CN103993024B - DiospruskakiLinn.cv. Nantongxiaofangshi DkGA2ox2 gene as well as expression vector and application of DkGA2ox2 gene - Google Patents
DiospruskakiLinn.cv. Nantongxiaofangshi DkGA2ox2 gene as well as expression vector and application of DkGA2ox2 gene Download PDFInfo
- Publication number
- CN103993024B CN103993024B CN201410243661.7A CN201410243661A CN103993024B CN 103993024 B CN103993024 B CN 103993024B CN 201410243661 A CN201410243661 A CN 201410243661A CN 103993024 B CN103993024 B CN 103993024B
- Authority
- CN
- China
- Prior art keywords
- dkga2ox2
- gene
- tobacco
- plant
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the field of gene engineering and relates to a DiospruskakiLinn.cv. Nantongxiaofangshi DkGA2ox2 gene as well as an expression vector and an application of the DkGA2ox2 gene. According to the invention, DiospruskakiLinn.cv. Nantongxiaofangshi is firstly cloned to obtain a novel DkGA2ox2 gene, and the novel DkGA2ox2 gene is introduced to tobacco and is over-expressed in tobacco. The DkGA2ox2transgenic tobacco has relatively strong stunting capacity and can be used for stunting a plant to 32.11% of the height of a wild plant.
Description
Technical field
The invention belongs to genetic engineering field, it is related to ' Nantong little side persimmon ' dkga2ox2 gene and its expression vector and answers
With.
Background technology
Dwarfed plant plant type is compact, and hat width is little, resistant to lodging, and production management is convenient, and high yield characteristic is good.By genetic engineering
Means can significantly improve the yield of the crops such as wheat and paddy rice using downgrading proterties, thus having caused last century to be known in the whole world
" green revolution " so that breeding wheat for semidwarfness becomes the development trend of plant breeding.Gibberellin (gibberellin, ga) is one
Class tetracyclic diterpene carboxylic acid, as one of five big plant hormones, affects each stage that higher plant grows, and such as seed is sprouted
Send out, the elongation of stem, flower induction differentiation and Sex Determination, fruit bear fruit.Sent out by Japanese plant virologist early in nineteen twenty-six
Existing, have now been found that 136 kinds of gibberellin class material (http://www.plant hormones.info/
gibberellins.htm).Wherein, only ga1、ga3、ga4、ga5、ga7Etc. minority gibberellin, there is biologically active, remaining is to close
Become precursor or catabolite.Gibberellin 2 oxidizing ferment (ga2 β hydroxylase, ga2ox) is in plant inner gibberellin metabolic process
Key enzyme, be the dioxygenase being encoded by polygenes, act on the ga of biologically active1And ga4So as in 2 hydroxylatings of c
It is transformed into inactive ga8And ga34, make the activity of gas in plant body reduce and make plant shortened internodes, produce and downgrade proterties.
It downgrades function in arabidopsis, tobacco, wheat, plant of Solanaceae, paspalum notatum, paddy rice, willow, Japanese plum, jonquil and petunia
In be verified.The bush type culture of fruit tree has more early bearing, the of fine quality, advantage of updating decision, high efficiency.Persimmon (diospyros
Kaki) cultivate earliest in China, existing more than 2000 year history, China is also one of its original producton location.But China's persimmon kind mostly is height
Megaphanerophyte, is not easy to management and cultivation.' Nantong little side persimmon ' (diospyros kaki linn.cv.nantongxiaofangshi)
It is the rare dwarf form persimmon kind carrying out in Jiangsu Province nineteen eighty-two finding in Nantong City during Fruit Tree Resources generaI investigation.Dryness is weak, no
Substantially center is done, and tree performance is opened a business, and shows obvious Dwarf ism；Only 3.5 4 meters of the adult height of tree, is growth under equal conditions
The 60% of Qiaoization kind.But the research about the molecular level of the short raw characteristic of this kind is not yet carried out, if related to ga
It is not understood that.
Content of the invention
It is an object of the invention to provide new ' Nantong little side persimmon ' dkga2ox2 gene.
It is yet another object of the invention to provide the recombinant expression carrier containing this gene.
It is yet another object of the invention to provide the application of this gene.
The purpose of the present invention can be achieved through the following technical solutions:
' Nantong little side persimmon ' dkga2ox2 gene, nucleotide sequence is as shown in seq id no.1.
Recombinant expression carrier containing described dkga2ox2 gene.
Described dkga2ox2 gene is preferably inserted into expression vector pyh4215's by described recombinant expression carrier
Gained between bamhi and saci restriction enzyme site.
Host containing described dkga2ox2 gene.
The preferred Agrobacterium of described host.
