CN103952416A - Two transcription factors for deastringency of harvested persimmons and application thereof - Google Patents
Two transcription factors for deastringency of harvested persimmons and application thereof Download PDFInfo
- Publication number
- CN103952416A CN103952416A CN201410173711.9A CN201410173711A CN103952416A CN 103952416 A CN103952416 A CN 103952416A CN 201410173711 A CN201410173711 A CN 201410173711A CN 103952416 A CN103952416 A CN 103952416A
- Authority
- CN
- China
- Prior art keywords
- seq
- persimmon
- sequence
- deastringency
- dkerf19
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/20—Reduction of greenhouse gas [GHG] emissions in agriculture, e.g. CO2
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides two transcription factors (DkERF19 and DkERF22) for deastringency of harvested persimmons. By utilizing the overall length sequence of DkERF19 and DkERF22, gene clone is carried out by a cDNA (complementary deoxyribonucleic acid) tail end rapid amplification technology according to the database information of RNA-Seq (ribose nucleic acid sequence) of the persimmons; then the gene relative transcription level is analyzed; according to the real-time quantification PCR (polymerase chain reaction) result, the expression quantity of the two transcription factors is remarkably improved in deastringency of the harvested persimmons through carbon dioxide; the activity analysis of a target gene is further regulated and controlled, according to the analysis result of dual-luciferase, the promoter activities of deastringency target genes DkPDC2 and DkPDC3 of the persimmon are respectively improved, so that the deastringency target genes can be used for deastringency of the harvested persimmons. The two transcription factors can be used in regulating and controlling deastringency of the harvested persimmons.
Description
Technical field
The invention belongs to plant molecular biotechnology and genetically engineered field, relate to participate in adopting two novel transcription factors that rear persimmon takes away the puckery taste (
dkERF19with
dkERF22) and application.
Background technology
Persimmon originates in China, its delicious flavour, good to human health, East Asia Region (China, Japan, Korea S etc.) one of most popular fruit, persimmon fruit unique distinction is that its fruit can accumulate a large amount of tannin (PAs) between the growth period, tannin is polymer substance, and wherein soluble tannin is the person that mainly do not present of persimmon astringent taste.
Persimmon can be divided into two kinds of sweet persimmon and puckery persimmons according to its type of taking away the puckery taste.Sweet persimmon is grown the early stage ability of losing syntannin, can naturally take away the puckery taste in the tree, direct-edible when maturation is gathered; But astringent persimmon fruit is real in accumulating a large amount of tannin, after adopting, must processes and can eat through taking away the puckery taste.The real acerbity removing method of astringent persimmon fruit is a lot, the upper ethanol steam parcel of for example tree fruit method, and the carbonic acid gas of high density or nitrogen treatment, warm water soaking or alternate freezing and thawing etc., most widely used in wherein studying and producing is the carbon dioxide treatment of high density.The acetaldehyde that in high concentration carbon dioxide processing, persimmon anaerobic respiration produces plays an important role in it takes away the puckery taste process, and wherein ethanol dehydrogenase (ADH) and pyruvic carboxylase (PDC) are the synthetic key enzymes of acetaldehyde in persimmon, member
dkADH1,
dkPDC2with
dkPDC3participate in taking away the puckery taste of persimmon as crucial target gene.
In recent years, the research of anaerobic respiration had been deep into transcriptional control level.Transcription factor is that a class can be passed through special cis-acting elements in recognition structure gene promoter and the regulatory factor of adjustment structure genetic transcription.In the genome of model plant Arabidopis thaliana, there is more than 1500 transcription factor of genes encoding of 5%, the regulate process of the various biological metabolisms of they participation plant, is also that plant adapts to various biologies or the necessary regulatory factor of abiotic stress, plays irreplaceable effect in vital movement.Therefore, the checking of different transcription factor gene functions has become the focus of current research, is the compulsory homework of various physiological mechanism analysis researchs.
As the important transcription factor of a class, the ethylene responses factor (Ethylene Response Factor, ERF) the 7th subtribe member of family plays a crucial role in the anaerobic respiration process of plant Hypoxia Stress.In model plant Arabidopis thaliana, find ERF family member
hRE1with
rAP2.2participate in Hypoxia Stress by regulation and control ADH and PDC.The research of persimmon is found, multiple ERF members process that can participate in taking away the puckery taste after adopting of astringent persimmon fruit reality, in ethylene signaling approach in persimmon
dkERF1,
dkERF4,
dkERF5with
dkERF6deng 4
eRFmember's process that may participate in taking away the puckery taste after persimmon is adopted;
dkERF9with
dkERF10can regulate and control respectively anaerobic respiration genes involved
dkADH1with
dkPDC2the promotor of gene and then complete taking away the puckery taste of persimmon.
