.

In the above-mentioned methods, culture condition, inoculum size etc. can be selected according to actual needs.

In the above-mentioned methods, applicant is connected to plasmid construction vector expression plasmid and carries out double digestion with EcoRI, BamHI after not specifically describing and N,O-Diacetylmuramidase DNA fragmentation pcr amplification being gone out full-length gene fragment and obtains monoclonal process, and this process is that those skilled in the art extensively adopt.

By aforementioned production method, N,O-Diacetylmuramidase of the present invention is able to high expression in intestinal bacteria, pichia spp, subtilis.

On the basis of the above, the invention also discloses the application of described N,O-Diacetylmuramidase as fungistat, N,O-Diacetylmuramidase of the present invention to Gram-positive or Gram-negative bacteria inhibited, the fungistat especially as gram-positive microorganism has significant restraining effect.

Accompanying drawing explanation

Fig. 1 shows the impact of pH environment on Bacillus licheniformis lysozyme activity of the present invention;

Fig. 2 shows the impact of temperature on Bacillus licheniformis lysozyme activity of the present invention;

Fig. 3 shows trypsinase and stomach en-to the impact of Bacillus licheniformis lysozyme activity of the present invention;

Fig. 4 shows the expression plasmid pET21a-lyso building process used in intestinal bacteria;

Fig. 5 is that Bacillus licheniformis N,O-Diacetylmuramidase SDS-PAGE of the present invention schemes, and swimming lane 1 is maker, and swimming lane 2 is N,O-Diacetylmuramidase expression in intestinal bacteria, and swimming lane 3 is N,O-Diacetylmuramidase expression in pichia spp, and swimming lane 4 is N,O-Diacetylmuramidases of purifying;

Fig. 6 shows the expression plasmid pPIC9K-lyso building process used in pichia spp;

Fig. 7 shows the expression plasmid PGJ105 building process used in subtilis.

Embodiment

Below in conjunction with embodiment, the invention will be further described, and embodiment is intended to carry out citing to the present invention and describes, but not is construed as limiting the invention in any form.

In following concrete enforcement; applicant provides expression plasmid used in expression method produced by N,O-Diacetylmuramidase building process and the primer sequence at often kind in detail; the process provided and primer are only provided for those skilled in the art better can understand the present invention, and is not particularly limited to protection scope of the present invention formation.

Embodiment 1

Bacillus licheniformis N,O-Diacetylmuramidase of the present invention has the nucleotide sequence shown in sequence table SEQ ID NO:1, has the aminoacid sequence shown in sequence table SEQ IDNO:3.

Be that substrate measures N,O-Diacetylmuramidase of the present invention in the solution of a series of different pH damping fluid with micrococcus lysodeikticus, enzyme activity is measured at 37 DEG C, result as shown in Figure 1, showing N,O-Diacetylmuramidase optimal pH of the present invention is 8, be 2 ~ 10 to have good stability at pH, the relative activity of 40% can also be kept when pH is under 2 conditions.

Measure the activity of N,O-Diacetylmuramidase of the present invention using micrococcus lysodeikticus as substrate, be in the damping fluid of 8, process under different temperature condition at pH, as shown in Figure 2, the optimum temperuture of N,O-Diacetylmuramidase of the present invention is 37 DEG C to result.

Shown in same reference drawing 2, be in the damping fluid of 8 at pH, under different temperature condition, process 4 hours enzyme solution, measure the thermostability of N,O-Diacetylmuramidase, N,O-Diacetylmuramidase of the present invention processes the enzyme activity that can also keep 45% for 4 hours under 55 DEG C of conditions.

By N,O-Diacetylmuramidase powder of the present invention respectively from the trypsinase 0 to 400mg/L different concns gradient and pepsin solution, process under 37 DEG C of conditions, mensuration trypsinase and stomach en-enzyme, on the impact of lysozyme activity, evaluate its function that can keep in Digestive tract as feed, foodstuff additive using this.As shown in Figure 3, can find out that N,O-Diacetylmuramidase of the present invention can resist certain density trypsinase and pepsic digestion, the vigor of nearly 50% can also be kept under the digestion of 300mg/l trypsinase and stomach en-enzyme.

The bacteriostasis of applicant to N,O-Diacetylmuramidase of the present invention is tested, selection comprises the totally 16 strain bacterial strain antimicrobial spectrum experiments such as Gram-positive, Gram-negative, MIC method is adopted to measure N,O-Diacetylmuramidase to the bacteriostatic action of bacterial strain, the results are shown in shown in following table 1, N,O-Diacetylmuramidase of the present invention has bacteriostatic action more widely, 16 kinds of bacterial strains are had to the restraining effect of degree varies, especially to the gram-positive microorganism that cell walls is thicker, there is significant restraining effect.

Table 1: N,O-Diacetylmuramidase of the present invention is to the restraining effect of different mushroom

Embodiment 2: the expression of Bacillus licheniformis N,O-Diacetylmuramidase of the present invention in e. coli bl21

First, the structure of expression plasmid: the sequence amplifying N,O-Diacetylmuramidase from Bacillus licheniformis DNA, PCR process adopts following primer:

Primers F: actgcaCATATGatgggaatcaaaggaatcgac;

Primer R:actgcaCTCGAGttatctaacacgaattttctgacca.

PCR primer and carrier all use Nde1 and Xho1 double digestion, and link, is built into expression plasmid pET21a-lyso.As shown in Figure 4, build the expression plasmid containing Bacillus licheniformis lysozyme gene, the plasmid that conversion builds is to expressive host recipient cell, picking mono-clonal contains in the LB substratum of corresponding resistant to 5ml, 37 DEG C, 200rpm incubated overnight, be cultured to about OD600=0.6, add IPTG to final concentration 1mM, be transferred to 20 DEG C, 200rpm continues inducing culture, in the process, and can at 2h, 4h, 6h, 8h, 10h sample to analyze expression situation respectively.

By the centrifugal 1min of 1ml bacterium liquid 12000rpm taken out, collect thalline, add the resuspended precipitation of 1ml PBS damping fluid, same centrifugal 1min.Add 300 ~ 500ml PBS re-suspended cell again, sonicated cells, by fracturing fluid 4 DEG C, the centrifugal 10min of 12000rpm, cleer and peaceful precipitation in separation.

Further, also comprise the step of extraction product being carried out to purifying on the basis of the above, comprising:

(1) Ni is irrigated ²⁺-NTA affinity column, carries out slow wash-out with deionized water, avoids introducing bubble in post bed;

(2) carry out pre-equilibration, loading with the starting buffer of 10 times of column volumes, the supernatant liquor after cytoclasis is injected Ni2+-NTA affinity column;

(3) carry out rinsing with the starting buffer of 10 times of ml, collect filtered solution;

(4) start to carry out wash-out with the starting buffer containing 20mM imidazoles of 5 times of column volumes, and elutriant is collected;

(5) carry out wash-out with the starting buffer containing 40mM, 60mM, 80mM, 100mM, 200mM, 300mM and 500mM imidazoles of 5 times of column volumes successively, respectively elutriant is collected;

(6) detected the effect reclaimed by SDS-PAGE, determine the most suitable wash-out concentration of imidazoles;

(7) take out the sample of 10 μ l from the filtrate that often pipe is collected, add the 2X sds gel sample loading buffer of 10 μ l, shake up;

(8) boiling water bath process 3min;

(9) take out sample, electrophoresis on the sds page 10 μ l samples being all splined on proper concn, electrophoresis result as shown in Figure 5.

Embodiment 3: the expression of Bacillus licheniformis N,O-Diacetylmuramidase in pichia spp

First, as shown in Figure 6, in bacillus coli DH 5 alpha, build the Expression vector pPIC9K containing Bacillus licheniformis gene, the structure of expression plasmid: the sequence amplifying N,O-Diacetylmuramidase from Bacillus licheniformis DNA, PCR process adopts following primer:

The primer F:actgcaGAATTCatgggaatcaaaggaatcgac;

Primer R:actgcaGCGGCCGCttatctaacacgaattttctgacca.

PCR primer and carrier all use EcoR1 and Not1 double digestion, and link, is built into expression plasmid pPIC9K-lyso.The method adopting electricity to transform is by Plastid transformation in pichia spp, and method for transformation is as follows:

First cell preparation is carried out

(1) in the 50ml centrifuge tube containing 5mlYPD, cultivate pichia spp, 30 DEG C are spent the night;

(2) get 0.1-0.5ml overnight culture, inoculation is containing the 2L shaking flask of 500ml fresh culture, and overnight growth is to OD600=1.3-1.5;

(3) at 4 DEG C, the centrifugal 5min collecting cell of 1500g, with the aqua sterilisa suspension cell of 500ml precooling;

As above centrifugal, with the aqua sterilisa suspension cell of 250ml precooling; With the 1M sorbyl alcohol suspension cell of 20ml precooling; As above centrifugal, with the 1M sorbyl alcohol suspension cell of 1ml precooling, be about 1.5ml to final volume.

Cell transforms after being ready to complete:

(1) get the above-mentioned cell of 80ul to mix with 5-20ug linearizing DNA (being dissolved in 5-10ulTE), proceed in the 0.2cm electricity revolving cup of precooling.5min is placed on ice;

(2) shock by electricity according to pichia spp parameter;

(3) content, in cup, is transferred in sterile centrifugation tube and is divided into 200-600ul equal portions by the 1M sorbyl alcohol adding 1ml precooling immediately, is applied on MD or RDB flat board

(4) flat board is hatched to cloning generation at 30 DEG C.

Fermentation culture flow process and purifying process as follows:

Zymotechnique:

1, seed flask is cultivated: from glycerine pipe, connect 200 microlitre bacterium liquid in 5 milliliters of YPD, and the inoculum size of cultivating by 1% after 12h is inoculated in 50mlBMGY, in 30 DEG C, 220r/min cultivates 24h.

2, high density fermentation is cultivated: by bacterium liquid in BMGY by 5% inoculum size access 1L automatic fermenter, with 50% ammoniacal liquor control pH6.0, temperature 30 DEG C, regulates mixing speed and air flow to maintain dissolved oxygen more than 30%.When glycerol depletion (dissolved oxygen rises rapidly), start to flow glycerol adding, when OD600 arrives 250, stop stream glycerol adding, after thalline hunger 0.5 ~ 1h, add methyl alcohol and start abduction delivering.Methanol feeding carries out according to dissolved oxygen, and whole process dissolved oxygen is controlled 30 ~ 50%.

Purifying process:

The pichia spp nutrient solution 10-50 ten thousand of the human lysozyme containing gene engineering expression is retained molecular film ultrafiltration, collects filtrate: to dam molecular weight ultrafiltration with 5000, collection dope; Carboxymethyl cellulose on dope, elution buffer wash-out, collects elutriant, crosses G-50 post desalination, frost drying, measures protein content and lysozyme activity.

Embodiment 4: the expression of Bacillus licheniformis N,O-Diacetylmuramidase in subtilis

First, the structure of expression plasmid: amplify promotor p43 and signal peptide respectively from subtilis DNA, then by fusion DNA vaccine method, p43 and signal peptide are merged.PCR primer containing p43 and signal peptide and carrier pGJ103 Xho1 and EcoR1 enzyme are cut and is built into carrier pGJ104.From Bacillus licheniformis DNA, amplify the gene of N,O-Diacetylmuramidase, PCR primer and plasmid pGJ104 EcoR1 and BamH1 enzyme are cut, link, is built into expression plasmid pGJ105.

In above-mentioned, subtilis amplification the primer is:

P43-F：actgcaCTCGAGtgtcgacgtgcatgcaggc；

P43-R：tataatggtaccgctatcacttta；

PsacB-SP-F：taaagtgatagcggtaccattataagttctttaggcccgtagtct；

PsacB-SP-R：actgcaGAATTCttctttcgcaaacgcttgagtt。

Amplify the sequence of N,O-Diacetylmuramidase in Bacillus licheniformis DNA, this process the primer is:

Primers F: actgcaGAATTCatgggaatcaaaggaatcgac;

Primer R:actgcaGGATCCttatctaacacgaattttctgacca.

PCR primer and carrier all use EcoR1 and Not1 double digestion, and link, is built into expression plasmid pPIC9K-lyso.As shown in Figure 7, in bacillus coli DH 5 alpha, build the expression vector PGJ105 containing Bacillus licheniformis gene, then adopt the method for electricity conversion by Plastid transformation in subtilis WB800.

In the present embodiment without in specified otherwise situation, intestinal bacteria and Bacillus subtillis are all at LB substratum (Tryptones: 10g/l; Yeast extract: 5g/l; Sodium-chlor: 10g/l; PH 7.5) in carry out aerobic shaking culture; If no special instructions, all bacterial strains all grow at 37 DEG C.During solid culture, in LB substratum, add the agar powder of 1.5g/l, when needing, add the microbiotic of suitable concn.

First in bacillus coli DH 5 alpha, build the carrier containing Bacillus licheniformis gene, and adopt the method for electricity conversion by Plastid transformation in subtilis.

Electricity method for transformation is as follows:

1, raw material prepares:

40ml (LB+0.5M sorbyl alcohol): peptone 10g/l, yeast powder 5g/l, NaCl 10g/l, 3.6g sorbyl alcohol pH=7.2; 200ml electricity turns substratum (0.5M sorbyl alcohol, 0.5M N.F,USP MANNITOL, 10% glucose): 18g sorbyl alcohol, 18.5g N.F,USP MANNITOL, 20g glucose; 10ml RM (0.5M sorbyl alcohol, 0.38M N.F,USP MANNITOL): 0.9g sorbyl alcohol, 0.7g N.F,USP MANNITOL; The 50ml centrifuge tube of 2 sterilizings.

2, transform

1) B.subtilis is inoculated in 3m1LB substratum, incubated overnight;

2) get in 2.6ml overnight culture access 40ml (LB+0.5M sorbyl alcohol), 37 DEG C, 200rpm is cultured to OD600=0.85 ~ 0.95;

3) by bacterium liquid ice-water bath 10min, then 5000g, 5min, 4 DEG C of collected by centrifugation thalline;

4) turn substratum (0.5M sorbyl alcohol, 0.5M N.F,USP MANNITOL, 10% glucose) with the electricity of 50ml precooling, again blow outstanding thalline, 5000g, 5min, 4 DEG C centrifugal removes supernatant, rinsing like this 4 times;

5) thalline after washing is blown be suspended from 1ml electricity and turn in substratum, every EP pipe packing 120;

6) by adding 50ngDNA (1 ~ 8 μ l) in 60 μ l competent cells, hatching 2min on ice, adding in the electric revolving cup (1mm) of precooling, electric shock once.Electroporation is arranged: 2.0kv, 1mm, shocks by electricity 1 time.(if electric shock result: time constant=4.5 ~ 5.0ms time constant <4.2, then needs to increase electricity and turns the rinsing times of substratum or improve competent extension rate, obtain higher transformation efficiency);

7) the complete taking-up cup that shocks by electricity also adds 1ml RM (LB+0.5M sorbyl alcohol+0.38 N.F,USP MANNITOL), 37 DEG C, 200rpm immediately, after recovery 3h, and coated plate.37 DEG C, incubated overnight.

After above-mentioned electricity has transformed, by bacterial strain culture expression albumen in LB substratum, the seed culture medium of 1% is inoculated in fermention medium, 37 DEG C, 220r/min cultivate respectively 8 hours, 12 hours, 16 hours and the centrifugal ultrasonication of sample thief in 20 hours, check protein expression.

The product purity of applicant to embodiment 2,3 is tested, and display product purity is all not less than 99.6%, illustrates that N,O-Diacetylmuramidase of the present invention production and extracting and purifying method effectively ensure that the purity of product.