Described dkga2ox2 gene downgrades the application in new germ plasm and/or plant species improvement in initiative.
The described recombinant expression carrier containing dkga2ox2 gene downgrades new germ plasm and/or plant species improvement in initiative
In application.
Beneficial effect:
Due to not yet having the homogenic report of Ebenaceae dkga2ox2, the side by homologous clone for the present invention in prior art
Method, according to the conserved regions design primer of homologous sequence known in other species in genbank, screens primer and profit through test of many times
With the method for gradient pcr, the carrying out of annealing temperature is continued to optimize with the intermediate segment having obtained dkga2ox2.The present invention first from
' Nantong little side persimmon ' clone obtained a new dkga2ox2 gene, by blast by dkga2ox2 nucleotide sequence with
The other species logging on ncbi carry out sequence alignment, dkga2ox2 and morning glory (gu189414.2), apple
(fj571521.1), oleander (ay594292.1), Chinese white poplar (jx102472.1), pears (jf441168.1), garden sorrel
(dq641499.1), grape (kc898179.1), petunia (gu059939.1) tobacco (ab125232.1), upland cotton
(hq891931.1) uniformity is respectively 75%, 76%, 74%, 75%, 75%, 75%, 74%, 74%, 73%, 73%.
The homology analysis of ' Nantong little side persimmon ' dkga2ox2 amino acid sequence and comparison result show, the present invention is obtained
Between dkga2ox2 and other species knowns, homology is relatively low, illustrates that two genes conservative between different plant species is not high,
The degree of variation being occurred in evolutionary process is also different.
The present invention also constructs the recombinant expression carrier of dkga2ox2, is conducted into tobacco, dkga2ox2 mistake in tobacco
Amount expression；Dkga2ox2 transgene tobacco has stronger dwarfing ability, and plant can be made to downgrade to WT lines
32.11%.
Brief description
Fig. 1 turns dkga2ox2 genetic tobacco pcr detection
Wherein m represents that marker, ck represent non-transgenic reference plant, and p represents positive control (plasmid), 1 21 expressions
Dkga2ox2 transgene tobacco strain
Fig. 2 turns dkga2ox2 genetic tobacco rt pcr detection
Wherein m represents that marker, ck represent non-transgenic reference plant, and p represents positive control (plasmid), 2 12 expressions
Dkga2ox2 transgene tobacco strain
Fig. 3 transplants the Phenotypic Observation of the transgene tobacco strain of 80 days.
Wherein, wt: non-transgenic tobacco strain；21,24: turn dkga2ox2 genetic tobacco strain (similarly hereinafter).
The change of height situation of Fig. 4 transgene tobacco strain.
Fig. 5 external source sprays ga3Can recovery transgenosis tobacco phenotypes
Wherein, a: spray ga3Before；B: spray ga3Afterwards
Fig. 6 rotaring gene plant blade ga1+3Content.
Fig. 7 transgenosis and the chlorophyll content of comparison strain various position leaves blade.
Wherein abscissa 4,10,16 represent plant the 4th, 10,16 leaf position blade from lower to upper respectively.
Fig. 8 overexpression dkga2ox2 gene evoking tobacco ntga20ox, ntga3ox and the expression of gene.
Fig. 9 pyh4215 plasmid map.
Specific embodiment
Embodiment 1
Take ' Nantong little side persimmon ' blade, extract rna with reference to the improved ctab method such as Cai Binhua.According to announce in genbank
Ga2ox gene cdna designs a pair of degenerate primers in sequence preservative area.Ga2ox-f:5 ' aayggygatrtbgghtggrtygaata
3’(seq id no.2)；Ga2ox-r:5 ' tgcytyacrctyttaaayctyccattwgtca 3 ' (seq id no.3).Its
In, y: represent c or t；R represents a or g；B represents c, t or g；H represents a, t or c；W represents a or t.
The acquisition of intermediate segment
The digestion of dna in total rna: (takara code:d2270a).Reverse transcription is with reference to primescripttmrt
reagent kit(perfect real time)(takara code:rr037a).Pcr amplification system: 100ng/ μ l cdna1
μ l, 10 × pcr buffer2.5 μ l, mgcl2(25mm) 1.5 μ l, dntp (2.5mm) 2 μ l, upstream and downstream primer (ga2ox-f/
Ga2ox-r) each 1 μ l, 0.15 μ l rtaq enzyme, complement to 25 μ l with water.Pcr program is: 94 DEG C of 4min；94 DEG C of 30s, 53 DEG C
30s, 72 DEG C of 40s, 35 circulations；72 DEG C of extension 10min.Product is analyzed in 1.5% agarose gel electrophoresis.Reclaim purpose fragment
And be connected on pmd19-t carrier conversion dh5 α competent cell random screening white colony and be sequenced.