Summary of the invention
The object of this invention is to provide and participate in adopting two transcription factors that rear persimmon takes away the puckery taste, described two transcription factors are
dkERF19with
dkERF22, its nucleotide sequence is as shown in SEQ:NO. 14, SEQ:NO. 15.
Another object of the present invention is to provide the application in deastringency of persimmon after regulation and control are adopted of described two transcription factors.
dkERF19with
dkERF22it is as follows that the concrete steps that rear persimmon takes away the puckery taste are adopted in participation:
1, gene clone
According to the RNA-Seq database information of persimmon, filter out two and may participate in adopting ethylene responses factor Unigene46180 and the Unigene16466 that rear persimmon takes away the puckery taste, application sequence is the primer of SEQ:NO. 1 and SEQ:NO. 2 and SEQ:NO. 3 and SEQ:NO. 4, utilizes 3'cDNA end rapid amplifying (3'RACE) technology to obtain respectively
dkERF19(sequence is SEQ:NO. 5) and
dkERF22the 3'UTR sequence of (sequence is SEQ:NO. 6), and then application sequence is the primer of SEQ:NO. 7 and SEQ:NO. 8, utilizes 5'cDNA end rapid amplifying (5'RACE) technology to obtain respectively
dkERF19the 5'UTR sequence of (sequence is SEQ:NO. 9), splice the sequence obtaining and be respectively the primer of SEQ:NO. 10 and SEQ:NO. 11 and SEQ:NO. 12 and SEQ:NO. 13 according to 3' and 5'UTR, this design of primers comprises initiator codon and terminator codon, and amplification obtains two transcription factors respectively
dkERF19(sequence is SEQ:NO. 14) and
dkERF22the full length sequence of (sequence is SEQ:NO. 15).
2, gene relative expression component analysis:
Foundation
dkERF19(SEQ:NO. 5) and
dkERF22the 3'UTR sequence of (SEQ:NO. 6) designs respectively real-time quantitative PCR (QPCR) special primer SEQ:NO. 16 and SEQ:NO. 17 and SEQ:NO. 18 and SEQ:NO. 19, PCR product comprises terminator codon, length is respectively 109 bp and 162 bp, and primer specificity is through melting point curve analysis, gel electrophoresis analysis and QPCR product sequence verification again.Extract respectively through carbonic acid gas (CO
2) take away the puckery taste and process and be not the rear persimmon RNA of adopting of any processing, reverse transcription synthesizes cDNA.With reference to Ssofast EvaGreen Supermix kit(Bio-Rad, the U.S.) specification sheets, gene relative expression quantity in application CFX96 instrument (Bio-Rad, the U.S.) analytic sample.
3, regulation and control target gene activation analysis:
To deposit in glycerol stock (transcription factor and the promotor) streak inoculation of-80 DEG C in containing on the LB solid medium of 25 μ g/ml gentamicins, 5 μ g/ml tsiklomitsins and 50 μ g/ml kantlex, cultivate 36-48 h for 28 DEG C, choose a small amount of bacterium colony and be applied on new identical LB solid medium, cultivate 12-24 h for 28 DEG C.The well-grown bacterium colony of scraping, with penetrating fluid (10 mM MES, 10 mM MgCl
2, 150 mM Syringylethanones, pH 5.6) suspend, adjust its OD
600it is 0.75 left and right.Bacterial strain containing transcription factor and structure gene promotor is pressed 10:1 volume mixture, then with asepsis injector, penetrating fluid is injected to the Ben Shi tobacco leaf of 6 weeks sizes, after 3 days, apply Dual-Luciferase Reporter Assay System(Promega, and Modulus Luminometer(Promega USA), USA) ratio of two kinds of luciferases (LUC and REN) in detection blade, analyzes interaction between transcription factor and target gene promotor accordingly.
Wherein in step (1): in RACE program, first round PCR program is 94 DEG C, 5min, 94 DEG C of 10 s and 72 DEG C of 2m30 s of 5 circulations, 94 DEG C of 10 s of 5 circulations, 70 DEG C of 30s and 72 DEG C of 2m30 s, 94 DEG C of 10 s of 30 circulations, 67 DEG C of 30s and 72 DEG C of 2m30 s, 72 DEG C of 10m, 4 DEG C of hold.Second to take turns PCR program be 94 DEG C, 5min, 94 DEG C of 10 s of 30 circulations, 65 DEG C of 30s and 72 DEG C of 2m30 s, 72 DEG C of 10m, 4 DEG C of hold.
In step (2): the CFX96 instrument of application Bio-Rad completes.Adopt 20 μ l systems: wherein 10 μ l 2 × Ssofast EvaGreen Supermix (Bio-Rad, the U.S.), 1.0 μ l upstream primers (10 μ M), 1.0 μ l downstream primers (10 μ M), cDNA and the 6.0 μ l H of 2.0 μ l dilutions
2o.PCR response procedures is: 94 DEG C, and 10 min; 94 DEG C of 10 s and 60 DEG C of 30 s of 45 circulations.
In step (3): the Fast stat high fidelity PCR system enzyme that construction of expression vector is selected, PCR system is Buffer(with Mgcl
23 μ l, and dNTP (2.5 μ are 2.4 μ l m), the each 1 μ l of Primer, and cDNA 0.6 μ l, enzyme 0.3 μ l, water 21.3 μ are l).
In step (3): will deposit in glycerol stock (transcription factor and the promotor) streak inoculation of-80 DEG C in containing on the LB solid medium of 25 μ g/ml gentamicins, 5 μ g/ml tsiklomitsins and 50 μ g/ml kantlex, cultivate 36-48h for 28 DEG C, choose a small amount of bacterium colony and be applied on new identical LB solid medium, cultivate 12-24 h for 28 DEG C.The well-grown bacterium colony of scraping, with penetrating fluid (10 mM MES, 10 mM MgCl
2, 150 mM Syringylethanones, pH 5.6) suspend, adjust its OD
600it is 0.75 left and right.Bacterial strain containing transcription factor and structure gene promotor is pressed 10:1 volume mixture, then with asepsis injector, penetrating fluid is injected to the Ben Shi tobacco leaf of 6 weeks sizes, after 3 days, apply Dual-Luciferase Reporter Assay System(Promega, and Modulus Luminometer(Promega USA), USA) ratio of two kinds of luciferases (LUC and REN) in detection blade, analyzes interaction between transcription factor and target gene promotor accordingly.
The present invention is according to the RNA-Seq database information of persimmon, and application cDNA end rapid amplifying (RACE) technology clone obtains two ERF transcription factors
dkERF19with
dkERF22.Compared with the ERF member of taking away the puckery taste with the participation persimmon of finding,
dkERF19with
dkERF22belong to respectively the 9th and the tenth subtribe, the carbonic acid gas (CO that persimmon takes away the puckery taste after can making to adopt
2) in treating processes,
dkERF19with
dkERF22expression amount significantly raise, and
dkERF19with
dkERF22can strengthen respectively the persimmon target gene that takes away the puckery taste
dkPDC2with
dkPDC3promoter activity, and then participate in adopting taking away the puckery taste of rear persimmon.Comprehensive above-mentioned functions feature,
dkERF19with
dkERF22be two brand-new, can regulate and control to adopt the rear persimmon process of taking away the puckery taste
eRFtranscription factor.And this transcription factor proceeds to the real rear expection of astringent persimmon fruit can make the real astringent taste of astringent persimmon fruit remove, need not be direct-edible through the processing side of taking away the puckery taste.
The present invention on the basis of above-mentioned persimmon research, further identify two brand-new
eRFtranscription factor,
dkERF19with
dkERF22, belong to respectively ERF family the 9th and the tenth subtribe.
dkERF19with
dkERF22there is following feature: take away the puckery taste in process at persimmon,
dkERF19with
dkERF22expression amount significantly raise;
dkERF19with
dkERF22can significantly strengthen the persimmon target gene that takes away the puckery taste
dkPDC2with
dkPDC3the activity of promotor, and then participate in taking away the puckery taste of persimmon.
Brief description of the drawings
Fig. 1 is in persimmon fruit
dkERF19with
dkERF22the gene expression pattern taking away the puckery taste in processing at carbonic acid gas.
Fig. 2 is transcription factor
dkERF19with
dkERF22right
dkPDC2with
dkPDC3the regulating and controlling effect of promotor.
Specific embodiment
Below in conjunction with drawings and Examples, the present invention is further elaborated, but embodiment does not limit the scope of the invention.Conventional genetic manipulation method is with reference to " molecular cloning experiment guide " (third edition) in the following embodiments.Not there is the gene of this function
dkERF7, and
dkERF19with
dkERF22for example, right
dkERF19with
dkERF22participation is adopted the rear persimmon process of taking away the puckery taste and is specifically addressed.
embodiment 1:the acquisition of two transcription factors
1.
dkERF19with
dkERF22gene clone
According to the RNA-Seq database information of persimmon, filter out two and may participate in adopting ethylene responses factor Unigene46180 and the Unigene16466 that rear persimmon takes away the puckery taste, application sequence is the primer of SEQ:NO. 1 and SEQ:NO. 2 and SEQ:NO. 3 and SEQ:NO. 4, utilizes 3'cDNA end rapid amplifying (3'RACE) technology to obtain respectively
dkERF19(sequence is SEQ:NO. 5) and
dkERF22the 3'UTR sequence of (sequence is SEQ:NO. 6), and then application sequence is the primer of SEQ:NO. 7 and SEQ:NO. 8, utilizes 5'cDNA end rapid amplifying (5'RACE) technology to obtain respectively
dkERF19the 5'UTR sequence of (sequence is SEQ:NO. 9), splice the sequence obtaining and be respectively the primer of SEQ:NO. 10 and SEQ:NO. 11 and SEQ:NO. 12 and SEQ:NO. 13 according to 3' and 5'UTR, this design of primers comprises initiator codon and terminator codon, and amplification obtains two transcription factors respectively
dkERF19(sequence is SEQ:NO. 14) and
dkERF22the full length sequence of (sequence is SEQ:NO. 15).
2. real-time quantitative fluorescence PCR analysis
dkERF19with
dkERF22expression pattern in carbon dioxide treatment and untreated persimmon;
Foundation
dkERF19(SEQ:NO. 5) and
dkERF22the 3'UTR sequence of (SEQ:NO. 6) designs respectively real-time quantitative PCR (QPCR) special primer SEQ:NO. 19 and SEQ:NO. 20 and SEQ:NO. 21 and SEQ:NO. 22, PCR product comprises terminator codon, length is respectively 109bp and 162bp, and primer specificity is through melting point curve analysis, gel electrophoresis analysis and QPCR product sequence verification again.Extract respectively through carbonic acid gas (CO
2) take away the puckery taste and process and be not the rear persimmon RNA of adopting of any processing, reverse transcription synthesizes cDNA.With reference to Ssofast EvaGreen Supermix kit(Bio-Rad, the U.S.) specification sheets, gene relative expression quantity in application CFX96 instrument (Bio-Rad, the U.S.) analytic sample.Real-time PCR Analysis shows and contrast compares, the induction that high concentration carbon dioxide can be in various degree
dkERF19with
dkERF22genetic expression (accompanying drawing 1).
3.dual-Luciferase system
To deposit in glycerol stock (transcription factor and the promotor) streak inoculation of-80 DEG C in containing on the LB solid medium of 25 μ g/ml gentamicins, 5 μ g/ml tsiklomitsins and 50 μ g/ml kantlex, cultivate 36-48h for 28 DEG C, choose a small amount of bacterium colony and be applied on new identical LB solid medium, cultivate 12-24h for 28 DEG C.The well-grown bacterium colony of scraping, with penetrating fluid (10 mM MES, 10 mM MgCl
2, 150 mM Syringylethanones, pH 5.6) suspend, adjust its OD
600it is 0.75 left and right.Bacterial strain containing transcription factor and structure gene promotor is pressed 10:1 volume mixture, then with asepsis injector, penetrating fluid is injected to the Ben Shi tobacco leaf of 6 weeks sizes, after 3 days, apply Dual-Luciferase Reporter Assay System(Promega, and Modulus Luminometer(Promega USA), USA) ratio of two kinds of luciferases (LUC and REN) in detection blade, analyzes interaction between transcription factor and target gene promotor accordingly.Dual-Luciferase systems analysis is found
dkERF19with
dkERF22target gene can regulate and control to take away the puckery taste respectively
dkPDC2with
dkPDC3promotor (accompanying drawing 2).
embodiment 2:the specific embodiment of the application of two transcription factors is described
Fruit tree is as perennial woody plant, and it is more difficult that genetically modified work is carried out, and therefore, we can make the astringent taste of astringent persimmon fruit reality remove after expecting that these two transcription factors proceed in astringent persimmon fruit reality, need not take away the puckery taste direct-edible.
The present invention utilizes RACE, and real-time quantitative PCR and tobacco Dual-Luciferase systems technology separate and obtain two novel transcription factors
dkERF19with
dkERF22.These two genes expression amount in persimmon takes away the puckery taste process significantly raises, and
dkERF19with
dkERF22can significantly strengthen the persimmon target gene that takes away the puckery taste
dkPDC2with
dkPDC3the activity of promotor, and then participate in taking away the puckery taste of persimmon.And this transcription factor proceeds to the real rear expection of astringent persimmon fruit can make the real astringent taste of astringent persimmon fruit remove, need not be direct-edible through the processing side of taking away the puckery taste.
<110> Zhejiang University
<120> participates in adopting rear persimmon takes away the puckery taste two transcription factors and application
<160>?19
<210>?1
<211>?23
<212> base sequence
<213> artificial sequence
<400>?1
GGAGCTTCGTCGGAGAGCAATAA
<210>?2
<211>?25
<212> base sequence
<213> synthetic
<400>?2
AGCTTCGTCGGAGAGCAATAATTCG
<210>?3
<211>?25
<212> base sequence
<213> synthetic
<400>?3
ACGAAAGCACAAGCGAAACCCTTAC
<210>?4
<211>?25
<212> base sequence
<213> synthetic
<400>?4
TTATAACGACGAGCTCCAGCAAAGC
<210>?5
<211>?747
<212>DNA sequence
<213> persimmon (Diospyros kaki)
<400>?5
AGCTTCGTCGGAGAGCAATAATTCGTTCACCGGAGGAATGAATGGGGGCGGCAACAAAGAAGAGGAGGTGAACTCCAGGCCGAACGGAGAAGAAGAAGAATTCGAGCCGGGGAAGAAGAAGGAGAAGAAGGAATCGTACAGGGGAGTCCGGCGGAGGCCGTGGGGGAAGTTCGCGGCGGAGATAAGGGACTCGACGAGGAACGGCATGCGGGTGTGGCTGGGGACCTTCGACAGCGCGGAGGAGGCGGCGATGGCGTACGACCAGGCGGCGTTGGCTATGCGGGGGACGAGGGCGGTGCTCAATTTTCCGGCGGAGAGGGTGGTGGAGTCGCTGAGGGGGATGGAGTGCGGGTGCGAGGAAGGTGCGTCCCCGGTGGTGGCTCTTAAGAAGAGGCACTCCATGGGGAAGCGGCCAGCCGGCAAACGGAGCAGAGTGGAGGAGGTGAAGCCGGAATTTGTGATGGTTTTGGAGGATTTGGGGGCTGATTACTTGGAGGAGCTTTTGTCTTCTTCCCAGACTCAAAGTATCTGATGATGATGAACTCCTTATCTTCTTCTTCCTTTCCAGTTCCATTAATTTTGCTTCCTTCTCTTATGTCCCTGTCTTTCCCATTTTGTTTCTTCTTCCCACTTGCTAGTGATCTGAGGCCATTCATGGCCCTCATCTCTGTAAATTAACCTCAAAATTGTGAATTAGAGGACCCCCCCGCTGTTACTACTGAAAAAAaaAaAaaaaaaaAaAAaaaA
<210>?6
<211>?792
<212> DNA sequence dna
<213> persimmon (Diospyros kaki)
<400>6
TTATAACGACGAGCTCCAGCAAAGCCGCCGGACCTTCTGCATCGACAACAATGGCAAGAAGGTGAACAAAGACAAAACGGTAACCGAAATTGGGACGGCCAGTGAGCAGCTCTTCGAGAAGAACGTGACGCCGAGCGACGTTGGAAAACTGAACCGGCTCGTGATCCCGAAGCAATACGCGGAAAGGCACTTTCCGCTGCAGATTGGAGGCAACTCGAAGGGCTTGCTGTTGAATTTCAAGGACGTGGCCGGAAAAGTTTGGCGATTCCGGTACTCGTACTGGAACAGTAGCCAGAGCTATGTTCTGACCAAAGGCTGGAGCCGATTTGTGAAGGAGAAGAATTTGAAGGCCGGAGACGTCGTCAGCTTCCACCGGTCCACCGGCGCCGAGAAGCAGCTGTACATAGCTTGCAAGCCTAGAGCGGAGTCGGCCGTGGCAAGGTTTTCGATTCCGGCCAGCCAAGTTCAGGCGCCCGTGCAGATTCTGAGACTATTTGGAGTGGACATATTTAAGGTTCCGGCAGTGAGCTGTGTTGTTGACGGTAAGAGAAGTAGAGAGATGGAGTTGTTGGCATTGGAGTGCAGTAAGAAGCCAAGAATCATTGGAGCTTTGTAACATTTTCTCCTTCTTCTTCTT(C)CTTCTCTATCGGCTCCAGTTTTTCGTTTTGGCCTTCTGTGAAAGTTGACTTGTATAGTATGTTACAGAGACTGTCTAATATATAGTTCCAAACACAAACAAATTATACCATATATAATGCTAAAGCTGTTGATTATCGCAAAAAAAAAAAAA
<210>?7
<211>?26
<212> base sequence
<213> synthetic
<400>?7
TCCGCCAGAACGCCGAACAGCAGCAT
<210>?8
<211>?26
<212> base sequence
<213> synthetic
<400>?8
CCTCTTCTTTGTTGCCGCCCCCATTC
<210>?9
<211>?223
<212> DNA sequence dna
<213> persimmon (Diospyros kaki)
<400>?9
AGACTCCAGAGCCTGCAATTTTGATTTCGGGGATTTTAATAAGAACAAGAAGTGAAAGGAGAAACAAACTCCATGGATTCTTTCTGGATCCACGGTTCACTGCCGTTTGACGTCAACGACTCCGAGGAGATGCTGCTGTTCGGCGTTCTGGCGGAGGGAGCTTCGTCGGAGAGCAATAATTCGTTCACCGGAGGAATGAATGGGGGCGGCAACAAAGAAGAGG
<210>?10
<211>?23
<212> base sequence
<213> synthetic
<400>?10
TGAAAGGAGAAACAAACTCCATG
<210>?11
<211>?22
<212> base sequence
<213> DNA sequence dna
<400>?11
TAAGGAGTTCATCATCATCAGA
<210>?12
<211>?21
<212> base sequence
<213> DNA sequence dna
<400>?12
ATGGACGGTATTTACGTGAACG
<210>?13
<211>?23
<212> base sequence
<213> synthetic
<400>?13
AGAAGGAGAAAATGTTACAAAGC
<210>?14
<211>?618
<212> DNA sequence dna
<213> persimmon (Diospyros kaki)
<400>?14
ATGGATTCTTTCTGGATCCACGGTTCACTGCCGTTTGACGTCAACGACTCCGAGGAGATGCTGCTGTTCGGCGTTCTGGCGGAGGGAGCTTCGTCGGAGAGCAATAATTCGTTCACCGGAGGAATGAATGGGGGCGGCAACAAAGAAGAGGAGGTGAACTCCAGGCCGAACGGAGAAGAAGAAGAATTCGAGCCGGGGAAGAAGAAGGAGAAGAAGGAATCGTACAGGGGAGTCCGGCGGAGGCCGTGGGGGAAGTTCGCGGCGGAGATAAGGGACTCGACGAGGAACGGCATGCGGGTGTGGCTGGGGACCTTCGACAGCGCGGAGGAGGCGGCGATGGCGTACGACCAGGCGGCGTTGGCTATGCGGGGGACGAGGGCGGTGCTCAATTTTCCGGCGGAGAGGGTGGTGGAGTCGCTGAGGGGGATGGAGTGCGGGTGCGAGGAAGGTGCGTCCCCGGTGGTGGCTCTTAAGAAGAGGCACTCCATGGGGAAGCGGCCAGCCGGCAAACGGAGCAGAGTGGAGGAGGTGAAGCCGGAATTTGTGATGGTTTTGGAGGATTTGGGGGCTGATTACTTGGAGGAGCTTTTGTCTTCTTCCCAGACTCAAAGTATCTGA
<210>?15
<211>?1020
<212> DNA sequence dna
<213> persimmon (Diospyros kaki)
<400>?15
ATGGACGGTATTTACGTGAACGAAAGCACAAGCGAAACCCTTACAATTGCAGCGGCGTCGCCGGCCACGAAGTCGCCGGAGAGCCTTGTAGACTCCGACGGCGGTGGCGAGGTCGAGTCCCGGGGGAAGCTGCCGTCGTCGAGGTTCAAAGGCGTGGTTCCGCAGCCGAACGGCCGGTGGGGGGCCCAGATCTACGAGAAGCACCAGCGCGTCTGGCTCGGAACTTTCAACGAAGAGGAAGAAGCCGCCCGGGCGTACGACGTGGCAGCCCAGCGCTTCCGCGGCCGGGACGCCGTCACCAACCTCAGGCTGCTAGCGGCGGAGGGCGACGCCGACGAGGCGGAAGCCGCTTTTTTGAGTTCCCACTCAAAGGCCGAGATCGTCGACATGCTCCGGAAACACACTTATAACGACGAGCTCCAGCAAAGCCGCCGGACCTTCTGCATCGACAACAATGGCAAGAAGGTGAACAAAGACAAAACGGTAACCGAAATTGGGACGGCCAGTGAGCAGCTCTTCGAGAAGAACGTGACGCCGAGCGACGTTGGAAAACTGAACCGGCTCGTGATCCCGAAGCAATACGCGGAAAGGCACTTTCCGCTGCAGATTGGAGGCAACTCGAAGGGCTTGCTGTTGAATTTCAAGGACGTGGCCGGAAAAGTTTGGCGATTCCGGTACTCGTACTGGAACAGTAGCCAGAGCTATGTTCTGACCAAAGGCTGGAGCCGATTTGTGAAGGAGAAGAATTTGAAGGCCGGAGACGTCGTCAGCTTCCACCGGTCCACCGGCGCCGAGAAGCAGCTGTACATAGCTTGCAAGCCTAGAGCGGAGTCGGCCGTGGCAAGGTTTTCGATTCCGGCCAGCCAAGTTCAGGCGCCCGTGCAGATTCTGAGACTATTTGGAGTGGACATATTTAAGGTTCCGGCAGTGAGCTGTGTTGTTGACGGTAAGAGAAGTAGAGAGATGGAGTTGTTGGCATTGGAGTGCAGTAAGAAGCCAAGAATCATTGGAGCTTTGTAA
<210>?16
<211>?23
<212> base sequence
<213> synthetic
<400>?16
CCCAGACTCAAAGTATCTGATGA
<210>?17
<211>?618
<212> base sequence
<213> synthetic
<400>?17
AAAGACAGGGACATAAGAGAAGG
<210>?18
<211>?1020
<212> base sequence
<213> synthetic
<400>?18
GCAGTAAGAAGCCAAGAATCAT
<210>?19
<211>?1020
<212> base sequence
<213> synthetic
<400>?19
GAAAAACTGGAGCCGATAGAG
Claims (3)
1. participate in adopting two transcription factors that rear persimmon takes away the puckery taste, it is characterized in that: described two transcription factors are
dkERF19with
dkERF22, its nucleotide sequence is as shown in SEQ:NO. 14, SEQ:NO. 15.
2. participate in adopting according to claim 1 two transcription factors application in deastringency of persimmon after regulation and control are adopted that rear persimmon takes away the puckery taste.
3. application according to claim 2, is characterized in that, realizes by following steps:
(1) gene relative expression component analysis: be SEQ:NO.'s 5 according to sequence
dkERF19with sequence be SEQ:NO.'s 6
dkERF223'UTR sequence design respectively real-time quantitative PCR special primer SEQ:NO. 16 and SEQ:NO. 17 and SEQ:NO. 18 and SEQ:NO. 19, PCR product comprises terminator codon, length is respectively 109bp and 162bp, primer specificity is through melting point curve analysis, gel electrophoresis analysis and real-time quantitative PCR product sequence verification again, extract respectively through carbonic acid gas take away the puckery taste process and do not do the adopting of any processing after persimmon RNA, reverse transcription synthesizes cDNA, with reference to Ssofast EvaGreen Supermix kit specification sheets, gene relative expression quantity in application CFX96 instrumental analysis sample,
(2) regulation and control target gene activation analysis: application primer SEQ:NO. 13 and SEQ:NO. 14 and SEQ:NO. 15 and SEQ:NO. 16, SEQ:NO. 17 increases respectively
dkERF19with SEQ:NO. 18
dkERF22full length sequence, carry to pGreenII 0029 62-SK expression vector, by finally confirming that the correct expression vector electricity building is transformed in GV3101::pSoup Agrobacterium competent cell, preserve the positive colony screening with 20% sterile glycerol, deposit in-80
oc, utilizes Dual-Luciferase system, analyzes different transcription factors and the persimmon target gene that takes away the puckery taste
dkPDC2with
dkPDC3between promotor, whether there is mutual work, verify accordingly whether transcription factor participates in adopting the regulation and control that rear persimmon takes away the puckery taste.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410173711.9A CN103952416B (en) | 2014-04-28 | 2014-04-28 | Participate in adopting two transcription factor and the application that rear persimmon takes away the puckery taste |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410173711.9A CN103952416B (en) | 2014-04-28 | 2014-04-28 | Participate in adopting two transcription factor and the application that rear persimmon takes away the puckery taste |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103952416A true CN103952416A (en) | 2014-07-30 |
| CN103952416B CN103952416B (en) | 2016-06-15 |
Family
ID=51329768
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410173711.9A Active CN103952416B (en) | 2014-04-28 | 2014-04-28 | Participate in adopting two transcription factor and the application that rear persimmon takes away the puckery taste |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103952416B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807068A (en) * | 2021-04-16 | 2022-07-29 | 华中农业大学 | Acetaldehyde dehydrogenase gene DkALDH10 and application thereof |
| CN115925843A (en) * | 2022-07-25 | 2023-04-07 | 华中农业大学 | Persimmon tannin biosynthesis positive regulation transcription factor DkMYB21 gene, protein and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2163639A1 (en) * | 2008-09-04 | 2010-03-17 | Institute National Polytechnique de Toulouse | New tomato ethylene response factors and uses thereof |
| CN102732536A (en) * | 2012-06-14 | 2012-10-17 | 浙江大学 | Cloning and transient expression method of persimmon deastringency related genes |
| CN102747068A (en) * | 2012-06-14 | 2012-10-24 | 浙江大学 | Method for regulating cloning and transcription of lignin metabolism-related ethylene response factors (ERFs) in Eriobotrya japonica Lindl. |
| JP2013092900A (en) * | 2011-10-25 | 2013-05-16 | Univ Of Yamanashi | Erf (electro rheological fluids) actuator |
-
2014
- 2014-04-28 CN CN201410173711.9A patent/CN103952416B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2163639A1 (en) * | 2008-09-04 | 2010-03-17 | Institute National Polytechnique de Toulouse | New tomato ethylene response factors and uses thereof |
| JP2013092900A (en) * | 2011-10-25 | 2013-05-16 | Univ Of Yamanashi | Erf (electro rheological fluids) actuator |
| CN102732536A (en) * | 2012-06-14 | 2012-10-17 | 浙江大学 | Cloning and transient expression method of persimmon deastringency related genes |
| CN102747068A (en) * | 2012-06-14 | 2012-10-24 | 浙江大学 | Method for regulating cloning and transcription of lignin metabolism-related ethylene response factors (ERFs) in Eriobotrya japonica Lindl. |
Non-Patent Citations (2)
| Title |
|---|
| TING MIN: "Ethylene-responsive transcription factors interact with promoters of ADH and PDC involved in persimmon (Diospyros kaki)fruit de-astringency", 《JOURNAL OF EXPERIMENTAL BOTANY》, vol. 63, no. 18, 31 December 2012 (2012-12-31), pages 6393 - 6405 * |
| 殷学仁等: "乙烯信号转导与果实成熟衰老的研究进展", 《园艺学报》, vol. 36, no. 1, 31 December 2009 (2009-12-31), pages 133 - 140 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114807068A (en) * | 2021-04-16 | 2022-07-29 | 华中农业大学 | Acetaldehyde dehydrogenase gene DkALDH10 and application thereof |
| CN114807068B (en) * | 2021-04-16 | 2022-12-27 | 华中农业大学 | Acetaldehyde dehydrogenase gene DkALDH10 and application thereof |
| CN115925843A (en) * | 2022-07-25 | 2023-04-07 | 华中农业大学 | Persimmon tannin biosynthesis positive regulation transcription factor DkMYB21 gene, protein and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103952416B (en) | 2016-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2714913A2 (en) | Transcription terminator sequences | |
| CN104342457A (en) | Method for targetedly integrating exogenous gene into target gene | |
| CN106520824A (en) | Multi-target-point editing system and application thereof | |
| CN107365793A (en) | A kind of method of extensive genome editor suitable for plant | |
| CN110938637B (en) | Homologous gene of phytophthora resistance negative regulatory factor StMKK1 and application thereof | |
| Barbrook et al. | Polyuridylylation and processing of transcripts from multiple gene minicircles in chloroplasts of the dinoflagellate Amphidinium carterae | |
| CN102002101B (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| CN110923251A (en) | Tobacco polyphenol oxidase NtPPO4 and application thereof | |
| CN103333901B (en) | Liriodendron hybrid LhWOX1 gene and application thereof | |
| CN112662701A (en) | Application of miRNA408 in regulation and control of cadmium accumulation of crops | |
| CN110358776B (en) | Rhizoctonia solani pathogenic related gene and application thereof | |
| CN109355290B (en) | Plant circular RNA expression frame and application thereof | |
| CN108559731A (en) | A kind of human embryonic stem cell line of tetracycline-regulated gene expression and its application | |
| CN103952416A (en) | Two transcription factors for deastringency of harvested persimmons and application thereof | |
| CN109825501A (en) | A kind of long-chain non-coding RNA T5120 and application thereof from arabidopsis | |
| CN103602705A (en) | Method for obtaining safely and optionally killed transgenic rice by using artificial micro ribonucleic acids (amiRNAs) | |
| CN108588078B (en) | Tomato late blight-resistant exon circular RNA-EcircRNA45 and cloning, detection and application methods thereof | |
| CN106497928B (en) | Tobacco GCN2 promoters, its expression vector and its application | |
| Li‐Pook‐Than et al. | Relationship between RNA splicing and exon editing near intron junctions in wheat mitochondria | |
| CN107058324A (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivating method | |
| CN106434692A (en) | Applications of rice OsPCF7 gene in culturing high-tillering rice varieties | |
| CN106676129A (en) | Method for improving genome edition efficiency | |
| CN103695422B (en) | Paddy rice root tip specific expression promoter Pro-Os04g24469 and application thereof | |
| CN102121006B (en) | Plant pathogenic bacterium induction type ethylene response factor gene promoter sequence and application thereof | |
| CN109306352A (en) | Papaya U6 promoter gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |