CN103966189A - Method for extracting UNG (uracil-N-glycosylase) - Google Patents
Method for extracting UNG (uracil-N-glycosylase) Download PDFInfo
- Publication number
- CN103966189A CN103966189A CN201410180401.XA CN201410180401A CN103966189A CN 103966189 A CN103966189 A CN 103966189A CN 201410180401 A CN201410180401 A CN 201410180401A CN 103966189 A CN103966189 A CN 103966189A
- Authority
- CN
- China
- Prior art keywords
- ung
- ung enzyme
- engineering bacteria
- minutes
- supernatant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/02—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2) hydrolysing N-glycosyl compounds (3.2.2)
- C12Y302/02027—Uracil-DNA glycosylase (3.2.2.27)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides a method for extracting UNG (uracil-N-glycosylase). The method comprises the following steps: after taking UNG engineering bacteria for activation, adding IPTG (isopropyl-beta-d-thiogalactoside) for inducible expression to obtain expressed engineering bacteria; adding DTT and tween-20 after the expressed engineering bacteria are treated with lysozyme at room temperature, treating for a period of time on ice and then centrifuging to obtain crude protein; slowing adding silicon dioxide particles, stirring in a magnetic stirring apparatus, centrifuging to remove precipitates and obtain supernatant; transferring the supernatant to a water bath which has been preheated to 70 DEG C, hatching and then centrifuging to remove precipitates and obtain supernatant; desalting after the supernatant flows through an Ni<2+>-chelated Ni-NTA column to obtain the purified UNG; adding glycerol in the obtained M-MLV reverse transcriptase, so that the volume fraction is 50%, and saving at -20 DEG C. The method is simple, small in enzyme activity loss, and high in purity, activity and recovery capacity of the recovered protein.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of method of extracting purifying UNG enzyme.
Background technology
The action principle of UNG enzyme is the uridylic glycosidic link that selective hydrolysis ruptures in two strands or the single stranded DNA that contains dU, the DNA chain that has disappearance base of formation, and the further hydrolytic cleavage of meeting under alkaline medium and high temperature, thus be eliminated.The optimum activity temperature of UNG enzyme is 50 DEG C, 95 DEG C of deactivations.PCR reaction is the most common, and most important pollutent is PCR product, and anti-pollution heat start PCR test kit replaces dTTP with dUTP, so PCR product is all the DNA chain that contains dU.Before starting, PCR increases the incubation step of 50 DEG C, UNG enzyme can be by the uridylic base degraded in existing U-DNA pollutent in reaction system, and DNA splitting of chain under the condition of this step of sex change subsequently, eliminate the amplification producing due to contaminating dna, thereby ensure the specificity of amplification, accuracy.
At present, because the easy deactivation of activated protein thereby purifying are all to require to carry out (operation on ice) under cold condition, conventional purifying UNG enzyme method adopts low temperature ultrasonication, repeatedly pass through ammonium sulfate precipitation, ion-exchange, purifying is carried out in chromatography and desalination, not only can will lose at the purifying initial stage up to 50% albumen, portion gene histone is difficult to remove completely, the existence of adding genome albumen can cause upper prop speed slow, extend the purifying time, the protease activity that purifying obtains reduces, affect the activity of late enzyme, be unfavorable for the Application and Development of qPCR test kit.
Summary of the invention
The object of the present invention is to provide one simple, loss of enzyme activity is little, the extracting method of the active protease that the purity of recovery albumen and yield are high.
For achieving the above object, the invention provides a kind of method of extracting purifying UNG enzyme, it is characterized in that, comprise the steps,
1) activation of engineering bacteria and expression: get after UNG enzyme engineering bacteria activates rear and shaking culture and add IPTG induction; Washing; Centrifugal collection thalline; The thalline of collecting washs by buffer A, centrifugal; Again with the resuspended engineering bacteria that obtains expression of buffer A;
2) crude protein preparation: with adding DTT after N,O-Diacetylmuramidase room temperature treatment, tween 20, processes after for some time centrifugally on ice by the engineering bacteria of described expression, and the supernatant obtaining is crude protein;
3) in crude protein, slowly add silica dioxide granule, on magnetic stirring apparatus, stir, centrifugal removal precipitation obtains supernatant;
4) the described supernatant obtaining is moved in the water-bath that is preheated to 70 DEG C, hatch rear centrifugal, remove precipitation, obtain supernatant;
5) supernatant flows through the Ni-NTA post of chelating Ni2+, then carries out desalination and obtain the UNG enzyme of purifying;
Described buffer A is 20mM Tris-HCl, 0.2M NaCl, pH 8.0;
Optional, it is 50% ,-20 DEG C of preservations that the M-MLV reversed transcriptive enzyme obtaining adds glycerine to make volume fraction.
Described UNG enzyme engineering bacteria is that pcr amplification obtains PCR product from moloneys mouse leukosis virus, gained PCR product is connected on the PET28a carrier of Nde I, Sal I double digestion after Nde I, Sal I double digestion, construction of expression vector PET28a-UNG, transforms above-mentioned plasmid to express bacterium BL21 (DE
3), obtain the engineering strain of Restruction UNG enzyme.
Described pcr amplification primer used is SEQ ID NO:1 and SEQ ID NO:2.
Described step 1) is to get UNG enzyme engineering bacteria to be inoculated in the LB liquid nutrient medium containing kantlex, shaking culture; Get the bacterium liquid having activated and be transferred in same LB liquid nutrient medium, after shaking culture, add IPTG inducing culture 8 hours; With centrifuge tube supersound washing 30min, and with distilled water rinse once; Centrifugal collection thalline; The thalline of collecting washs by buffer A, centrifugal; Again with the resuspended engineering bacteria that obtains expression of buffer A.
Described step 1) is to get UNG enzyme engineering bacteria to be inoculated in the LB liquid nutrient medium containing kantlex, and 37 DEG C, 200rpm shaking culture is spent the night; Get the bacterium liquid having activated and be transferred in same LB liquid nutrient medium, 37 DEG C, 250 revs/min of shaking culture add 1M IPTG to final concentration 1.0mmol/L after 4 hours, under 28 DEG C, 250 rpm parts, cultivate 8 hours; With centrifuge tube supersound washing 30min, and with distilled water rinse once; 12000rpm, collects thalline for centrifugal 5 minutes for 4 DEG C; The thalline of collecting washs once by buffer A, 12000rpm, and 4 DEG C are centrifugal 5 minutes; Again with the resuspended engineering bacteria that obtains expression of buffer A.
Described step 2) be 1mM for adding DTT to make final concentration after 20 minutes by 4mg/ml final concentration N,O-Diacetylmuramidase room temperature treatment the engineering bacteria of described expression, adding tween 20 to make volume percent is 0.5%, process on ice 45 minutes, 15000g/4 DEG C/20 minutes, the supernatant obtaining was crude protein.
Described step 3) is the silica dioxide granule that slowly adds volume coefficient 5% in crude protein, on magnetic stirring apparatus, stir 10 minutes, 15000g, 4 DEG C centrifugal 20 minutes, remove precipitation.
In described step 4), hatch 10 minutes, centrifugal condition is 15000g/4 DEG C/20 minutes.
Described step 5) is to flow through the Ni-NTA post of chelating Ni2+ after supernatant is supplied NaCl, and this post is first used 10 times of bed volume binding buffer liquid balances; Wash successively with 5 times of bed volume washing buffer solution again; Finally use elutriant wash-out target protein.Containing the UNG enzyme that obtains purifying after sephadexG25 desalination for elutriant of target protein; The desalination damping fluid of using in desalination is: 20mM Tris-HCl, pH 7.5 under 25 ° of C, 300mM KCl, 1mM DTT, 0.2mM EDTA, 1mg/ml BSA;
Described binding buffer liquid is 20mM Tris-HCL, 0.5MNaCl, PH8.0,5mM imidazoles; Described washing buffer solution is 20mM Tris-HCL, 0.5MNaCl, PH8.0,15mM/50mM imidazoles; Described elutriant is 20mM Tris-HCL, 0.1MNaCl, PH8.0,200mM imidazoles.
Production technique of the present invention is rationally simple, only needs the broken thalline of N,O-Diacetylmuramidase, silicon-dioxide absorption nucleic acid and foreign protein, 70 DEG C add hot incubation and process 10 minutes, affinity chromatography is carried out purifying, has avoided repeatedly passing through for a long time ion exchange column in conventional UNG enzyme purification, and chromatography column and desalting column carry out purifying.Ensure that enzymic activity is well kept, ensured product production and purity, can eliminate up to 10
9u-DNA product, can contain the anti-pollution system of UNG/dUTP for setting up.
the confirmation of product
(1) gene source
UNG enzyme gene is for from intestinal bacteria Ecoli JM109(K-12 source) increase and obtain.
amplimer is:
UNG F：ATACATATGGCTAACG AATTAACCTG GCATG (SEQ ID NO:1)
UNG R：CTGGTCGACTTACTCACTCTCTGCCGGTAATACT (SEQ ID NO:2)
Gene order information: >gnl|ECOLI|EG11058 ung " EG11058-MONOMER " 2714776..2715465 Escherichia coli K-12 substr. MG1655;
(2) carrier source
PET-28a expression plasmid is purchased from Novagen company of the U.S..This plasmid has 1 T7 promotor before cloning site, before T7 promotor, there is 16 × His-Tag coding sequence, be the enhanser of T7, in multiple clone site, have NcoI-Xhol11 restriction enzyme site, on carrier, also have the selection markers of 1 kantlex (Kan);
(3) Host Strains
Host Strains is BL21 (DE
3) bacterial strain, Host Strains BL21 is through phage DE
3after lysogenization, DE
3lacUV5 strong promoter and the T7 rna polymerase gene that is arranged in its downstream be integrated into the genomic dna of Host Strains.Host Strains can produce a large amount of t7 rna polymerases under the inducing action of non-metabolic lactose analogue IPTG, and t7 rna polymerase can be identified the T7 promoter sequence in Pet-28a expression vector specifically, thereby expresses efficiently object recombinant protein.Because IPTG can not utilized by Host Strains, therefore in nutrient solution, add a small amount of IPTG just can produce lasting inducing action to lacUV5 strong promoter;
(4) UNG enzyme engineering bacterial strain
The pcr product of UNG enzyme gene is through Nde I, Sal I double digestion on the PET28a carrier of Nde I, Sal I double digestion, and construction of expression vector PET28a-UNG, transforms above-mentioned plasmid to express bacterium BL21 (DE
3), obtain the engineering strain of Restruction UNG enzyme.
2. the preparation of product
1. use 50ml buffer A (20mM Tris-HCL, 0.2MNaCl, PH8.0) resuspended thalline, 4mg/ml final concentration N,O-Diacetylmuramidase room temperature treatment 20 minutes, adding DTT to make final concentration is 1mM, and adding tween 20 to make volume percent is 0.5%, processes on ice 45 minutes, 15000g/4 DEG C/20 minutes, the supernatant obtaining was crude protein;
2. in crude protein, slowly add the silica dioxide granule of volume coefficient 5%, on magnetic stirring apparatus, stir 10 minutes (absorption genomic dna and foreign protein), 15000g/4 DEG C/20 minutes, remove precipitation, supernatant moves into clean centrifuge tube;
3. the supernatant 2. step being obtained moves in the water-bath that is preheated to 70 DEG C, hatches 10 minutes, and 15000g/4 DEG C/20 minutes, remove precipitation, supernatant moves into clean centrifuge tube;
supernatant liquor supply NaCl to final concentration be 0.5M, flow through the Ni-NTA post of chelating Ni2+, this post is first used 10 times of bed volume binding buffer liquid (20mM Tris-HCL, 0.5MNaCl, PH8.0,5mM imidazoles) balance; Use again 5 times of bed volume washing buffer solution (20mM Tris-HCL, 0.5MNaCl, PH8.0,15mM/50mM imidazoles) to wash successively; Finally use elutriant (20mM Tris-HCL, 0.1MNaCl, PH8.0,200mM imidazoles) wash-out target protein.Containing the elutriant sephadexG25 desalination of target protein, desalination damping fluid is buffer B: (10mM Tris-HCl (25 ° of C of pH 7.5 at), 300mM KCl, 1mM DTT, 0.1mM EDTA, 0.5mg/ml BSA).After desalination, adding glycerine to make volume fraction be 50% ,-20 DEG C saves backup.
3. the purposes of product
PCR reaction is the most common, and most important pollutent is PCR product, and anti-pollution heat start PCR test kit replaces dTTP with dUTP, so PCR product is all the DNA chain that contains dU.Before starting, PCR increases the incubation step of 50 DEG C, UNG enzyme can be by the uridylic base degraded in existing U-DNA pollutent in reaction system, and DNA splitting of chain under the condition of this step of sex change subsequently, eliminate the amplification producing due to contaminating dna, thereby ensure the specificity of amplification, accuracy.High-quality UNG enzyme is applicable to being applied to the exploitation of qPCR test kit.
Beneficial effect
1. with conventional UNG enzyme extraction method contrast, adopt 70 DEG C of incubation step, remove to greatest extent foreign protein, ensureing purifies obtains high purity UNG enzyme;
2. with conventional UNG enzyme extraction method contrast, extracting purge process adds silicon-dioxide to carry out the absorption of nucleic acid and foreign protein, remove a large amount of nucleic acid and foreign protein, upper prop speed is fast, effectively reduce the non-specific adsorption machine meeting of affinity column amplifying nucleic acid and foreign protein, reduce the upper prop time, be conducive to ensure to reclaim the purity of albumen and keep enzymic activity;
3. with conventional UNG enzyme extraction method contrast, the present invention only needs affinity column and desalting column, and upper prop number of times is few, simple to operate, avoid Reusability ion exchange column and chromatography column, easily carry out protein purification and effective guarantee protein recovery in common lab.
Brief description of the drawings
Fig. 1 is SDS-PAGE purity detecting electrophorogram.
Fig. 2 is uridylic-N-glycosylase (UNG) enzymic activity detected result figure.
Fig. 3 is that the activity that does not add uridylic-N-glycosylase (UNG) enzyme detects control experiment result figure.
Embodiment
Describe embodiments of the invention below in detail, the example of described embodiment is shown in the drawings, and wherein same or similar label represents same or similar element or has the element of identical or similar functions from start to finish.Be exemplary below by the embodiment being described with reference to the drawings, be intended to for explaining the present invention, and can not be interpreted as limitation of the present invention.Unreceipted concrete technology or condition person in embodiment, according to the described technology of the document in this area or condition or carry out according to product description.The unreceipted person of production firm of agents useful for same or instrument, being can be by the conventional products of commercial acquisition.
Embodiment 1:
One, main agents is prepared
1.LB liquid nutrient medium (1000 mL)
NaCl：10g
Peptone: 10g
Yeast powder: 5g
2. buffer A (20mM Tris-HCl, 0.2M NaCl, pH 8.0) (1000 mL)
Trizma-HCl：1.7651g
Trizma-Base：1.066g
NaCl：11.688g
3. buffer B (20mM Tris-HCl, 0.5M NaCl, pH 8.0) (1000 mL)
Trizma-HCl：1.7651g
Trizma-Base：1.066g
NaCl：29.22g
4. lavation buffer solution C:(20mM Tris-HCl, 0.5M NaCl, 5mM imidazoles, 0.5%Tween-20, pH 8.0) (100 mL)
Buffer B: 100mL
3M imidazoles: 167uL
Tween-20：500 uL
5. lavation buffer solution D:(20mM Tris-HCl, 0.5M NaCl, 5mM imidazoles, pH 8.0) (100 mL)
Buffer B: 100mL
3M imidazoles: 167uL
Two, structure and the expression of uridylic-N-glycosylase (UNG) enzyme engineering bacteria
1, the structure of uridylic-N-glycosylase (UNG) enzyme engineering bacteria
1) template is intestinal bacteria Ecoli.JM109 genomic dna.(precious biotechnology (Dalian) company limited)
2) amplimer is:
UNG F：ATACATATGGCTAACG AATTAACCTG GCATG SEQ ID NO:1
UNG R：CTGGTCGACTTACTCACTCTCTGCCGGTAATACT SEQ ID NO:2
3) also configuration of UNG reaction buffering:
Add respectively P
fuarchaeal dna polymerase 10 × reaction buffer 30 μ L, UNG F and UNG R(50 μ mol/L) each 2.5 μ L, P
fuarchaeal dna polymerase 40U, supplies volume to 300 μ L with dual distilled water, and vibration suspendible is for subsequent use;
4) application of sample
Prop up UNG reaction buffer is divided and is filled in PCR thin-walled tube by 30 μ L/, add step e coli.JM109 genomic dna 2 μ L, mix, centrifugal a little, insert in fluorescent PCR amplification instrument;
5) cycling condition setting
95 DEG C of 1 circulations in 10 minutes; 95 DEG C 30 seconds, 58 DEG C 30 seconds, 72 DEG C 60 seconds, 40 circulation; 72 DEG C 600 seconds, 1 circulation; 38 DEG C 30 seconds;
6) engineering bacteria builds
The pcr product of UNG enzyme gene is through Nde I, Sal I double digestion on the PET28a carrier of Nde I, Sal I double digestion, and construction of expression vector PET28a-UNG, transforms above-mentioned plasmid to express bacterium BL21 (DE
3), obtain the engineering strain of Restruction UNG enzyme;
2, actication of culture
Get UNG enzyme engineering bacteria 200uL and be inoculated into 20mL containing in kantlex (50 μ g/mL) LB liquid nutrient medium, 37 DEG C, 200rpm shaking culture is spent the night;
3. enlarged culturing
Get the bacterium liquid that 3mL activates and be transferred in the same LB liquid nutrient medium of 200 mL (about 8:40 starts), 37 DEG C, 250 revs/min of shaking culture are after 4 hours.(about 12:40)
4. abduction delivering
Add induced expression agent 200uL 1M IPTG to final concentration 1.0mmol/L, under 28 DEG C, 250 rpm parts, cultivate 8 hours (about 20:00).
5. thalline reclaims
(1) get 12 50mL centrifuge tube supersound washing 30min, and with distilled water rinse once;
(2) 12000rpm, collects thalline for centrifugal 5 minutes for 4 DEG C;
(3) thalline of collecting is divided into 4 pipes, uses buffer A (20 mmol/L Tris-HCl, 0.2 mol/L NaCl, pH8.0) to wash once, 12000rpm, and 4 DEG C are centrifugal 5 minutes.Use again buffer A resuspended (about 35mL);-20 DEG C of preservations are spent the night.
Three, the purifying of restructuring uridylic-N-glycosylase (UNG) enzyme
1. frozen bacteria suspension being placed in to 37 DEG C of water-baths thaws to melting completely, 4mg/ml final concentration N,O-Diacetylmuramidase room temperature treatment 20 minutes, adding DTT to make final concentration is 1mM, adding tween 20 to make volume percent is 0.5%, process on ice 45 minutes, 15000g/4 DEG C/20 minutes, the supernatant obtaining was crude protein;
2. in crude protein, slowly add the silica dioxide granule of volume coefficient 5%, on magnetic stirring apparatus, stir 10 minutes (absorption nucleic acid and foreign protein), 15000g/4 DEG C/20 minutes, remove precipitation, supernatant moves into centrifuge tube;
3. supernatant step 2 being obtained moves in the water-bath that is preheated to 70 DEG C, hatches 10 minutes, and 15000g/4 DEG C/20 minutes, remove precipitation, supernatant moves into centrifuge tube;
Supernatant liquor supply NaCl to final concentration be 0.5M, flow through the Ni-NTA post of chelating Ni2+, this post is first used 10 times of bed volume binding buffer liquid (20mM Tris-HCL, 0.5MNaCl, PH8.0,5mM imidazoles) balance; Use again 5 times of bed volume washing buffer solution (20mM Tris-HCL, 0.5MNaCl, PH8.0,15mM/50mM imidazoles) to wash successively; Finally use elutriant (20mM Tris-HCL, 0.1MNaCl, PH8.0,200mM imidazoles) wash-out target protein.Containing the elutriant sephadexG25 desalination of target protein, desalination damping fluid (20mM Tris-HCl (25 ° of C of pH 7.5 at), 300mM KCl, 1mM DTT, 0.2mM EDTA, 1mg/ml BSA).After desalination, adding glycerine to make volume fraction be 50% ,-20 DEG C saves backup.
Four, uridylic-N-glycosylase (UNG) enzyme detects
1.SDS-PAGE purity detecting, the results are shown in Figure 1, and each swimming lane applied sample amount is respectively 10 microlitres, 20 microlitres, 10 microlitres, 20 microlitres from left to right, and the UNG enzyme that purifying obtains as can be seen from Figure 1 has good purity, substantially there is no foreign protein.
2. active detection
(1) the UNG enzyme that purifying obtains detects with hbv nucleic acid immue quantitative detection reagent box (fluorescent PCR method).
(2) HBV reaction buffer configuration (30 μ L/person-portion)
1) HBV reaction buffer A
Add respectively 0.5mol/L Trizma HCl 64 μ L, 0.5mol/L Trizma Base 336 μ L, 1 mol/L MgCl
215 μ L, 1mol/L KCl 500 μ L, 0.5mol/L EDTA2Na 2 μ L, dNTPs 90 μ L, (50 μ mol/L upstream: CCCAAAGACAAAAGAAAATTGG, are shown in SEQ ID NO:3 to HBV specificity upstream and downstream primer; Downstream: CCCACTGTTTGGCTTTCAGT, see SEQ ID NO:4) 83.3 μ L, HBV probe (50 μ mol/L 5 ' FAM-TGGCCCCCAATACCACATCATCC-3 ' TAMRA, sequence is shown in SEQ ID NO:5) 25 μ L, Taq archaeal dna polymerase 167 μ L, UNG enzyme 3 μ L(0.3U), supply volume to 10mL with dual distilled water.
2) HBV reaction buffer B
Add respectively 0.5mol/L Trizma HCl 64 μ L, 0.5mol/L Trizma Base 336 μ L, 1 mol/L MgCl
215 μ L, 1mol/L KCl 500 μ L, 0.5mol/L EDTA2Na 2 μ L, dNTPs 90 μ L, HBV specificity upstream and downstream primer (the same) 83.3 μ L, HBV probe (50 μ mol/L are the same) 25 μ L, Taq archaeal dna polymerase 167 μ L, supply volume to 10mL with dual distilled water.
(3) sample
Get containing 10 times of gradient dilutions of dU HBV pcr amplification product TE water, dilute altogether 8 concentration (1.0 × 10
9iU/mL, 1.0 × 10
8iU/mL, 1.0 × 10
7iU/mL, 1.0 × 10
6iU/mL, 1.0 × 10
5iU/mL, 1.0 × 10
4iU/mL, 1.0 × 10
3iU/mL, 1.0 × 10
2iU/mL).
(4) application of sample
Prop up HBV reaction buffer A and B aforesaid liquid are divided respectively and be filled in PCR thin-walled tube by 30 μ L/, add successively step; (3) gradient dilution containing dU PCR product 2 μ L, mix, centrifugal a little, insert in fluorescent PCR amplification instrument;
(4) 1) cycling condition setting
38 DEG C 5 minutes, 95 DEG C 10 minutes; 95 DEG C 15 seconds, 58 DEG C 40 seconds, 40 circulation;
(5) result is from computer direct analysis.1
1) HBV reaction buffer A amplification
UNG enzymic activity detected result is shown in Fig. 2, is respectively from left to right 1.0 × 10
9iU/mL, 1.0 × 10
8iU/mL, 1.0 × 10
7iU/mL, 1.0 × 10
6iU/mL, 1.0 × 10
5iU/mL, 1.0 × 10
4iU/mL, 1.0 × 10
3iU/mL, 1.0 × 10
28 concentration of IU/mL are containing the amplification curve (reaction system that contains UNG enzyme) of dU sample, and as can be seen from the figure, concentration is 1.0 × 10
9iU/mL, 1.0 × 10
8iU/mL, 1.0 × 10
7iU/mL, 1.0 × 10
6iU/mL, 1.0 × 10
5iU/mL, 1.0 × 10
4iU/mL, 1.0 × 10
3iU/mL, 1.0 × 10
2iU/mL8 concentration containing dU sample in the reaction system that contains UNG enzyme by complete digestion, there is no amplification curve.
)hBV reaction buffer B amplification
UNG enzymic activity detects control experiment and the results are shown in Figure 3, is wherein respectively from left to right 1.0 × 10
9iU/mL, 1.0 × 10
8iU/mL, 1.0 × 10
7iU/mL, 1.0 × 10
6iU/mL, 1.0 × 10
5iU/mL, 1.0 × 10
4iU/mL, 1.0 × 10
3iU/mL, 1.0 × 10
28 concentration of IU/mL are containing the amplification curve (not containing the reaction system of UNG enzyme) of dU sample, and as can be seen from the figure, concentration is 1.0 × 10
9iU/mL, 1.0 × 10
8iU/mL, 1.0 × 10
7iU/mL, 1.0 × 10
6iU/mL, 1.0 × 10
5iU/mL, 1.0 × 10
4iU/mL, 1.0 × 10
3iU/mL, 1.0 × 10
2not having in the reaction system that does not contain UNG enzyme containing dU sample of IU/mL8 concentration is digested, and amplification curve is good, and gradient is even.
By above experiment, illustrate that the UNG enzyme that the present invention prepares has activity.
Although illustrated and described embodiments of the invention above, be understandable that, above-described embodiment is exemplary, can not be interpreted as limitation of the present invention, those of ordinary skill in the art can change above-described embodiment within the scope of the invention in the situation that not departing from principle of the present invention and aim, amendment, replacement and modification.
SEQUENCE LISTING
<110> Xiamen Amplly Bio-Tech Inc.
Mono-kind of <120> extracts the method for UNG enzyme
<130> P9658
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 31
<212> DNA
<213> synthetic
<400> 1
atacatatgg ctaacgaatt aacctggcat g 31
<210> 2
<211> 34
<212> DNA
<213> synthetic
<400> 2
ctggtcgact tactcactct ctgccggtaa tact 34
<210> 3
<211> 22
<212> DNA
<213> synthetic
<400> 3
cccaaagaca aaagaaaatt gg 22
<210> 4
<211> 20
<212> DNA
<213> synthetic
<400> 4
cccactgttt ggctttcagt 20
<210> 5
<211> 23
<212> DNA
<213> synthetic
<400> 5
tggcccccaa taccacatca tcc 23
Claims (10)
1. a method of extracting purifying UNG enzyme, is characterized in that, comprises the steps,
1) activation of engineering bacteria and expression: get after UNG enzyme engineering bacteria activates rear and shaking culture and add IPTG induction; Washing; Centrifugal collection thalline; The thalline of collecting washs by buffer A, centrifugal; Again with the resuspended engineering bacteria that obtains expression of buffer A;
2) crude protein preparation: with adding DTT after N,O-Diacetylmuramidase room temperature treatment, tween 20, processes after for some time centrifugally on ice by the engineering bacteria of described expression, and the supernatant obtaining is crude protein;
3) in crude protein, slowly add silica dioxide granule, on magnetic stirring apparatus, stir, centrifugal removal precipitation obtains supernatant;
4) the described supernatant obtaining is moved in the water-bath that is preheated to 70 DEG C, hatch rear centrifugal, remove precipitation, obtain supernatant;
5) supernatant flows through the Ni-NTA post of chelating Ni2+, then carries out desalination and obtain the UNG enzyme of purifying;
Described buffer A is 20mM Tris-HCl, 0.2M NaCl, pH 8.0;
Optional, it is 50% ,-20 DEG C of preservations that the M-MLV reversed transcriptive enzyme obtaining adds glycerine to make volume fraction.
2. the method for extraction purifying UNG enzyme claimed in claim 1, it is characterized in that, described UNG enzyme engineering bacteria is that pcr amplification obtains PCR product from moloneys mouse leukosis virus, gained PCR product is connected on the PET28a carrier of Nde I, Sal I double digestion after Nde I, Sal I double digestion, construction of expression vector PET28a-UNG, transforms above-mentioned plasmid to express bacterium BL21 (DE
3), obtain the engineering strain of Restruction UNG enzyme.
3. the method for extraction purifying UNG enzyme claimed in claim 2, is characterized in that, described pcr amplification primer used is SEQ ID NO:1 and SEQ ID NO:2.
4. the method for the extraction purifying UNG enzyme described in claim 1 or 2, is characterized in that, described step 1) is to get UNG enzyme engineering bacteria to be inoculated in the LB liquid nutrient medium containing kantlex, shaking culture; Get the bacterium liquid having activated and be transferred in same LB liquid nutrient medium, after shaking culture, add IPTG inducing culture 8 hours; With centrifuge tube supersound washing 30min, and with distilled water rinse once; Centrifugal collection thalline; The thalline of collecting washs by buffer A, centrifugal; Again with the resuspended engineering bacteria that obtains expression of buffer A.
5. the method for extraction purifying UNG enzyme claimed in claim 4, is characterized in that, described step 1) is to get UNG enzyme engineering bacteria to be inoculated in the LB liquid nutrient medium containing kantlex, and 37 DEG C, 200rpm shaking culture is spent the night; Get the bacterium liquid having activated and be transferred in same LB liquid nutrient medium, 37 DEG C, 250 revs/min of shaking culture add 1M IPTG to final concentration 1.0mmol/L after 4 hours, under 28 DEG C, 250 rpm parts, cultivate 8 hours; With centrifuge tube supersound washing 30min, and with distilled water rinse once; 12000rpm, collects thalline for centrifugal 5 minutes for 4 DEG C; The thalline of collecting washs once by buffer A, 12000rpm, and 4 DEG C are centrifugal 5 minutes; Again with the resuspended engineering bacteria that obtains expression of buffer A.
6. the method for the extraction purifying UNG enzyme described in claim 1 or 2, it is characterized in that, described step 2) be 1mM for adding DTT to make final concentration after 20 minutes by 4mg/ml final concentration N,O-Diacetylmuramidase room temperature treatment the engineering bacteria of described expression, adding tween 20 to make volume percent is 0.5%, process on ice 45 minutes, 15000g/4 DEG C/20 minutes, the supernatant obtaining was crude protein.
7. the method for the extraction purifying UNG enzyme described in claim 1 or 2, is characterized in that, described step 3) is the silica dioxide granule that slowly adds volume coefficient 5% in crude protein, on magnetic stirring apparatus, stir 10 minutes, 15000g, 4 DEG C centrifugal 20 minutes, remove precipitation.
8. the method for the extraction purifying UNG enzyme described in claim 1 or 2, is characterized in that, hatches 10 minutes in described step 4), and centrifugal condition is 15000g/4 DEG C/20 minutes.
9. the method for the extraction purifying UNG enzyme described in claim 1 or 2, is characterized in that, described step 5) is to flow through the Ni-NTA post of chelating Ni2+ after supernatant is supplied NaCl, and this post is first used 10 times of bed volume binding buffer liquid balances; Wash successively with 5 times of bed volume washing buffer solution again; Finally use elutriant wash-out target protein.
10. contain the UNG enzyme that obtains purifying after sephadexG25 desalination for elutriant of target protein; The desalination damping fluid of using in desalination is: 20mM Tris-HCl, pH 7.5 under 25 ° of C, 300mM KCl, 1mM DTT, 0.2mM EDTA, 1mg/ml BSA;
Described binding buffer liquid is 20mM Tris-HCL, 0.5MNaCl, PH8.0,5mM imidazoles; Described washing buffer solution is 20mM Tris-HCL, 0.5MNaCl, PH8.0,15mM/50mM imidazoles; Described elutriant is 20mM Tris-HCL, 0.1MNaCl, PH8.0,200mM imidazoles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410180401.XA CN103966189A (en) | 2014-04-30 | 2014-04-30 | Method for extracting UNG (uracil-N-glycosylase) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410180401.XA CN103966189A (en) | 2014-04-30 | 2014-04-30 | Method for extracting UNG (uracil-N-glycosylase) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103966189A true CN103966189A (en) | 2014-08-06 |
Family
ID=51236196
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410180401.XA Pending CN103966189A (en) | 2014-04-30 | 2014-04-30 | Method for extracting UNG (uracil-N-glycosylase) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103966189A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107254467A (en) * | 2017-07-14 | 2017-10-17 | 北京碳元科技有限公司 | Normal temperature preserves method of nucleic acid sample and products thereof and application method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101684474A (en) * | 2009-02-19 | 2010-03-31 | 孙启明 | Soluble expression and purification method for recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in colon bacillus |
| CN102816786A (en) * | 2012-05-25 | 2012-12-12 | 湖北大学 | Simple and efficient method for preparing and purifying TaqDNA polymerase |
-
2014
- 2014-04-30 CN CN201410180401.XA patent/CN103966189A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101684474A (en) * | 2009-02-19 | 2010-03-31 | 孙启明 | Soluble expression and purification method for recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in colon bacillus |
| CN102816786A (en) * | 2012-05-25 | 2012-12-12 | 湖北大学 | Simple and efficient method for preparing and purifying TaqDNA polymerase |
Non-Patent Citations (4)
| Title |
|---|
| BLATTNER,F.R: "uracil-DNA-glycosylase[Escherichia coli str.k-12 substr.MG1655]", 《GENBANK:AAC75633.1》 * |
| HIROSHI OGASAWARA,ET AL: "Negative Regulation of DNA Repair Gene (ung) Expression by the CpxR/CpxA Two-Component System in Escherichia coli K-12 and Induction of Mutations by Increased Expression of CpxR", 《JOURNAL OF BACTERIOLOGY》 * |
| 林利波: "火球菌尿嘧啶DNA糖苷酶基因克隆、表达纯化和酶学性质研究", 《中国优秀硕士学位论文全文数据库 基础科学辑 》 * |
| 马泓冰 等: "阳离子交换一步层析法纯化抗gp130单克隆抗体", 《细胞与分子免疫学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107254467A (en) * | 2017-07-14 | 2017-10-17 | 北京碳元科技有限公司 | Normal temperature preserves method of nucleic acid sample and products thereof and application method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105039278B (en) | Saltant type Taq archaeal dna polymerases and its preparation method and application | |
| US10787702B2 (en) | Thermolabile exonucleases | |
| CN106906236B (en) | Sialidase gene recombinant expression vector and construction method thereof, sialidase and preparation method thereof | |
| CN111423486A (en) | Renaturation method of new type coronavirus recombinant protein inclusion body | |
| CN103966183A (en) | Method for extracting purified Taq DNA polymerases | |
| CN108018271A (en) | Single subunit RNA polymerase, its purification process and the application in RNA synthesis | |
| CN109504748A (en) | A method of it is specific in SNPs detection to improve RAA technology | |
| CN103966189A (en) | Method for extracting UNG (uracil-N-glycosylase) | |
| WO2006095769A1 (en) | Microorganism-derived psychrophilic endonuclease | |
| CN104250642A (en) | Method for extracting and purifying M-MLV reverse transcriptase | |
| CN103992992A (en) | Coding gene of (+) gamma-lactamase in Sulfolobus solfataricus P2, and application thereof | |
| CN102766611B (en) | Sulfolobus virus dUTP (deoxyuridine triphosphate) pyrophosphatase and polynucleotide coding same | |
| CN104178467A (en) | Recombinant T4 bacteriophage polynucleotide kinase (T4 PNK) and preparation method thereof | |
| CN103966182A (en) | Method for extracting purified Tth DNA polymerases | |
| CN109022471B (en) | Escherichia coli expression system for producing oxalate oxidase, and production method and application of oxalate oxidase | |
| CN113430220A (en) | Synthesis method, construction method and application of genetic engineering bacteria for expressing soluble feline omega interferon | |
| CN106318922A (en) | Preparation method of Pfu DNA polymerase | |
| CN105255922B (en) | A kind of alginate lyase SHA-5 genes and its prokaryotic expression carrier | |
| Shuai et al. | Purification and characterization of an endo-exonuclease from adult flies of Drosophila melanogaster | |
| CN108715892A (en) | A kind of rareness species DNA information acquisition methods | |
| US20100209972A1 (en) | Method for synthesis of single- or double-stranded dna, and kit for the synthesis | |
| CN107236718B (en) | Low-temperature esterase from metagenome, coding gene and application thereof | |
| CN108251345B (en) | Recombinant engineering bacterium containing lipase gene for domestic sewage treatment and construction method thereof | |
| RU2809366C1 (en) | METHOD OF OBTAINING LARGE FRAGMENT OF Bst POLYMERASE (OPTIONS) | |
| CN110438258B (en) | Method for detecting interaction of H7N9 subtype avian influenza virus genome vRNA-vRNA by using gel migration |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB02 | Change of applicant information |
Address after: 361000 No. 10 Sunshine Road, Haicang District, Fujian, Xiamen Applicant after: Xiamen Amplly Bio-Tech Inc. Address before: 361000 No. 10 Sunshine Road, Tian An Industrial Park, Haicang, Fujian, Xiamen Applicant before: Xiamen Amplly Bio-Tech Inc. |
|
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140806 |
|
| RJ01 | Rejection of invention patent application after publication |