The acquisition of 3 ' ends
By primescript during reverse transcriptiontmIn rt reagent kit, ramdom6 replaces with adapter-primer r11466:5 '
Gcaggactgcagctgactgactact30vn 3 ' wherein v represents a or g or c, and n represents: a, t, c or g (seq i d no.4), reversion
The temperature of record reaction is adjusted to 42 DEG C from 37 DEG C, and the temperature of the inactivation reaction of reverse transcriptase is adjusted to 95 DEG C from 85 DEG C).Pcr program and body
System is also same as the acquisition of intermediate segment.With universal primer r16326:5 ' ggtggtagagctcgcaggactgcagctgactg
3 ' (seq id no.5) and special outside primer ga2ox23 ' gsp-1:5 ' ttgatggacgagcagagcg 3 ' (seq id
No.6) carry out first round amplification, reaction system and program are as follows: pcr amplification system: 100ng/ μ l cdna1 μ l, 10 × pcr
Buffer2.5 μ l, mgcl2(25mm) 1.5 μ l, dntp (2.5mm) 2 μ l, each 1 μ l of upstream and downstream primer, 0.15 μ l rtaq enzyme, use
Water complements to 25 μ l.Pcr program is: 94 DEG C of 4min；94 DEG C of 30s, 61 DEG C of 30s, 72 DEG C of 40s, 35 circulations；72 DEG C of extensions
10min.Do template by after 10 times of first round pcr product dilution, with inner primer r16324:5 '
Agagctcgcaggactgcagcagctgactgactac 3 ' (seq id no.7) and ga2ox23 ' gsp-2:5 '
Catctccgttctaagatccaaca 3 ' (seq id no.8) carries out the second wheel amplification,
System is ibid.
The acquisition of 5 ' ends
The acquisition of cdna is with reference to smartertmRace cdna amplification kit (clontech,
cat.nos.634923&634924).Using upm and special Outside primer ga2ox25 ' gsp-1:5 '
Agttctggtcgggcgggacg 3 ' (seq id no.9) carries out the first round amplification of pcr of landing, and reaction system and program are such as
Under: 10 × ex taq buffer2.5 μ l, mgcl2(25mm) 1.5 μ l, 100ng/ μ l cdna1.0 μ l, gsp-10.5 μ l,
Upm2.0 μ l, dntp (2.5mm) 0.5 μ l, ex taq0.2 μ l, ddh2O17.8 μ l, final volume 25.0 μ l.
Reaction condition is: 94 DEG C of 5min；94 DEG C of 30s, 70 DEG C drop to 68 DEG C of 30s (often circulation reduce by 0.5 DEG C), 72 DEG C
2min, 5 circulations；94 DEG C of 30s, 68 DEG C of 30s, 72 DEG C, 90s, totally 30 circulations；72℃10min.Will be dilute for first round pcr product
Template is done, with inner primer ga2ox25 ' gsp-2:5 ' gcccttccgccattaactccagta 3 ' (seq id after releasing 10 times
No.10) carry out the second wheel amplification with nup, system is ibid.Product is analyzed with 1% agarose gel electrophoresis, cuts glue reclaim purpose piece
It is sequenced after Duan Jinhang t/a clone.
Using dnaman, the sequence at 5 ' ends, 3 ' ends and the correct clone of intermediate segment is spliced, obtain the total length of gene
Sequence, as shown in seq id no.1.Carry out similarity retrieval with blast, find dkga2ox2 nucleotide sequence and morning glory
(gu189414.2), apple (fj571521.1), oleander (ay594292.1), Chinese white poplar (jx102472.1), pears
(jf441168.1), garden sorrel (dq641499.1), grape (kc898179.1), petunia (gu059939.1) tobacco
(ab125232.1), the uniformity of upland cotton (hq891931.1) be respectively 75%, 76%, 74%, 75%, 75%, 75%,
74%th, 74%, 73%, 73%, belong to dkga2ox2 and belong to ga2- oxidation enzyme family.
Embodiment 2
According to the restriction enzyme site of carrier and dkga2ox2 gene, design contains bamhi and saci gene specific primer,
Dkga2ox2b-f:5 '-cgggatccatggtggtattgtc-3 ' (seq id no.11)；Dkga2ox2s-r:5 '-
cgagctcctaagttaacgaggctgc-3’(seq id no.12)；, carried out with ' Nantong little side persimmon ' total length cdna as template
Pcr expands, and pcr reaction system is: 100ng/ μ l cdna1 μ l, 10 × pcr buffer2.5 μ l, mgcl2(25mm) 1.5 μ l,
Dntp (2.5mm) 2 μ l, each 1 μ l of upstream and downstream primer, 0.15 μ l rtaq enzyme, complement to 25 μ l with water.Pcr program is: 94 DEG C
4min；94 DEG C of 30s, 62 DEG C of 40s, 72 DEG C of 70s, 35 circulations；72 DEG C of extension 10min.Product divides in 1% agarose gel electrophoresis
Analysis.Reclaim purpose fragment and be connected on pmd19-t carrier conversion dh5 α competent cell random screening white colony and surveyed
Sequence.
Utilize by original pyh4215 carrier and through dkga2ox2 gene in pmd19-t carrier after correct for the sequence verification
Bamhi and saci carries out double digestion.Carrier and genetic fragment are reclaimed in rubber tapping, convert Escherichia coli after connecting 5h.Bacterium solution pcr is identified
Positive colony, random 3 monoclonal sample presentation sequencings of picking, to guarantee accuracy and the specificity of product.Extract plasmid, pcr and
Digestion is identified.Escherichia coli plasmid freeze-thaw method is proceeded to Agrobacterium eha105 competent cell, positive gram of bacterium solution pcr identification
Grand.
Embodiment 3
Freeze-thaw method, by recombinant plasmid transformed Agrobacterium eha105, transfers single bacterium colony in 50ml l containing km50mg-1Yeb liquid
In body culture medium, 28 DEG C, when 200rpm shaking table culture is to od600 value about 0.5,5000rpm is centrifuged 10min, removes supernatant.Thalline
Do not contain hormone, the fluid nutrient medium Eddy diffusion of uncomfortable ph, shaking table culture 1h with 50ml ms；Qu30dMiao is taken root in ridge healthy and strong tobacco
Zu Peimiao, from the 4th and 5 fully expanded leaves of top clip, tobacco leaf is cut into 1-2cm2Leaf block put into above-mentioned culture medium
In, continuous jog soaks 3min；Take out blade with tweezers, be placed on aseptic filter paper and suck unnecessary bacterium solution, be inoculated in co-cultivation training
Foster base (ms+ba1.0mg l-1+naa0.2mg·l-1, ph5.8) in, 28 DEG C of light culture 2-3d；After end, tobacco leaf is turned
Enter screening and culturing medium (ms+6-ba1.0mg l-1+naa0.2mg·l-1+hyg30mg·l-1+cb200mg·l-1, ph5.8) in,
It is placed directly within illumination cultivation at 25 DEG C, light dark period 16h/8h, light intensity is 40-50 μm of ol m-2·s-1, squamous subculture every two weeks
Once, until callus differentiates resistant plant.When resistant budses length is to 3-5cm, cut access root media (1/2ms+
iba0.2mg·l-1+hyg30mg·l-1+cb200mg·l-1, ph5.8) in root induction.Open bottle cap after one month, carry out
Natural lighting, temperature control at 20-25 DEG C, hardening 1 week.Again transgenic seedling is transplanted to seedling-raising cup, keep environment to moisten, treat
Culture under outdoor natural conditions can be placed in after robust growth.
The detection of embodiment 4 transgene tobacco strain
Clip transgene tobacco and the wild-type tobacco blade not infected on superclean bench, immerse 10 μ l gus dye liquors
In, place 37 DEG C of incubators in overnight after, using 70% ethanol decolorization observe coloration result.It is blue plant to coloration result
Extract genome dna and total rna, carry out the detection of pcr and rt-pcr.
4.1 genome dna and the extraction of total rna
The extraction of genome dna and total rna with reference to (2008) such as Cai Binhua and opens the method that meter educates etc. (2010), and slightly makees
Modification, concrete grammar is as follows: takes seedling leaves about 0.3g rapid grind into powder in liquid nitrogen, adds and split containing 900 μ l ctab
In the 2ml centrifuge tube of solution liquid, 65 DEG C of water-bath 30min (every 10min gently overturns and mixes once), add isopyknic chloroform: different
Amylalcohol (24:1), mixing of gently turning upside down；4 DEG C, 12000rpm is centrifuged 15min, takes supernatant, adds equal-volume chloroform: isoamyl
Alcohol (24:1), mixing of gently turning upside down；4 DEG C, 12000rpm is centrifuged 15min, takes supernatant, repeats extracting once；Transfer supernatant
To new 1.5ml centrifuge tube, add the absolute ethyl alcohol of 20 DEG C of precoolings of two volumes and the naac (ph5.2) of 1/10 3m
(extracting dna) or add isopyknic 10m licl (extracting total rna), 20 DEG C of standings occur up to flocculent deposit, 4 DEG C,
12000rpm is centrifuged 15min；70% ethanol washing precipitation 12 times, is dried on superclean bench, is dissolved in 50 μ l depc and processed
Ddh2o in.Take the TNA of 1 μ l, detected with 1% agarose gel electrophoresis.
4.2pcr detection
The TNA 20 μ l taking said extracted carries out the digestion of rna in genome, referring in particular to Tong Zhaoguo's etc. (2008)
Method.Postdigestive genome dna is dissolved in the ddh of 20 μ l2In o, take the nucleic acid of 1 μ l, with 1% agarose gel electrophoresis
Detected.Dna detectable concentration on bio photometer, system is that 1 μ l dna sample adds 49 μ l ddh2O, dna concentration,
Od280/od260 directly reads from instrument.
Pcr detection template: transfer-gen plant dna, positive plasmid sample, non-transgenic reference plant dna；Pcr primer is joined
According to table 1；Amplification reaction system: 100ng/ μ l cdna1 μ l, 10 × pcr buffer2.5 μ l, mgcl2(25mm) 1.5 μ l, dntp
(2.5mm) 2 μ l, primer dkga2ox2b-f (seq id no.11) and each 1 μ l of dkga2ox2s-r (seq id no.12), 0.15
μ l rtaq enzyme, complements to 25 μ l with water.Pcr program is: 94 DEG C of 4min；94 DEG C of 30s, 62 DEG C of 40s, 72 DEG C of 70s, 35 circulations；
72 DEG C of extension 10min.Product is analyzed in 1% agarose gel electrophoresis, and result is shown in Fig. 1.
4.3rt pcr detects
By extract total rna on bio photometer detectable concentration, system be 1 μ l rna sample add 49 μ l
Ddh2o, rna concentration, od280/od260, od260/od230 directly read from instrument；Take total rna of 1 μ l, with 1% fine jade
Sepharose electrophoresis is detected, reverse transcription after remaining total rna carries out dna digestion becomes cdna, concrete grammar reference explanation book
(takara drr047a) is carried out, and the cdna after synthesis saves backup in 20 DEG C.
Rt pcr detection template: transfer-gen plant cdna, positive plasmid sample, non-transgenic reference plant cdna；Remaining
With pcr detection, result is shown in Fig. 2.
Embodiment 5 transgene tobacco downgrades character analysis
The mensure of 5.1 transgenic tobacco plant morphological indexs
Transfer-gen plant there occurs significant changes (Fig. 3) in the form of stem and leaf, 80d wild-type tobacco comparison after transplanting
Strain reaches full-bloom stage, and transgenic line 21 has just enter into and comes into bloom, but inflorescence number substantially lowers.24 also do not have
The sign at florescence, shows the phenomenon of flowering delay.And plant is substantially short and small, blade profile is compact.In order to more accurately quantify these
Phenomenon, to transplanting the comparison of 80 days and transgene tobacco strain carries out that plant height, internode, stem be thick, length of blade is (from leaf base to leaf
Point) and width of blade (blade width from) measurement, calculating blade length-width ratio.Table 1 result shows 2 transgenic line plant heights
All with compareed pole significant difference, 21,24 plant height is the 59.31% and 32.11% of comparison.In addition, transgenic line set section
Between Distance Shortened, be the 82.64% and 32.23% of wild-type tobacco；Stem is thick to be increased slightly, increases by 34.30% He than wild-type tobacco
64.98%；Length of blade shortens, and is the 66.21% and 52.94% of wild-type tobacco；Width of blade increases, and compares wild-type tobacco
Increase by 30.16% and 4.37%；Above index all reaches pole significant difference level.
The growth tendency of wild-type tobacco and transgenic line is substantially the same, and before 20d after transplanting, growing way difference is little.
But the period of 60d 80d wild-type tobacco rapid growth after transplanting, the plant height of transgenic line is not greatly improved,
And continue to keep gentle growth tendency (Fig. 4).
After transplanting, 30d sprays the ga of 100mg/l to transgenic tobacco plant and comparison3.Twice a week, continuously spray.
Observe phenotype after 30 days and find, by applying the process of external source ga3, transfer-gen plant internode extends rapidly, can normally bloom, can
Recover normal phenotype such as Fig. 5.
The mensure of 1 turn of dkga2ox2 gene plant morphological index of table
Wt: non-transgenic tobacco strain；21,24: turn dkga2ox2 genetic tobacco strain；
wt:non‐transgenic tobacco plant；2‐1,2‐4:transgenic tobacco plants of
dkga2ox2；
Note: in table, * * represents through the test of Deng Kenshi multiple extreme difference, reaches 1% level of signifiance "
note:meanswith*aresignificantlydifferent(p<0.01)
5.2.1 the mensure of GA content
Take the fully deployed functional leaf of transgenosis and wild-type tobacco plants (upper the 4th expansion leaf of number) at the florescence, use enzyme
Linked immunosorbent assay (elisa) measures content, and result shows: the ga content of transgenic line is below compareing (Fig. 6)；Turn
Gene strain 21,24 blade ga contents are comparison 70.98% and 41.46%；Overexpression in tobacco for this gene is described,
Effectively inhibit the synthesis of plant source gibberellin, so that the plant height of transfer-gen plant substantially becomes short.
5.2.2 photosynthetic efficiency measures
In the morning (10:00 12:00) of florescence fine day, measured using the portable photosynthetic analyzer of li 6400xt type and turn base
Because of the photosynthetic rate situation of tobacco and wild-type tobacco, measurement site is tobacco plant from bottom to top the 12nd leaf, avoids main lobe
Arteries and veins, every strain selects uniform 3 plants of growing way, and same blade repeats to survey 3 times, record Net Photosynthetic Rate, stomatal conductance and transpiration speed
Rate, the results are shown in Table 2.Result shows: transgenic line net assimilation efficiency rises 16.14% and 33.48% than comparison.Rising speed
Rate is proportionate with stomatal conductance, and transgenic line transpiration rate is only the 78.24% and 59.56% of comparison, and stomatal conductance is
The 83.72% and 65.11% of comparison.
The mensure of 2 turns of dkga2ox2 genetic tobacco photosynthetic rate indexs of table
Note: wt: non-transgenic tobacco strain；21,24: turn dkga2ox2 genetic tobacco strain；
wt:non‐transgenic tobacco plant；2‐1,2‐4:transgenic tobacco plants of
dkga2ox2；
Note: in table, * * represents through the test of Deng Kenshi multiple extreme difference, reaches 1% level of signifiance "
note:meanswith*aresignificantlydifferent(p<0.01)
5.2.3 the mensure of chlorophyll content
The blade taking tobacco plant upper, middle and lower after transplanting on the 8th week measures chlorophyllous content for material.Ye Wei
Counting is from lower to upper, and bottom, middle part and top are the 4th, 10,16 leaf position blade respectively.As shown in fig. 7, each transgenic line
Essentially identical with the variation tendency of wild type control strain: from tender leaf to old leaf, chlorophyll content assumes downward trend, middle part and
The chlorophyll content difference on top is little.The chlorophyll content of transgenic line is above wild type control strain, downgrades more
Significantly the chlorophyll content of the chlorophyll content of transgenic line 2421 strains relatively lighter than dwarf degree is high.Middle part
The amplitude that blade Determination of Chlorophyll increases is maximum, increased 32.79% than wild type.Indicated above, dkga2ox2 gene is in tobacco
In expression improve leaf chlorophyll content so that leaf color deepen.
The expression analysis of 5.3 transgene tobacco ga2ox related genes
According to tobacco ga20ox, ga3ox sequence logging on ncbi database website, set using beacon designer7.0
Meter gene specific primer, tobacco ga20ox gene-specific primer is ntga20ox-f:5 '-tgctttctttctttgtccaa-
3 ' (seq id no.13), ntga20ox-r:5 '-ctctgtaatgcttctgtgtaa-3 ' (seq id no.14)；Ga3ox base
Because specific primer is ntga3ox-f:5 '-aagactgatgtggctcat-3 ' (seq id no.15), ntga3ox-r:5 '-
tgttaatatggtagaatccgtatgt-3’(seq id no.16).This experiment with tobacco tubulin gene as reference gene,
Its specific primer is nttuba1-f:5 '-cttatgttccgtggtgatg-3 ' (seq id no.17), nttuba1-r:5 '-
ttggtggctgatagttga-3’(seq id no.18).By fluorescent quantitation rt pcr technical research transgene tobacco strain
The expression characterization of middle ga20ox, ga3ox gene.Qrt pcr reaction system is cdna1 μ l, and upstream and downstream primer is respectively
0.2pmol l 1sybr premix ex taq (takara) 10 μ l, ddh2o8.6μl.Reaction condition is 95 DEG C of 4min；95℃
20s, 60 DEG C of 20s, 72 DEG C of 40s, 40 circulations.3 repetitions of test setting.Data analysis adopt 7300system software andMethod.Result shows: in transgene tobacco strain, the expression of ntga20ox and ntga3ox gene has obtained difference
The reinforcement of degree.The ascensional range of the wherein expression of ntga3ox gene is relatively large (Fig. 8).