Applicant has carried out DNA and amino acid sequencing to the product of embodiment 2-4 gained, result shows that its molecular weight of gained N,O-Diacetylmuramidase is consistent with sequence table middle-molecular-weihydroxyethyl, and its nucleotide sequence, aminoacid sequence are all consistent with sequence in sequence table SEQ IDNO:1, SEQ IDNO:3.

Claims (9)

1. a Bacillus licheniformis N,O-Diacetylmuramidase, is characterized in that, nucleotide sequence coded by shown in sequence table SEQ ID NO:1.

2. the production method of Bacillus licheniformis N,O-Diacetylmuramidase according to claim 1, it is characterized in that comprising and adopt e. coli strain bl21 as expressive host, using pET2l or pET28 series plasmids as expression vector, produce the step of Bacillus licheniformis N,O-Diacetylmuramidase with IPTG abduction delivering.

3. production method according to claim 2, is characterized in that comprising the steps:

(1) seed culture: picking mono-clonal from flat board, is inoculated in LB substratum, incubated overnight at 37 DEG C;

(2) abduction delivering: get seed culture medium and be inoculated in fermention medium LB, cultivates after to OD value to 0.6, adds IPTG induction, in 20 DEG C of cultivations;

(3) protein extraction: centrifugal acquisition cell, removes cell residue by after its ultrasonication, adopts membrane filtration, then ni-sepharose purification and get final product.

4. the production method of Bacillus licheniformis N,O-Diacetylmuramidase according to claim 1, it is characterized in that comprising and adopt pichia spp GSl15 bacterial strain as expressive host, using the plasmid of pPIC9K series as expression vector, by the step of methanol induction Expression product Bacillus licheniformis N,O-Diacetylmuramidase.

5. production method according to claim 4, is characterized in that comprising the steps:

First in bacillus coli DH 5 alpha, build the Expression vector pPIC9K containing Bacillus licheniformis gene, Plastid transformation in pichia spp, is then carried out following process by the method adopting electricity to transform:

(1) seed culture: inoculate bacterium liquid from glycerine pipe in YPD substratum, is inoculated in BMGY substratum after cultivation, cultivate at 30 DEG C;

(2) fermentation culture: by bacterium liquid access automatic fermenter in BMGY substratum, with 50% ammoniacal liquor control pH for 6.0, temperature 30 DEG C, regulates mixing speed and air flow to maintain dissolved oxygen more than 30%; Glycerol adding is flowed, until OD600 arrives 250 during glycerol depletion;

(3) abduction delivering: after the hungry 0.5-1h of thalline, add methanol induction and express;

(4) protein extraction: the pichia spp nutrient solution 10-50 ten thousand of the above-mentioned Bacillus licheniformis N,O-Diacetylmuramidase containing gene engineering expression is retained molecular film ultrafiltration, then to dam molecular weight ultrafiltration with 5000, collection dope; Add carboxymethyl cellulose in dope, elution buffer wash-out, collect elutriant, desalination, frost drying, to obtain final product.

6. the production method of Bacillus licheniformis N,O-Diacetylmuramidase according to claim 1, it is characterized in that comprising and adopt subtilis WB800 as expressive host, produce the step of Bacillus licheniformis N,O-Diacetylmuramidase using autonomously replicationg vector PGJl03 plasmid as expression vector.

7. production method according to claim 6, is characterized in that comprising the steps:

(1) in bacillus coli DH 5 alpha, build the PGJl03 plasmid vector containing Bacillus licheniformis gene;

(2) method of electricity conversion is adopted by Plastid transformation in subtilis;

(3) above-mentioned bacterial strains culture expression albumen in LB substratum, seed culture medium is inoculated in fermention medium, cultivates, the then centrifugal ultrasonication of sample thief at 37 DEG C, checks protein expression.

8. the application in fungistat prepared by Bacillus licheniformis N,O-Diacetylmuramidase according to claim 1.

9. application according to claim 8, is characterized in that the fungistat of described N,O-Diacetylmuramidase as gram-positive microorganism.