CN101684474A - Soluble expression and purification method for recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in colon bacillus - Google Patents
Soluble expression and purification method for recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in colon bacillus Download PDFInfo
- Publication number
- CN101684474A CN101684474A CN200910024869A CN200910024869A CN101684474A CN 101684474 A CN101684474 A CN 101684474A CN 200910024869 A CN200910024869 A CN 200910024869A CN 200910024869 A CN200910024869 A CN 200910024869A CN 101684474 A CN101684474 A CN 101684474A
- Authority
- CN
- China
- Prior art keywords
- mmlv
- reverse transcriptase
- leukemia virus
- murine leukemia
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to an expression and purification of murine leukemia virus reverse transcriptase (MMLV-RT), in particular to a soluble expression and a purification method for recombinant murineleukemia virus reverse transcriptase (MMLV-RT), which belongs to the field of biochemistry. MMLV-RT genes and enterokinase restriction enzyme cutting sites are cloned in a pET28a vector through vector construction; the MMLV-RT and molecular chaperones are co-expressed at the low temperature; the expression amount of protein is improved to 15 percent; and the solubility of the protein is 10 timesthat of the protein expressed by a conventional method.
Description
Technical field
The present invention relates to the expression and the purifying of a kind of murine leukemia virus reverse transcriptase (MMLV-RT), the solubility expression and the purification process of particularly a kind of murine leukemia virus reverse transcriptase (MMLV-RT).Belong to biochemical field.
Background technology
RT-PCR is as important molecular biology research means, is the technology that the polymerase chain amplification (PCR) with the reverse transcription (RT) of RNA and cDNA combines.At first synthesizing cDNA through the effect of ThermoScript II from RNA, is template again with cDNA, the synthetic purpose fragment of amplification.The RT-PCR technology is sensitive and of many uses, can be used for detecting gene expression dose in the cell, the content of RNA viruses and the cDNA sequence of directly cloning specific gene in the cell.Be called reverse transcription by mRNA to the process of cDNA, by ThermoScript II (reversetranscriptase) catalyzed reaction.ThermoScript II claims the archaeal dna polymerase that RNA instructs again.Be to be the enzyme of template synthetic DNA with RNA, this kind of enzyme be 1970 the U.S. scientist Temin (H.M.Temin) and Baltimore (D.Baltimore) respectively at finding in the animal oncornavirus RNA, therefore they also obtain the prize of 1975 annual Nobel's physiology or medical science.MMLV (from the Moloey murine leukemia virus) is the ThermoScript II of using always, is the archaeal dna polymerase that depends on RNA, has 5 '--3 ' dna polymerase activity.As the most frequently used molecular biology product, market demand is huge for ThermoScript II (reverse transcriptase), and extractive technique complexity, the productive rate of natural ThermoScript II are low.At present,, but form inclusion body easily, can only obtain very a spot of activated protein behind the purifying by recombinant murine leukemia virus reverse transcriptase expression amount height in the pET system of genetic engineering technique clone.
Summary of the invention
The objective of the invention is for overcoming above-mentioned the deficiencies in the prior art part, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria is provided, the present invention is cloned into MMLV-RT gene and enteropeptidase restriction enzyme site in the pET28a carrier by vector construction, MMLV-RT and molecular chaperones TF coexpression under cryogenic condition, the proteic expression amount of MMLV-RT can bring up to 15%, and solubility is 10 times that ordinary method is expressed.At last, utilize six histidine-tagged and enteropeptidase enzymes to cut purifying to obtain reversed transcriptive enzyme (MMLV-RT).
The present invention realizes with following technical scheme: solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria, it is characterized in that: MMLV-RT gene and enteropeptidase restriction enzyme site are cloned in the pET28a carrier by vector construction, under cold condition,, improve proteic expression amount and solubility with the molecular chaperones coexpression.
Solubility expression and the purification process of described a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria, it is characterized in that: MMLV-RT gene and enteropeptidase restriction enzyme site are cloned in the pET28a carrier, under cryogenic condition with the molecular chaperones coexpression.
Solubility expression and the purification process of described a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria is characterized in that: the MMLV-RT gene clone is realized coexpression in the pET28a carrier.
Solubility expression and the purification process of described a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria is characterized in that: MMLV-RT and enteropeptidase restriction enzyme site are cloned in the pET28a carrier express.
Described MMLV-RT gene under cold condition with the molecular chaperones coexpression.
The expression vector of described structure is pET28a-His6-EK (enteropeptidase)-MMLV-RT.
The molecular chaperones of described expression is TF and GroEL-GroES, MMLV-RT and molecular chaperones TF, GroEL-GroES coexpression in the host bacterium.
Described expressed fusion protein contain six histidine-tagged, use the Ni-NTA purified fusion protein.
Solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria of described expression is characterized in that: by the Ni-NTA purifying, obtain reversed transcriptive enzyme (MMLV-RT) after cutting by the enteropeptidase enzyme again.
Described expressive host bacterium is Escherichiacoli BL21 (DE3).
Advantage of the present invention is: by vector construction MMLV-RT gene and enteropeptidase restriction enzyme site are cloned in the pET28a carrier, MMLV-RT and molecular chaperones coexpression under cryogenic condition increase the solubility of expressing protein greatly.In addition, the histidine-tagged and adding enteropeptidase restriction enzyme site then makes the purifying of ThermoScript II simplify more, efficiently.
Description of drawings
The invention will be further described below in conjunction with drawings and Examples:
Fig. 1 is the expression of fusion rotein His6-MMLV-RT in intestinal bacteria:
Figure 1A is the plasmid map of recombinant expression vector pET28-MMLV-RT:
Figure 1B is that the SDS-PAGE of reorganization His6-MMLV-RT protein expression analyzes:
Fig. 2 is the optimization of reversed transcriptive enzyme expression condition:
Fig. 2 A is the influence to the reversed transcriptive enzyme solubility of low temperature fermentation and molecular chaperones coexpression:
Fig. 2 B is under different condition, the comparison of His6-MMLV solubility and output:
Fig. 3 is that the SDS-PAGE (10%) of His-MMLV-RT and MMLV-RT behind the purifying analyzes:
Fig. 4 is that the reverse transcriptase activity behind the purifying is measured:
Fig. 4 A is that initial transcription rate is measured:
Fig. 4 B is an Atg7 cDNA synthetic test:
Among Fig. 1, Fig. 2:
Swimming lane 1: albumen marker (kD);
GroEL/ES+TF - + - +
Total protein concentration % 15 14 13 13
Relative total protein concentration 1.0 0.95 0.87 0.87
Solubility (%) 56 30 95
Contain pET28-MMLV-RT and pG-tf2 BL21 (DE3) cultivation and handle as mentioned above, the band of expression of MMLV-RT, TF and GroEL-GroES is as shown in the figure.T, S and I represent total protein respectively, go up cleer and peaceful precipitation.Independent total MMLV-RT (swimming lane 1) in the group of 37 ℃ of expression A is made as 1.0, it is expressed total amount and accounts for 15% of bacterial protein, as reference, through quantitative and correction, the shared ratio of the MMLV-RT of other swimming lane is shown in the figure below, the working concentration of tsiklomitsin is 20 μ g/l, and IPTG is 0.6mM.
Fig. 2 B is under different condition, and the comparison SDS-PAGE gel gray scale scanning of His6-MMLV solubility and output is analyzed proteic solubility of MMLV-RT and corresponding productive rate
Among Fig. 3: the His6-MMLV-RT of purifying and MMLV-RT protein sample are analyzed .M with 10%SDS-PAGE: the molecular weight of albumen standard; Swimming lane 1: the ultrasonic supernatant of great expression; Swimming lane 2:Ni
2+-NTA passes; Swimming lane 3:buffer C washing; Swimming lane 4:Buffer D elutriant (1.5 μ g); Swimming lane 5: contrast, do not add the elutriant of EK; The elutriant that swimming lane 6:EK enzyme is cut (5 μ g); (3 μ g) passed in swimming lane 7:Q ion-exchange.
Among Fig. 4: reverse transcription reaction carries out under 37 ℃ of conditions.The consumption of MMLV-RT of purifying (circle) and positive control MMLV RT (Invitrogen Corp) (square frame) is 5nM, and the concentration of poly (rA)-p (dT) 12-18 is each reaction triplicate of 25mM., and error line is represented standard error.
Embodiment
The present invention is by the structure of reorganization MMLV-RT prokaryotic expression carrier pET28a-MMLV-RT, success will codon optimized MMLV-RT gene clone also be in same reading frame with it to the downstream of His6-tag encoding sequence, the restriction enzyme site that between His6-tag and MMLV-RT, adds enteropeptidase, made up fusion rotein MMLV-RT prokaryotic expression carrier, sequencing result show read frame and dna sequence dna all correct.By the contrast experiment, find MMLV-RT and molecular chaperones TF coexpression under cryogenic condition, proteic expression amount brings up to 15%, and solubility is 10 times that ordinary method is expressed.Cut and ion exchange chromatography is received and to be passed by nickel affinity chromatography, EK enzyme, obtained not MMLV-RT with any affinity tag.Nickel affinity chromatography has been removed most thalline foreign proteins, to not be with amino acid whose MMLV-RT of any redundancy and His6 label to separate after cutting with the enteropeptidase enzyme, remove the DNA of EK and trace at last with ion exchange chromatography, obtained the MMLV-RT (purity about 95%) of about 23mg in one liter of fermented liquid.The 10%SDS-PAGE analysis revealed, the MMLV-RT of purifying conforms to theoretical molecular 70kD.The reversed transcriptive enzyme of purifying shows the activity similar with the commercialization enzyme, is about 2 * 10 than living
5Units/mg.
Below by preferred embodiment the present invention is done more detailed argumentation.Experimental technique in the following experiment if there is not specified otherwise, all belongs to ordinary method.
1, the structure of reorganization MMLV-RT prokaryotic expression carrier pET28-MMLV-RT:
With synthetic MMLV-RT is template, and with the method amplification MMLV-RT encoding sequence of PCR, used forward primer is: 5 '-CGGGATCC
GACGACGACGACAAGATGGGGCAGCCCCTGC AAG-3 ', reverse primer is: 5 '-CCGCGGCCGCTTAAGTCTCTGTGATGGCTG CC-3 '.The sequence (underscore part) that restriction enzyme site (black matrix) and the coding enteropeptidase recognition site DDDDK of a BamHI are arranged in forward primer has the restriction enzyme site (black matrix) of a NotI in the reverse primer.The condition of PCR reaction is: 94 ℃ of thermally denatures one minute, and 55 ℃ of annealing one minute, 72 ℃ were extended 90 seconds, and carried out 25 circulations altogether.The PCR product of purifying adopts BamH I and Not I to carry out double digestion, inserts the multiple clone site of pET28a then.PET28a is the prokaryotic expression carrier that the N end of a T7 series merges His6-tag.Recombinant expression vector pET28a-MMLV-RT is carried out dna sequencing, analyze the exactness that it reads frame and encoding sequence.
According to the step described in the method, with codon optimized MMLV-RT gene clone to the downstream of His6-tag encoding sequence and be in same reading frame with it, for the ease of discharging the also MMLV-RT of purifying wild-type, the present invention designs and adds the restriction enzyme site of enteropeptidase between His6-tag and MMLV-RT, recombinant plasmid is through sequence verification, successfully made up fusion rotein MMLV-RT prokaryotic expression carrier, it is all correct to read frame and dna sequence dna, its sketch is referring to Figure 1A.
2.MMLV-RT expression:
(1) expression of fusion rotein MMLV-RT
Change MMLV-RT fusion protein expression vector pET28a-MMLV-RT and control vector pET28a over to expressive host bacterium E.coli BL21 (DE3) respectively, the picking mono-clonal is seeded to fresh LB liquid nutrient medium (kantlex that contains 50mg/l).Treat that bacterium grows to OD
600Be about 0.6, add final concentration respectively and be the expression that the IPTG of 0.6mM induces MMLV-RT.Induce after two hours and collect thalline, tropina sample after the processing is walked 12%SDS-PAGE, use UVP white/ultraviolet transilluminator that the Coomassie brilliant blue stained gel is carried out sweep record, adopt specialty analysis software Grab-it 2.5 and Gelwork analysis purposes albumen to account for the ratio of bacterial protein.
(2) under different temperature, MMLV-RT and molecular chaperones coexpression
PG-Tf2 is a prokaryotic expression carrier with ColE1 replicon, chlorampenicol resistant.Can express colibacillary mate molecule: TF and GroEL-GroES simultaneously under the control of tsiklomitsin inductive promotor, (HSP Research Institute Japan) is so kind as to give this carrier by Hideki doctor Yanagi
[2]Change pET28-MMLV-RT and pG-Tf2 over to E.coli BL21 (DE3) jointly, go up screening at the LB of two resistances culture medium flat plate (containing the kantlex of 50mg/l and the paraxin of 34mg/l) and obtain positive colony.
Monoclonal incubated overnight bacterium liquid is seeded to respectively in the test tube that contains 3ml liquid LB, and every test tube contains 50mg/l kantlex and 34mg/l paraxin, above-mentioned test tube is divided into 1,2,3 and 4 groups.Put 37 ℃ of shaking tables for 1 group and 2 groups and cultivate, 3 groups and 4 groups are 28 ℃ of cultivations, and rotating speed is 250rpm, at bacterial growth to OD
600Be about at 0.5 o'clock, adding final concentration in the test tube of 2 groups and 4 groups is the tsiklomitsin inducing molecule companion's of 20 μ g/l expression, after 20 minutes, in four groups of all test tubes, add final concentration and be the expression that the IPTG of 0.6mM induces MMLV-RT, induce the back to continue to cultivate 3 hours (1 group and 2 groups) or 5 hours (3 groups and 4 groups).
(3) analysis of protein expression and quantitative
In order to compare the height of MMLV-RT solubility under different expression conditions, collect the identical cell of quantity, then use the resuspended thalline of PBS damping fluid of 300 μ l ice baths, fully after the supersound process, adopt centrifugation method that bacterial lysate is divided into total protein, goes up three components of cleer and peaceful precipitation, and run 12%SDS-PAGE.The dyeing of gel, scanning and proteic quantitatively as mentioned above.Herein, solubility is defined as: the target protein of solubility/general purpose albumen * 100%.
After IPTG induces, a protein band that is about 80kD has appearred, a little more than the theoretical molecular of MMLV-RT, through gel scanning gray analysis, MMLV-RT accounts for about 15% (Figure 1B) of bacterial protein, yet most MMLV-RT is present in the kytoplasm with the form of inclusion body.For the solubility that improves purpose MMLV-RT and the productive rate of biologically active MMLV-RT, the present invention has attempted the method for low temperature and molecular chaperones coexpression.Shown in Fig. 2 A, MMLV-RT and molecular chaperones TF and GroEL-GroES be at 37 ℃ of coexpressions, the solubility of the MMLV-RT that is not significantly improved; When reducing leavening temperature to 28 ℃, the MMLV-RT ratio of soluble form rises to 30% from original 5%; With MMLV-RT and molecular chaperones TF and GroEL-GroES when 28 ℃ of coexpressions, the solubility of target protein sharply increases to 95%, compare with 37 ℃ of single expression, the productive rate of solubility target protein has improved about 10 times, SDS-PAGE gray analysis and the reliability (Fig. 2 B) of the quantitative analysis of purified target protein all having been proved conclusively The above results.Find in the experiment, the overexpression of molecular chaperones has only reduced the total expression level of MMLV-RT slightly, because it is huge to the solubility contribution of purpose egg that low temperature adds the molecule companion, finally this fermentation strategy has still greatly improved the output of folding naturally MMLV-RT.Reach a conclusion thus: low temperature fermentation and molecular chaperones coexpression all are necessary, and the two has promoted solubility expression in intestinal bacteria in synergistic mode, and then its solubility has been improved about 10 times.
3, proteic purifying
Collect the cell of one liter of fermented liquid, and with bufferA (20mM Tris-HCl, 300mMNaCl, the 0.5%Triton-X100 of 40ml ice bath, the 10mM imidazoles, 10% glycerine, pH7.4) resuspended, the ultrasonic degradation cell, the centrifuging and taking supernatant, supernatant is by the Ni of buffer A pre-equilibration
2+Affinity column, last sample finish and use buffer A thorough washing to baseline, then use buffer B (20mM Tris-HCl, 300mM NaCl, 80mM imidazoles, 0.5%Triton-X100,10% glycerine, pH7.4) the washing foreign protein is used buffer C (20mM Tris-HCl, 300mM NaCl at last, the 250mM imidazoles, 0.5%Triton-X100,10% glycerine, pH7.4) wash-out target protein.
For the purifying of no His6 affinity tag MMLV-RT, the Ni of His6-MMLV-RT will be combined
2+-NTA affinity media is with above-mentioned buffers A and B thorough washing, and then the EK enzyme is cut buffer D (0.1%Triton X-100,5% glycerine, pH 8.0 for 20mM Tris-HCl, 150mM NaCl) and washed two column volumes.At last according to EK (mg): the ratio of target protein (mg)=1: 10000 adds EK initial endonuclease reaction in 25% the dielectric suspensions.The enzyme tangent condition is 4 ℃/16 hours.Enzyme is cut MMLV-RT that wash-out comes out further through reinforcing yin essence ion-exchange absorption chromatography Q-Sepharose purifying.Enzyme behind the purifying adopts Micro BCA test kit quantitatively to reach the analysis of gel gray scale scanning.
Cut and ion exchange chromatography is received and to be passed by nickel affinity chromatography, EK enzyme, obtained wild-type not with the MMLV-RT of any affinity tag.Nickel affinity chromatography has been removed most thalline foreign proteins, cut with the enteropeptidase enzyme, the albumen precipitation side effect of having avoided high imidazoles wash-out to bring, and will not be with amino acid whose MMLV-RT of any redundancy and His6 label to separate, the final ion displacement chromatography is removed the DNA of EK and trace, has finally obtained the wild-type MMLV-RT (purity about 95%) of about 23mg from one liter of fermented liquid.12.5%SDS-PAGE analysis revealed, the MMLV-RT of purifying conform to theoretical molecular 70kD (Fig. 3).The yield of purifying is summarized in the following table:
Purifying flow process MMLV-RT total amount (mg/L) purification efficiency (%)
Bacterium ultrasonic degradation thing 36.5 100
Centrifugal supernatant 34.5 95
Ni
2+-NTA affinity chromatography 27.2 79
The EK enzyme cuts 23 85
4. the activity test method of reversed transcriptive enzyme
The activity employing of reversed transcriptive enzyme [
3H] dTTP participates in method and carries out quantitative analysis, idiographic flow reference (J.Biochem.143 (2008) 261-268).In a cDNA synthetic example, with the mRNA extract in people source template as reverse transcription, the enzyme of 200 unit of activity is added in the reaction system, be specially (25mMTris-HCl (pH 8.3), 50mM KCl, 10mM DTT, 4mM MgCl2,1 μ M oligo (dT), 18,5 μ g RNA and 200U reversed transcriptive enzymes), 42 ℃ of reactions 60 minutes.Carry out the PCR reaction with the reverse transcription product as template then, the primer of employing is to being: 5 '-ATGGCGGCAGCTACGGGGG-3 ' and 5 '-GATGGTCTCATCATCGC TC-3 '.The PCR product is carried out electrophoresis and sequencing analysis.Shown in Fig. 4 A, the reversed transcriptive enzyme of purifying shows the activity similar with the commercialization enzyme, is about 2 * 10 than living
5Units/mg.The autophagy gene atg7 that has synthesized the people source of this enzyme success.
Claims (10)
1, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria: it is characterized in that: by vector construction with MMLV-RT gene and enteropeptidase (enterokinase, EK) restriction enzyme site is cloned in the pET28a carrier, under cold condition by with molecular chaperones (TF, GroEL and GroES) coexpression, improve expressing quantity and solubility.
2, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase according to claim 1 (MMLV-RT) in intestinal bacteria, it is characterized in that: MMLV-RT gene and enteropeptidase restriction enzyme site are cloned in the pET28a carrier, under cryogenic condition with the molecular chaperones coexpression.
3, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase according to claim 1 (MMLV-RT) in intestinal bacteria is characterized in that: the MMLV-RT gene clone is realized coexpression in the pET28a carrier.
4, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase according to claim 3 (MMLV-RT) in intestinal bacteria, it is characterized in that: MMLV-RT enteropeptidase restriction enzyme site is cloned in the pET28a carrier and is expressed.
5, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase according to claim 2 (MMLV-RT) in intestinal bacteria is characterized in that: the MMLV-RT gene under cold condition with the molecular chaperones coexpression.
6, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase according to claim 2 (MMLV-RT) in intestinal bacteria is characterized in that: the recombinant protein that prokaryotic expression carrier is expressed is His6-EK-MMLV-RT.
7, solubility expression and the purification process in intestinal bacteria according to claim 3 and 4 described a kind of recombinant murine leukemia virus reverse transcriptases (MMLV-RT) is characterized in that: His6-EK-MMLV-RT and molecular chaperones TF and GroEL-GroES coexpression in the host bacterium.
8, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria according to claim 6, it is characterized in that: the fusion rotein of expression contains six Histidines (His6) label, with nickel affinity column (Ni-NTA) purified fusion protein.
9, according to claim 6 and 7 described solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in intestinal bacteria, it is characterized in that: by the Ni-NTA purified fusion protein, cut by the enteropeptidase enzyme again and obtain reversed transcriptive enzyme (MMLV-RT) earlier.
10, solubility expression and the purification process of a kind of recombinant murine leukemia virus reverse transcriptase according to claim 7 (MMLV-RT) in intestinal bacteria is characterized in that: described expressive host bacterium is Escherichiacoli BL21 (DE3).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910024869A CN101684474A (en) | 2009-02-19 | 2009-02-19 | Soluble expression and purification method for recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in colon bacillus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910024869A CN101684474A (en) | 2009-02-19 | 2009-02-19 | Soluble expression and purification method for recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in colon bacillus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101684474A true CN101684474A (en) | 2010-03-31 |
Family
ID=42047848
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910024869A Pending CN101684474A (en) | 2009-02-19 | 2009-02-19 | Soluble expression and purification method for recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in colon bacillus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101684474A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966189A (en) * | 2014-04-30 | 2014-08-06 | 厦门安普利生物工程有限公司 | Method for extracting UNG (uracil-N-glycosylase) |
| CN104250642A (en) * | 2014-04-30 | 2014-12-31 | 厦门安普利生物工程有限公司 | Method for extracting and purifying M-MLV reverse transcriptase |
| CN107988195A (en) * | 2017-11-22 | 2018-05-04 | 江南大学 | A kind of method for significantly improving linoleate isomerase amount of soluble expression in recombination bacillus coli |
| CN110382690A (en) * | 2017-02-16 | 2019-10-25 | 生物辐射实验室股份有限公司 | Novel reverse transcriptase and application thereof |
-
2009
- 2009-02-19 CN CN200910024869A patent/CN101684474A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966189A (en) * | 2014-04-30 | 2014-08-06 | 厦门安普利生物工程有限公司 | Method for extracting UNG (uracil-N-glycosylase) |
| CN104250642A (en) * | 2014-04-30 | 2014-12-31 | 厦门安普利生物工程有限公司 | Method for extracting and purifying M-MLV reverse transcriptase |
| CN110382690A (en) * | 2017-02-16 | 2019-10-25 | 生物辐射实验室股份有限公司 | Novel reverse transcriptase and application thereof |
| CN110382690B (en) * | 2017-02-16 | 2024-05-24 | 生物辐射实验室股份有限公司 | Novel reverse transcriptase and use thereof |
| CN107988195A (en) * | 2017-11-22 | 2018-05-04 | 江南大学 | A kind of method for significantly improving linoleate isomerase amount of soluble expression in recombination bacillus coli |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110592058B (en) | Threonine aldolase, coding gene thereof and application of threonine aldolase in droxidopa biosynthesis | |
| CN102277338A (en) | Diketoreductase mutant and application thereof | |
| CN101591664A (en) | The gene of a kind of high antimer selective epoxidation thing lytic enzyme and coding thereof | |
| CN113667685B (en) | Signal peptide related sequence and application thereof in protein synthesis | |
| CN101684474A (en) | Soluble expression and purification method for recombinant murine leukemia virus reverse transcriptase (MMLV-RT) in colon bacillus | |
| WO1993008289A1 (en) | HEPARINASE GENE FROM $i(FLAVOBACTERIUM HEPARINUM) | |
| CN101429519A (en) | Process for producing recombinant insulin-like growth factor-1(IGF-1) amalgamation protein | |
| CN113801240B (en) | D-psicose-3-epimerase activity aggregate and preparation method and application thereof | |
| CN111499759A (en) | Zinc finger protein-lactoferrin fusion protein with cell membrane penetrating property and preparation and application thereof | |
| CN102021173B (en) | Preparation method for soluble truncated human tumor necrosis factor-related apoptosis inducing ligand (TRAIL) active protein | |
| CN106754851B (en) | TaGPI1mS543A protein and coding gene and application thereof | |
| CN105349557B (en) | A kind of malic enzyme gene RKME2 and its recombinant expression carrier | |
| CN102181413B (en) | Alpha-galactosidase and encoding gene and application thereof | |
| CN104178467A (en) | Recombinant T4 bacteriophage polynucleotide kinase (T4 PNK) and preparation method thereof | |
| CN103382496B (en) | Method for preparation of S-adenosylmethionine | |
| CN113234704B (en) | Method for preparing recombinant serratia marcescens nuclease | |
| CN108300725B (en) | Soluble single-chain antibody superantigen fusion gene and protein, and preparation and application thereof | |
| CN102140444B (en) | Low temperature alkaline phosphatase and preparation method thereof | |
| CN102277370A (en) | Prokaryotic expression vector of candida boidinii formate dehydrogenase, and construction method and application thereof | |
| CN110029093B (en) | Recombinant glucose dehydrogenase and preparation method and encoding gene thereof | |
| CN113025591B (en) | Farnesyl transferase variant and preparation method thereof | |
| CN114621352B (en) | Silicon fusion protein, preparation and application | |
| CN113584054B (en) | DNA molecules encoding arginine deiminase and uses thereof | |
| CN108117599A (en) | The recombination expression and purification process of Ssm6a and its fusion protein used | |
| CN113817696B (en) | Amine oxidase ASAO, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| DD01 | Delivery of document by public notice |
Addressee: Xu Weiguo Document name: Notification that Entitlement to Patent Deemed Abandoned |
|
| AD01 | Patent right deemed abandoned |
Effective date of abandoning: 20100331 |
|
| C20 | Patent right or utility model deemed to be abandoned or is abandoned |