The present invention has obtained a new dkga2ox2 gene from ' Nantong little side persimmon ' clone first, and constructs
Dkga2ox2 expression vector, by Agrobacterium-mediated transformation Nicotiana gossei.Dkga2ox2 transfer-gen plant table from phenotype
Reveal dwarfing proterties: length of blade diminishes, width becomes big, and blade length-width ratio reduces, and leaf color is deepened, and stem slightly increases, and internode reduces；
Flowering delay, and inflorescence number substantially reduces, and illustrates that in tobacco, overexpression dkga2ox2 has to growing of reproductive organs
Certain impact；External source applies ga3After can recover phenotype.This shows, the overexpression of dkga2ox2 reduces biological in tobacco living
The level of property ga, Dwarfing phenotypes are caused by biologically active ga deficiency.Table excessively in arabidopsis atga2ox7 and atga2ox8
Reach and osga2ox6 in paddy rice, osga2ox5 ox plant also shows similar dwarfing proterties.
We have carried out expression analysis by the gene of the enzyme to coding ga biosynthesis pathway genes.Compared with wt, turn
In dkga2ox2 tobacco, ga biosynthesis gene ntga20ox and ntga3ox is obtained for different degrees of rise.This is probably
Because overexpression dkga2ox2 reduces the content of source ga in tobacco, the feed-back regulatory mechanism of gibberellin makes other gibberellin
The expression of related gene also rises to maintain the dynamic equilibrium of plant inner gibberellin.The increasing of wherein ntga3ox expression
It is larger that to be possibly due to it be last key enzyme in encoding bioactive ga building-up process.The rise of ga20ox and ga3ox
It is reported in ga defect and the insensitive mutant of ga.Thus, it is possible to speculate that the difference of transgenosis Dwarfing phenotypes is probably
Caused by following two reasons, first, the gene insertion site in transgene tobacco strain and copy number have differences, or
Caused by transgenosis chimera；Second, the Agrobacterium that may be differed by degree of transgenic line or other external environment shadow
Ring.
Transgenic line ties up to compare with wild-type tobacco on the photosynthetic parameters of measured 3 has notable difference: its
Net assimilation rate rises, and stomatal conductance and transpiration rate have reduction.Chlorophyll plays the part of luminous energy in photosynthesis of plant
Absorb the effect with transmission.In effective scope, with the increase of chlorophyll content, photosynthetic rate is consequently increased, thus leading
Cause the raising of biological yield.May is that and chlorophyllous metabolic process be have impact on due to the reduction of gas content in transgene tobacco body,
Photosynthetic rate is made to improve therewith so that chlorophyll content increases.Leaf cell structure also there occurs change simultaneously, and blade becomes
Thickness, stomatal conductance is low to lead to transpiration rate to reduce, and to avoid the invalid loss of moisture, improves the storage capacity of blade.
Claims (7)
1. the little side in Nantong persimmon dkga2ox2 gene is it is characterised in that nucleotide sequence is as shown in seq id no.1.
2. the recombinant expression carrier containing the dkga2ox2 gene described in claim 1.
3. recombinant expression carrier according to claim 2 is it is characterised in that described recombinant expression carrier is will be described
Dkga2ox2 gene is inserted into gained between bamhi the and saci restriction enzyme site of expression vector pyh4215.
4. the Host Strains containing the dkga2ox2 gene described in claim 1.
5. Host Strains according to claim 4 are it is characterised in that described Host Strains are Agrobacterium.
6. the dkga2ox2 gene described in claim 1 downgrades the application in new germ plasm and/or plant species improvement in initiative.
7. the recombinant expression carrier containing dkga2ox2 gene described in claim 2 downgrades new germ plasm and/or plant in initiative
Application in breed improvement.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410243661.7A CN103993024B (en) | 2014-06-03 | 2014-06-03 | DiospruskakiLinn.cv. Nantongxiaofangshi DkGA2ox2 gene as well as expression vector and application of DkGA2ox2 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410243661.7A CN103993024B (en) | 2014-06-03 | 2014-06-03 | DiospruskakiLinn.cv. Nantongxiaofangshi DkGA2ox2 gene as well as expression vector and application of DkGA2ox2 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103993024A CN103993024A (en) | 2014-08-20 |
| CN103993024B true CN103993024B (en) | 2017-01-18 |
Family
ID=51307355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410243661.7A Active CN103993024B (en) | 2014-06-03 | 2014-06-03 | DiospruskakiLinn.cv. Nantongxiaofangshi DkGA2ox2 gene as well as expression vector and application of DkGA2ox2 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103993024B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001048215A1 (en) * | 1999-12-24 | 2001-07-05 | National Institute Of Agrobiological Sciences | RICE-ORIGIN GIBBERELLIN 2β-HYDROXYLASE GENES AND UTILIZATION THEREOF |
| WO2007135685A3 (en) * | 2006-05-23 | 2008-02-14 | Univ Ramot | Compositions for silencing the expression of gibberellin 2-oxidase and uses thereof |
| CN102757487A (en) * | 2011-04-27 | 2012-10-31 | 中国农业大学 | Plant dwarfing related protein GA2ox, and encoding gene and application thereof |
-
2014
- 2014-06-03 CN CN201410243661.7A patent/CN103993024B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001048215A1 (en) * | 1999-12-24 | 2001-07-05 | National Institute Of Agrobiological Sciences | RICE-ORIGIN GIBBERELLIN 2β-HYDROXYLASE GENES AND UTILIZATION THEREOF |
| WO2007135685A3 (en) * | 2006-05-23 | 2008-02-14 | Univ Ramot | Compositions for silencing the expression of gibberellin 2-oxidase and uses thereof |
| CN102757487A (en) * | 2011-04-27 | 2012-10-31 | 中国农业大学 | Plant dwarfing related protein GA2ox, and encoding gene and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Cloning and Preliminary Function Analysis of Three Gibberellin 2-Oxidase Genes in Petunia(Petunia hybrida);Guo Yu-Long et al.;《Journal of Agricultural Biotechnology》;20131231;第21卷(第8期);第940-948页 * |
| 南通小方柿矮生性状及生理生化特性的研究;戴文浩 等;《南京农业大学学报》;19991231;第22卷(第2期);第21-24页，尤其是摘要 * |
| 棉花赤霉素代谢基因GhGA2ox2的功能分析;胡林;《中国优秀硕士学位论文全文数据库·农业科技辑》;20100815;全文，尤其是摘要、第1.2.1.3节、3.2.1-3.2.2节、4.1、5.1节、图4.1 * |
| 珍稀矮生型柿品种——南通小方柿;蒋德新 等;《江苏农业科学》;19921231;第49-50页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103993024A (en) | 2014-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107208100A (en) | Plant nitrate transport albumen and application thereof | |
| CN107058337B (en) | Flowering gene CsFT of tea tree and coding protein thereof | |
| CN102787121A (en) | Method for validating transcription factor gene function | |
| CN106591322A (en) | Gingko MADS-box transcription factor gene GbMADS9 for controlling blossoming of plants and encoding protein and application of Gingko MADS-box transcription factor gene GbMADS9 | |
| WO2020249108A1 (en) | Up gene and application thereof in plant improvement | |
| CN102757487B (en) | Plant dwarfing related protein GA2ox, and encoding gene and application thereof | |
| CN114606245B (en) | Tea tree CsVAAT3 gene and application thereof | |
| CN113046368A (en) | Rice gene OsPM1 gene and application of promoter in improving high-temperature stress resistance of rice | |
| CN114752579A (en) | Application of ZmMAPK protein and coding gene thereof in regulation and control of low-temperature stress tolerance of plants | |
| CN112063631A (en) | PtrLBD4-3 gene of populus trichocarpa as well as encoding protein and application thereof | |
| CN105821060A (en) | Soybean low-phosphorus-resistance related gene GmACP2, encoded protein and application of GmACP2 | |
| CN109879947A (en) | 2 gene of moso bamboo transcription factor PheDof and application | |
| CN109182351A (en) | Barley HvALS1 gene and application thereof | |
| US20230272411A1 (en) | Heat-shock related gene zmhsf11 and application of zmhsf11 in regulating heat-resistence of plant | |
| CN115725615B (en) | Upland cotton GhABC1K14-A09 gene and application thereof in drought resistance and salt tolerance of upland cotton | |
| CN103993024B (en) | DiospruskakiLinn.cv. Nantongxiaofangshi DkGA2ox2 gene as well as expression vector and application of DkGA2ox2 gene | |
| CN114958906B (en) | Gene and promoter related to low potassium stress of tobacco and application of gene and promoter | |
| CN108359670A (en) | Improve microRNA genes and its application of arsenic stress rice tolerance | |
| CN105505946B (en) | A kind of gene GF14e, albumen and its application improving Pyricularia Oryzae resistance | |
| CN104152468B (en) | ' the little side's persimmon in Nantong ' DkGA2ox1 gene and expression vector thereof and application | |
| CN111518803B (en) | RNAi fragment and application thereof in regulation and control of lignin synthesis | |
| CN109234290B (en) | Brassica napus BnKAT2 gene and promoter and application thereof | |
| CN116179564B (en) | Upland cotton GhABC1K12-A07 gene and application thereof | |
| CN114181946B (en) | Gene and promoter related to low nitrogen stress resistance of plants and application of gene and promoter | |
| CN115785242B (en) | Method for creating high yield and high quality rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |